| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Physiology and Biophysics (M.R., A.S., J.M., C.O.S., J.M.B.-S., G.G.), University of Illinois at Chicago, Chicago, Illinois 60612; and Department of Obstetrics (L.T.G.), Gynecology and Womens Health, New Jersey Medical School, Newark, New Jersey 07101
Address all correspondence and requests for reprints to: Dr. Geula Gibori, Department of Physiology and Biophysics, University of Illinois at Chicago, 835 South Wolcott (M/C 901), Chicago, Illinois 60612. E-mail: ggibori{at}uic.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
PRAP is a 32-kDa protein that associates with the cytoplasmic domain of the short form of the PRL receptor (16) and is expressed at high levels in the CL in the rat (17, 18), specifically in the large luteal cells (19). PRAP has been identified as a novel isoform of 17ßHSD (PRAP/17ßHSD7). This enzyme is a potent converter of estrone to estradiol (14, 15) but, in contrast to 17ßHSD1, it does not convert androstenedione to testosterone. PRAP/17ßHSD7 has been found in CL of every species investigated to date (18) and has been cloned from the rabbit (21), marmoset monkey (22), and human (23), in addition to the mouse (14) and rat. The presence of this enzyme in the CL reveals the novel possibility that the CL in general has the capacity to convert estrone and to synthesize estradiol. To date, 11 different isozymes of 17ßHSD have been cloned; however, the only isozymes known to metabolize estrone to estradiol are 17ßHSD1 and PRAP/17ßHSD7.
Abundant expression of PRAP/17ßHSD7 by the rat CL begins around mid-pregnancy (17, 18), coincident with a drop in LH levels (5). Experimentally, LH has been shown to decrease PRAP/17ßHSD7 expression, whereas estradiol has been shown to increase PRAP/17ßHSD7 mRNA levels (17, 24, 25). Down-regulation of PRAP/17ßHSD7 expression in the CL by LH is in marked contrast to the stimulatory effect of this hormone on transcription of 17ßHSD1 in granulosa cells (13) and the drop in LH at mid-pregnancy thus results in a change in the primary ovarian source of estradiol, from follicular granulosa to luteal cells. Tight regulation of estradiol production during pregnancy is essential, as fetal survival in the rodent is negatively affected by high levels of estradiol (26, 27). Increased expression of PRAP/17ßHSD7 also coincides with the transition from ovarian-derived androgens to placental-derived androstenedione as the substrate for luteal estradiol production (10, 11). At the end of pregnancy, beginning around d 18 of gestation, LH levels rise (5) and PRAP/17ßHSD7 mRNA expression drops (17, 24).
The consistent luteal expression of PRAP/17ßHSD7 gene across species, and its tight regulation by hormones critical to luteal function, led us to examine transcriptional elements involved in basal and hormonal-regulated expression of this gene. We initially determined the 5' untranslated region of the PRAP mRNA transcript and cloned a 1.2-kb fragment of genomic DNA 5' to the transcription start site. Sequence comparison between the rat and human 5' genomic regions of PRAP/17ßHSD7 along with EMSA and promoter-reporter studies led to the discovery of conserved enhancer regions in this promoter, as well as the DNA binding site mediating down-regulation by LH.
| Materials and Methods |
|---|
|
|
|---|
5' Rapid amplification of cDNA ends (5' RACE)
RACE was performed using the 5' RACE System, Version 2.0 (Life Technologies, Carlsbad, CA) according to the manufacturers protocol. Briefly, 1 µg of total mRNA isolated from the corpora lutea of d 15 pregnant rats was converted to cDNA through reverse transcription. This cDNA was then capped at its 5' end with poly-C using terminal deoxytransferase. A primer that recognizes a portion of the PRAP cDNA (GAGGTTTAGCTGGGGGTTAGG) was used in a PCR with a poly-G primer to isolate the region of PRAP cDNA 5' to nucleotide 303 of the coding portion. This PCR product was then cloned and sequenced to determine the PRAP 5' UTR sequence
Primer extension
Primer extension was performed using the avian myeloblastosis virus reverse transcriptase primer extension system (Promega, Madison, WI). Once again, RNA from d 15 pregnant rat CL was used. A PRAP-specific primer (GAGGTTTAGCTGGGGGTTAGG) was labeled with 32P via a T4 polynucleotide kinase and then purified and analyzed for labeling efficiency. This radiolabeled primer was then hybridized to luteal RNA and extended using reverse transcriptase. The size of this product was compared with sequencing products of known size using SDS-PAGE and autoradiography.
PRAP/17ßHSD7 promoter cloning
The region of genomic DNA 5' to the transcription start site was cloned using the Promoter Finder DNA walking kit (Clontech, Palo Alto, CA) according to the manufacturers protocol. Two primers specific to the 5' untranslated region of PRAP/17ßHSD7 were used in a two-step nested PCR with two primers to the cap region provided by the kit. The largest piece, about 1.2 kb in size, was cloned and sequenced (sequence shown is consensus of three independent clones). The promoter clone (1166 to +73) was subcloned from the sequencing vector into the KpnI and BglII sites of the pGL3 basic luciferase reporter vector (Promega). The 369-bp promoter was created by digesting the initial construct with HindIII and cloning the resulting truncation into the HindIII site in the pGL3 basic luciferase reporter vector.
The 368, 185, 115, and 52 PRAP promoter constructs were generated via PCR using the Advantage PCR kit (Clontech), primers adding a BglII site (5') and a HindIII site (3') (Table 1
; 10 pmol of each primer per reaction), and the full-length PRAP promoter as a template (100 ng per reaction). The reaction underwent 4 cycles of 25 sec at 94 C and 4 min at 72 C, followed by 16 cycles of 25 sec at 94 C and 4 min at 65 C, and last, 67 C for 4 min. The PCR products were extracted from a 0.7% agarose gel using the GeneClean kit (Q.BIOgene, Irvine, CA), and digested with BglII and HindIII. The digested products were again purified from a 0.7% agarose gel using the GeneClean kit and ligated into pGL3 basic plasmid digested with BglII and HindIII, using T4 DNA ligase.
|
Cell culture and transfection
RCLP cells, a cell line derived from a primary culture of rat luteal cells isolated at d 16 of pregnancy, were cultured in medium 199 (Cellgro/Mediatech, Herndon, VA) containing 10% FBS (Hyclone Labs, Logan, UT) and 2x antibiotic/antimycotic solution (Mediatech). Chinese hamster ovary (CHO) cells were cultured in DMEM/F12 (Sigma-Aldrich, St. Louis, MO) containing 10% FBS and 2x antibiotic/antimycotic solution. COS1 cells were cultured in DMEM (Sigma-Aldrich) containing 10% FBS and 2x antibiotic/antimycotic solution. For transfection, cells were plated at 4060% confluency in six-well plates the afternoon before transfection. Cells were transfected using LIPOFECTAMINE or LIPOFECTAMINE 2000 (Life Technologies) according to the manufacturers protocol. The cells were transfected with the appropriate PRAP/17ßHSD7 promoter constructs and ß-galactosidase expression vector to control for transfection efficiency, each at 0.5 µg per well. Treatments with dimethylsulfoxide (DMSO) or forskolin (100 µM; Sigma-Aldrich) began immediately after transfection, for 6 h.
Luciferase activity
Luciferase and ß-galactosidase activities were measured in cell lysates prepared in 1x reporter lysis buffer (Promega) using a luminometer (Lumat LB 9507 luminometer; EG&G Berthold, Oak Ridge, TN). Luciferase activity was measured using a firefly luciferase assay system (Promega) and ß-galactosidase activity was measured using a luminescent ß-galactosidase system (Clontech), according to the respective manufacturer instructions. Luciferase activity was normalized to ß-galactosidase activity for each lysate.
EMSA
Nuclear extracts from both luteal tissue and cultured cells were prepared as described by Dignam et al. (28) with modifications. Cells or tissue were homogenized in approximately five packed cell volumes of solution A (10 mM HEPES-KOH, pH 7.9; 10 mM KCl; 1.5 mM MgCl2; 0.5 mM dithiothreitol) with a Dounce homogenizer and the nuclear pellet obtained by centrifugation at 12,000 x g for 30 sec. The pellet was then resuspended in 50100 µl of solution B (20 mM HEPES-KOH, pH 7.9; 0.42 mM NaCl; 1.5 mM MgCl2; 25% glycerol; 0.2 mM EDTA; 0.5 mM phenylmethylsulfonylfluoride; 0.5 mM dithiothreitol) and rocked vigorously for 20 min at 4 C. This was then centrifuged for 20 min at 14,000 x g and the supernatant containing the nuclear extract was then dialyzed in 50 vol of 1x binding buffer (20 mM HEPES-KOH, pH 7.9; 0.1 M KCl; 20% glycerol; 0.2 mM EDTA; 0.5 mM phenylmethylsulfonylfluoride; 0.5 mM dithiothreitol) for 5 h. Protein concentration in nuclear extracts was determined using a bicinchoninic acid protein assay (Pierce, Rockford, IL). Five picomoles of each annealed oligonucleotide probe (Table 1
) were labeled using 10 U of T4 polynucleotide kinase (Life Technologies) and 25 µCi of
-labeled 32P ATP (Amersham, Piscataway, NJ) to a specific activity of more than 8000 cpm/fmol. Five micrograms of nuclear extract were incubated with 1 µg of poly(dI-dC) and 50 fmol of probe in 1x binding buffer on ice for 30 min. Cold competitor probes were added to a final concentration of 2.5 pmol, and antibodies in supershift studies were used according to the manufacturers protocol. Antibodies to Sp1 (sc-59, sc-420), GATA-6 (sc-7244), and nuclear factor YA (NF-YA)/CCAAT-binding factor-B (sc-7712) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Samples were run on a 4% nondenaturing polyacrylamide gel in 0.5x Tris borate EDTA buffer at 200 V for 23 h. The gels were then dried and analyzed by autoradiography.
Mutation of PRAP/17ßHSD7 promoter
Mutations to the promoter were made via PCR using the QuikChange or QuikChange II site-directed mutagenesis kits (Stratagene, La Jolla, CA) according to the manufacturers protocol. All mutations were made using the probes shown in Table 1
as primers in the PCR or as indicated, and the 185 or 52 PRAP/17ßHSD7 promoter in pGL3 basic was used as the template. The presence of correct mutations was confirmed through DNA sequencing.
RNA extraction and semiquantitative PCR
RNA was extracted using TRIzol reagent (Life Technologies) following the manufacturers protocol. Luteal RNA was transformed into cDNA via reverse transcription. Custom oligonucleotide primers based on the ribosomal L19 cDNA sequence (5'-CTG AAG GTC AAA GGG AAT GTG-3', 5'-GGA CAG AGT CTT GAT GAT CTC-3') and the PRAP cDNA sequence (5'-AAT TAT GTC AAG GGC CAA AAG ATG-3', 5'-CCT CGC TGG GAC TAA AAG AAG ATT-3') were obtained from Life Technologies and used to amplify the appropriate cDNA templates by PCR. Conditions for each template were optimized so that signals were in the linear range of detection. The PCR products with DNA loading buffer were then separated by gel electrophoresis on a 0.7% agarose gel. L19 concentrations were used as internal control for comparison.
Statistical analysis
One-way (Figs. 2
, 3
, and 5
) or two-way (Figs. 6
and 9
) ANOVA was performed on each data set, followed by the Bonferroni multiple comparisons post test.
|
|
|
|
|
| Results |
|---|
|
|
|---|
The sequence obtained by 5' RACE was used to make primers and clone an 1165-bp fragment 5' to the distal PRAP/17ßHSD7 transcription start site via a PCR-based method, and this sequence is shown in Fig. 1
. This promoter does not contain a classical TATA box; however, the sequence surrounding the more distal start site resembles an initiator sequence (29), which may be involved in transcription initiation. Furthermore, sequence analysis found a number of putative transcription factor binding sites; however, it contained neither a consensus estrogen response element (ERE) nor a typical cAMP response element, which are the sites most frequently associated with estrogen and LH signaling, respectively. It did, however, find three ER half sites, which may allow for estrogen signaling in association with other transcription factors, such as Sp1 (30) or AP-1 (31). This sequence has been submitted to GenBank (accession no. AY390340).
|
Due to the lack of convenient restriction sites, smaller PRAP promoter constructs were generated through PCR-based cloning, and these constructs were transfected into RCLP cells. These shorter constructs had higher promoter activity (compare 369 in Fig. 2A
to 368 in Fig. 2B
) presumably resulting from the loss of the translation start codon during PCR derivation. As shown in Fig. 2B
, PRAP/17ßHSD7 promoter activity was greatly diminished with the deletion of the region between 185 and 115, demonstrating the existence of a major enhancer(s) of basal (in the absence of hormonal stimulation) activity in this region.
To examine the specificity of this enhancer, segments of the PRAP/17ßHSD7 were placed in the pGL3 promoter vector, in which luciferase expression is under control of an SV40 promoter. These constructs were transfected into different cell types to examine their effect on transcription of a heterologous promoter. Two segments upstream of the putative enhancer region were generated, 1166 to 369 and 1166 to 804, whereas a third segment, 368 to 110, contained the putative enhancer region. In RCLP cells, the sequence from 368 to 110 possessed enhancer activity, whereas more 5' segments of the promoter did not (Fig. 3A
). These constructs were then transfected into another ovarian cell line (CHO) as well as a kidney cell line (COS) to determine whether this enhancer activity was specific to luteal cells (Fig. 3
, B and C). Although the stimulation was not quite as high in these two cell lines, the 368 to 110 region still caused 2.5- to 3-fold greater activity in these cells relative to the SV40 promoter alone. The other constructs again had no enhancer activity in these cells. In summary, these experiments revealed that the identified enhancer region in the PRAP/17ßHSD7 promoter mediates enhancer activity in a variety of cell types, although the increased activity in RCLP cells (
4.5-fold over promoters not containing the region) vs. the other cell types (2- to 3-fold increase) suggests some regulatory component specific to luteal cells.
Analysis of the enhancer region by EMSA
To determine the transcription factor(s) involved in the enhancer activity, we first identified a highly conserved region within the 185- to 115-bp fragment. Comparative analysis demonstrated that a region from 156 to 123 within this fragment of the rat promoter is conserved between the rat and the human 17ßHSD7 promoters (23). This 33-bp piece contains putative response elements for both the GATA and Sp1 families of transcription factors.
Because PRAP/17ßHSD7 protein becomes abundant around the time of mid-pregnancy (17), nuclear extracts were made from the CL of d 14 pregnant rats and from RCLP cells and were analyzed via EMSA with a probe consisting of the 156- to 123-bp promoter fragment. The results for these two cell types were identical, and only results for RCLP cells are shown in Fig. 4A
. Both CL and RCLP cell nuclear extracts contained protein(s) that bound to the 156 to 123-bp sequence, forming three specific bands (Fig. 4A
, lane 2). Binding was competed with wild-type cold probe (lane 3) and with a probe mutated at the putative GATA site (lane 4), but not with a probe mutated at the Sp1 site (lane 5). Addition of an Sp1 antibody to the probe/nuclear-extract mix (lane 8) led to the formation of a supershift (vs. lane 7), and this supershift mainly detracted from the intensity to the uppermost band. In contrast, an antibody to GATA-6 failed to supershift the DNA/protein bands (data not shown).
|
Effect of Sp1 mutations on PRAP/17ßHSD7 promoter activity
To assess the effect of the two identified Sp1 binding sites on basal promoter activity, mutations were made of either the proximal, distal, or both Sp1 binding sites in the 185-luc promoter construct and these constructs were then transfected into RCLP cells (Fig. 5
). Mutation of the distal Sp1 binding site alone led to a 50% decrease in basal promoter activity. Whereas mutation of the proximal Sp1 site had a minor effect on basal activity, only mutation of the distal Sp1 or both Sp1 sites resulted in a clear inhibition of the promoter. These results demonstrate an important role for Sp1 in enhancing the basal promoter activity of PRAP/17ßHSD7 and indicate that the distal Sp1 site is a critical mediator of this effect.
Regulation of the PRAP/17ßHSD7 promoter by LH
Previous studies in our laboratory demonstrated that LH has an important role in inhibiting the expression of PRAP/17ßHSD7 in early pregnancy, and that the drop in LH at mid-pregnancy allows PRAP/17ßHSD7 mRNA expression in the rat CL (17, 25). To look at possible mechanisms of repression by LH, we transfected RCLP cells with the 368, 115, and 52 PRAP/17ßHSD7 promoter constructs. Because RCLP cells do not respond to LH/hCG, we used forskolin, which directly activates adenylyl cyclase, to mimic the increase in cAMP caused by LH. As shown in Fig. 6
, all PRAP/17ßHSD7 promoter-reporter constructs were inhibited by forskolin, whereas the pGL3 basic construct was not. This indicates that the necessary element for response to cAMP-mediated inhibition is contained in the proximal 52 bp of the PRAP promoter.
Analysis of the conserved inverted CCAAT sequence
The proximal 52 bp of the PRAP promoter was examined for potential conserved transcription factor binding sites, and this analysis yielded a region from 40 to 11 highly conserved between the human, mouse, and rat 17ßHSD7 promoters that contains an inverted CCAAT sequence as well as a putative binding site for Pbx-1. CCAAT boxes have been described in a number of systems to dynamically regulate transcription of a number of diverse genes, in part due to the wide variety of transcription factors that bind to sites containing the "CCAAT" sequence (reviewed in Ref. 34). This includes such diverse factors as the CCAAT/enhancer binding proteins, nuclear factor 1, CCAAT displacement protein, and CCAAT binding protein/NF-Y (35, 36, 37). Whereas many of these may have a CCAAT sequence within their binding site, NF-Y is the only one that requires this sequence (38). Pbx-1 has been shown to mediate a cAMP response in the promoter of another steroidogenic enzyme, P450c17 (39, 40, 41, 42), and can cause either transcriptional activation or repression depending on cell and promoter context (43).
To determine whether transcription factors are indeed binding to this sequence in the CL, we performed EMSA analysis using the rat PRAP/17ßHSD7 DNA sequence from 40 to 11 to probe luteal nuclear extracts for binding activity. As mentioned earlier, we have shown that the normal increase in PRAP/17ßHSD7 expression seen at mid-pregnancy can be inhibited by administration of LH/hCG (25). Using the same model, nuclear extracts were obtained from CL of rats on d 14 of pregnancy that had been injected with either PBS or hCG for 3 d. In addition, the RNA was isolated from these same CL and analyzed by semiquantitative RT-PCR for PRAP/17ßHSD7 expression (Fig. 7
). As previously demonstrated (25), hCG treatment leads to a decrease in PRAP/17ßHSD7 mRNA expression. The nuclear extracts obtained from these same animals were used in EMSA studies with the 40 to 11 promoter region. As shown in Fig. 8
, luteal nuclear extracts from control rats possessed binding activity for this probe, and this activity was not found in luteal nuclear extracts from hCG-treated rats. This binding could be blocked by cold wild-type probe as well as a cold probe mutated at a putative Pbx-1 binding site but not by cold probe mutated at the putative CCAAT site. This suggests that a luteal factor binds to this CCAAT site, and that this binding is prevented by hCG. To identify this protein, antibody to NF-YA was coincubated with the luteal nuclear extracts and the 40 to 11 probe. As shown in Fig. 8
, antibody to NF-YA could supershift this complex formed by the control luteal extracts. No supershift was observed when nuclear extracts from hCG-treated rats were used.
|
|
| Discussion |
|---|
|
|
|---|
Analysis of promoter activity in culture revealed the presence of a strong enhancer between 185 and 115, and this enhancer was active in the presence of a heterologous promoter in all cell lines tested, although it was most active in the rat luteal cell line RCLP. Sequence analysis of this promoter fragment and comparison to the human and mouse promoter sequences identified a region containing two Sp1 binding site that was conserved between species and binding of Sp1 to this site was confirmed by EMSA in both RCLP cells and luteal extracts. An additional proximal Sp1 binding site was also confirmed by EMSA. These two Sp1 sites were mutated individually and in combination, and the results revealed the distal Sp1 site to be a potent enhancer, consistent with the location of the major enhancer element revealed by truncation studies. Interestingly, the proximal site also enhanced basal activity to a lesser extent. It is worth noting that this proximal Sp1 site is physically close to the CCAAT or NF-Y binding site also identified in this promoter. Numerous studies have shown that NF-Y and Sp1 interact to affect transcription in various promoters (45, 46, 47, 48). The two factors have been shown to cooperatively bind DNA and synergistically activate transcription. NF-Y and Sp1 have also been shown to interact in the absence of DNA through glutathione S-transferase pulldown assay and coimmunoprecipitation (49).
In addition, binding of the PRAP promoter by Sp1 may serve as a conduit for estrogen regulation of PRAP promoter activity. A number of laboratories have shown Sp1 to mediate stimulation in response to estrogen in a variety of genes via differing mechanisms, including cooperative binding with an ER half site (30). The presence of three ER half sites within the PRAP/17ßHSD7 promoter raises the possibility of interaction between these factors, which, although beyond the scope of the current study, is fertile ground for future investigation.
In the present study, we explored the mechanisms by which LH inhibits expression of PRAP/17ßHSD7. PRAP/17ßHSD7 expression has been shown by our laboratory to be decreased in response to LH in the rat CL, and in RCLP cells we found that forskolin could effectively decrease PRAP/17ßHSD7 promoter activity in all constructs, including the smallest construct (52 bp). This minimum construct contains a conserved CCAAT box and binds NF-Y in nuclear extracts from both RCLP cells (data not shown) and CL in gel mobility shift assays. The NF-Y complex is also known as CCAAT-binding factor and is a heterotrimeric transcription factor that consists of three conserved subunits, /A, NF-YB, and NF-YC (50, 51) that must be associated together to bind to DNA. In TATA-less promoters, which, like the PRAP/17ßHSD7 promoter, contain only one or two cis-acting elements, the CCAAT box is absolutely required for regulating gene transcription (34, 52). Treatment with hCG abolished the CCAAT binding activity of luteal nuclear extracts, suggesting that loss of this CCAAT binding activity may play a role in the inhibition of PRAP expression by LH in vivo. cAMP has been suggested to mediate inhibition of the fatty acid synthase gene through NF-Y (53, 54); and this is similar to our observation that hCG inhibits NF-Y binding to the CCAAT site in the PRAP/17ßHSD7 promoter. Mutation of this CCAAT box within the context of the 52-bp promoter blocked forskolin-mediated inhibition of PRAP promoter activity, further confirming the crucial role of NF-Y in regulation of this promoter.
The inhibition of PRAP/17ßHSD7 by LH is a crucial element in control of estradiol production during pregnancy in the rat. The two isoforms of 17ßHSD found in the ovary, type 1 and type 7, are the only isoforms of this enzyme capable of converting the weak estrogen estrone to the strong estrogen estradiol, which is essential for pregnancy in the rodent (55). As the other hormones in the steroidogenic pathway are active in ovarian tissues throughout pregnancy, the presence of two, differently regulated isoforms of 17ßHSD provides an efficient mechanism for regulating estradiol production. In the initial stages of pregnancy, high levels of LH stimulate transcription of 17ßHSD1 in granulosa cells (13), the primary source of estradiol. When circulating LH drops at midpregnancy (5), production of 17ßHSD7 begins in the CL (17, 18). This new enzyme replaces the activity of follicular 17ßHSD1, maintaining estradiol production in the absence of high levels of LH. Furthermore, by preventing concomitant follicular and luteal production of estradiol, this dual regulation prevents overproduction of estradiol, excessive amounts of which are detrimental to fetal survival in the rodent (26, 27).
In addition to its critical role in maintaining adequate ovarian estradiol production, 17ßHSD7 may carry out other important functions during pregnancy. PRAP/17ßHSD7 has been identified in the decidua of the mouse (56). A role for this enzyme in decidual development or maintenance has not yet been identified; however, it is interesting to speculate on the necessity for maintaining adequate local estradiol production in this tissue. One known action of estradiol in the rodent decidua is the inhibition of IL-6 production (57). As IL-6 can lead to abortion (20, 58), the presence of locally produced estradiol may be a crucial factor in the success of pregnancy.
In conclusion, in this study we have successfully cloned the PRAP/17ßHSD7 5' flanking region and characterized elements involved in its regulation. An enhancer region was identified and found to bind Sp1 from the nuclear extracts of a luteal cell line and the CL of pregnancy. A critical Sp1 site within this enhancer was identified by mutation analysis. A second Sp1 site in a more proximal region of the promoter also had an impact on basal activity of the promoter. In addition, a binding site for NF-Y was found in the proximal promoter region, which is essential for forskolin-induced inhibition of the promoter. Because binding of NF-Y to this region of the promoter is inhibited by hCG, this is a likely mechanism by which LH acts to repress the transcriptional expression of luteal PRAP/17ßHSD7 gene during early and late pregnancy.
| Footnotes |
|---|
First Published Online February 24, 2005
1 M.R. and A.S. contributed equally to this work. ![]()
Abbreviations: 17ßHSD, 17ß Hydroxysteroid dehydrogenase; CHO, Chinese hamster ovary; CL, corpus luteum; DMSO, dimethylsulfoxide; ERE, estrogen response element; hCG, human chorionic gonadotropin; NF-Y, nuclear factor Y; PRAP, prolactin receptor-associated protein; PRL, prolactin.
Received December 29, 2004.
Accepted for publication February 16, 2005.
| References |
|---|
|
|
|---|
-HSD) enzyme. Program of the 32nd Annual Meeting of the Society for the Study of Reproduction, Pullman, WA, 1999, p 162 (Abstract A221)
and activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF-7 breast cancer cells. Endocrinology 143:45834591
-hydroxylase/17,20 lyase) in human adrenal NCI-H295A cells. Mol Endocrinol 15:12771293
-globin gene in unfractionated B-cell extracts. Biochim Biophys Acta 1007:237242[Medline]
This article has been cited by other articles:
![]() |
Y. S. Devi, A. Shehu, C. Stocco, J. Halperin, J. Le, A. M. Seibold, M. Lahav, N. Binart, and G. Gibori Regulation of Transcription Factors and Repression of Sp1 by Prolactin Signaling Through the Short Isoform of Its Cognate Receptor Endocrinology, July 1, 2009; 150(7): 3327 - 3335. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Shehu, J. Mao, G. B. Gibori, J. Halperin, J. Le, Y. Sangeeta Devi, B. Merrill, H. Kiyokawa, and G. Gibori Prolactin Receptor-Associated Protein/17{beta}-Hydroxysteroid Dehydrogenase Type 7 Gene (Hsd17b7) Plays a Crucial Role in Embryonic Development and Fetal Survival Mol. Endocrinol., October 1, 2008; 22(10): 2268 - 2277. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zheng, C. A Price, Y. Tremblay, J. G Lussier, and P. D Carriere Role of transforming growth factor-{beta}1 in gene expression and activity of estradiol and progesterone-generating enzymes in FSH-stimulated bovine granulosa cells Reproduction, October 1, 2008; 136(4): 447 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Benoit, H. A. LaVoie, G. L. McCoy, and C. A. Blake Expression of Sperm Protein 22 (SP22) in the Rat Ovary During Different Reproductive States Experimental Biology and Medicine, July 1, 2007; 232(7): 910 - 920. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Needle, K. Piparo, D. Cole, C. Worrall, I. Whitehead, G. Mahon, and L. T. Goldsmith Protein Kinase A-Independent cAMP Stimulation of Progesterone in a Luteal Cell Model Is Tyrosine Kinase Dependent but Phosphatidylinositol-3-Kinase and Mitogen-Activated Protein Kinase Independent Biol Reprod, July 1, 2007; 77(1): 147 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Stocco, C. Telleria, and G. Gibori The Molecular Control of Corpus Luteum Formation, Function, and Regression Endocr. Rev., February 1, 2007; 28(1): 117 - 149. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ohnesorg, B. Keller, M. H. de Angelis, and J. Adamski Transcriptional regulation of human and murine 17{beta}-hydroxysteroid dehydrogenase type-7 confers its participation in cholesterol biosynthesis. J. Mol. Endocrinol., August 1, 2006; 37(1): 185 - 197. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |