| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Institut National de la Santé et de la Recherche Médicale/Fiocruz Associate Laboratory of Immunology, Laboratory on Thymus Research (S.S., D.M.S.V.-V., W.S.), Department of Immunology, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro 21045-900, Brazil; Department of Morphology, Federal University of Alagoas (S.S.), Maceió 57072-970, Brazil; Hôpital Necker, Unité Mixte de Recherche 8147 (S.S., J.-M.P., M.D., W.S.), and Institut National de la Santé et de la Recherche Médicale, Unité 344 (M.-C.P.-V., W.S.), 75743 Paris Cedex 15, France; and National Institute of Aging, National Institutes of Health (V.d.M.-C.), Baltimore, Maryland 21224
Address all correspondence and requests for reprints to: Dr. Wilson Savino, Laboratory on Thymus Research, Department of Immunology, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Avenue Brasil 4365, Manguinhos, 21045-900 Rio de Janeiro, Brazil. E-mail: savino{at}fiocruz.br.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The thymus is a primary lymphoid organ in which bone marrow-derived T cell precursors undergo differentiation, ultimately leading to the migration of positively selected thymocytes to the T cell-dependent areas of peripheral lymphoid organs (3). From the entrance of T cell precursors into the thymus to the exit of mature cells from the organ, a vast body of interactions promotes the complex process of T cell differentiation (1) that occurs as cells migrate within the thymic lobules. Such a process involves sequential expression of various proteins and rearrangements of the T cell receptor (TCR) genes. Most of the immature thymocytes, including those bearing the phenotypes TCRCD3CD4CD8 and TCRlowCD3lowCD4+CD8+, are cortically located, whereas mature TCRhighCD3highCD4+CD8 and TCRhighCD3highCD4 CD8+ cells (that will normally leave the organ toward peripheral lymphoid organs) are found in the medulla. Along with such a journey, developing thymocytes encounter cortical and medullary nonlymphoid microenvironments through distinct cell-cell and cell-matrix interactions (1, 4). Cell migration is thus a crucial event for intrathymic T cell differentiation, and we recently proposed that chemokines act in concert with the extracellular matrix (ECM), resulting in the migration of a given cell subset, either within the thymus or at the entrance into and/or exit from the organ (5). Interestingly, microenvironmental cells produce both types of molecules (4, 5, 6, 7).
Few studies suggest that GH modulates intrathymic T cell migration: 1) recombinant GH increases human T cell engraftment into the thymus of severe combined immune deficiency mice, an effect that seems to be mediated by adhesion molecules and ECM, because it can be abrogated with anti-ß1 integrin antibodies (8); 2) in vitro GH treatment increases the adhesion of thymocytes to thymic epithelial cells (TEC; the major component of the thymic microenvironment) as well as the production of ECM proteins and expression of ECM receptors by TEC (9). In this study, we approached this issue by studying thymocyte migration in GH-transgenic (GH-Tg) mice as well as in normal mice intrathymically injected with GH.
| Materials and Methods |
|---|
|
|
|---|
In most cases, 8- to 10-wk-old animals were used, whereas some experiments using GH-Tg mice were run using different ages, from 6 wk to 7 months. The animal facilities and care followed rules precluded by the European Union ethics committee for animal research.
Chemicals
Recombinant bovine GH was provided from Dr. A. F. Parlow (Pituitary Hormones and Antisera Center, National Institute of Diabetes and Digestive and Kidney Diseases, Torrance, CA). Stock solution (1 mg/ml) was prepared in PBS and kept at 20 C until use. Cellular fibronectin (from human foreskin fibroblasts), laminin (from murine Engelbreth-Holm-Swarm sarcoma), BSA, fluorescein isothiocyanate (FITC), and aminoethylcarbazole were purchased from Sigma-Aldrich Corp. (St. Louis, Mo), whereas the anesthetic 2,2,2-tribromoethanol was purchased from Aldrich Chemical Co. (Milwaukee, WI). The chemokines CXCL12/SDF-1
and CCL25/TECK were obtained from R&D Systems, Inc. (Minneapolis, MN). Pertussis toxin (PTX) and cholera toxin (CTX) were obtained from Sigma-Aldrich Corp. (St. Louis, MO).
Antibodies
For immunohistochemistry, rabbit polyclonal antisera specific for laminin or fibronectin were obtained from Novotec (St. Martin-la-Garenne, France); rabbit antihuman cytokeratin immune serum as well as peroxidase-labeled goat antirabbit Ig serum were purchased from DakoCytomation (Carpinteria, CA). Anti-CXCL12 monoclonal antibody (mAb) was purchased from R&D Systems, Inc. Rhodamine-labeled goat antirabbit Ig and FITC-coupled goat antirat Ig were purchased from Biosys (Compiegne, France). In all cases, optimal dilutions of each primary or secondary antibody were predetermined in our laboratory.
For cytofluorometric analyses, appropriate dilutions of the following mAb were used: anti-CD3/FITC, anti-CD4/phycoerythrin (PE), anti-CD4/peridinin chlorophyll protein (PercP), anti-CD4/allophycocyanin (APC), anti-CD8/CyChrome, anti-CD8/APC, anti-CD8/PercP, anti-CD44/FITC, anti-CD25/APC, anti-CD49d/PE, anti-CD49e/PE, anti-CD49f/PE, and anti-CXCR4/PE as well as isotype-matched negative controls for each fluorochrome applied in specific antibodies, thus including unrelated rat Igs labeled with FITC, PE, APC, or PercP (all purchased from BD Pharmingen, San Diego, CA). In some blocking experiments, purified anti-CD49f was applied (10 µg/ml) to inhibit laminin-very late antigen-6 (VLA-6)-mediated interactions.
Immunohistochemistry
Thymus frozen sections were submitted to indirect immunofluorescence or immunoperoxidase assay as previously described (12). Specimens were incubated with a given primary antibody for 1 h, washed with PBS, and treated with rhodamine- or peroxidase-coupled second antibody. In the case of immunofluorescence, specimens were analyzed under a confocal fluorescence microscope (MS 510, Zeiss, Oberkochen, Germany). When peroxidase-linked second antibody was applied, enzyme activity was revealed with aminoethylcarbazole in the presence of H2O2. Controls comprised specimens in which primary antibodies were replaced by unrelated Igs and generated no significant labeling (not shown).
Cytofluorometry
Thymus, spleen, as well as sc and mesenteric lymph node cell suspensions from each animal group were prepared in PBS as previously described (13). Three- or four-color cytofluorometry was performed by incubating cells with a mixture of appropriately diluted antibodies in 2% fetal calf serum in PBS for 20 min at 4 C. After washings, cells were fixed and analyzed by flow cytometry in a FACSCalibur device (BD Pharmingen) equipped with CellQuest software (BD Biosciences, Mountain View, CA). A gate excluding cell debris and nonviable cells was determined using forward vs. side scatter parameters and was confirmed in some experiments with the use of propidium iodide staining and immediate analysis of unfixed cells. Analyses were made after recording 10,000100,000 events for each sample.
We also phenotyped the CD4CD8 double-negative (DN) subset with the CD44 and CD25 markers. For that, we used anti-CD4/PercP and anti-CD8/PercP in conjunction with anti-CD25/allophycocyanin and anti-CD44/FITC. In these experiments, we recorded 200,000 events at the flow cytometer.
Real-time PCR
Mouse thymuses were homogenized in 1 ml TRIzol reagent (Invitrogen Life Technologies, Inc., Carlsbad, CA) using a Polytron instrument (Brinkmann Instruments, Westbury, NY). The total RNA was then isolated according to the instructions of the manufacturer. RT of 2 µg total RNA was performed using the Stratagene RT kit (La Jolla, CA), and the resulting cDNA was submitted to real-time PCR, to measure the expression of mRNA encoding for CXCL12. Amplification of ß2-microglobulin was performed as an endogenous control. The following primers were applied: CXCL12: forward: ccagtcagcctgacctaccg; reverse, cgggtcaatgcacacttgtc; and ß2-microglobulin: forward, tgaccgcttgtatgctatccagt; reverse, cagtgtgagccaggatatag.
The PCR was performed on an ABI PRISM 7700 sequence detector using the quantitative PCR Master Mix for SYBR Green (Eurogentec, Seraing, Belgium). Amplification was carried out in a total volume of 20 µl containing 0.5 µM gene-specific primers, 10 µl Master Mix SYBR Green, and 5 µl cDNA at different dilutions (three then fold dilutions). After initial enzyme activation (5 min at 55 C) and DNA denaturation, (5 min at 95 C) the PCRs were cycled 50 times with the following parameters: denaturation at 95 C for 30 sec, annealing at 59 C for 30 sec, and extension at 72 C for 30 sec. RNA expression was determined by the comparative cycle threshold (
Ct) method (14). Four independent assays were performed, each one in triplicate.
Cell adhesion assay
To assess the thymocyte adhesive capacity on ECM substrata, 60 x 15-mm culture dishes (Nunc, Copenhagen, Denmark) were coated for 1 h at room temperature (plus 30 min for air drying) with 10 µg/ml fibronectin, laminin, or BSA as a control. In these assays, 1 x 107 thymocytes from three pooled thymuses from GH-Tg, GH intrathymically treated BALB/c mice, or their corresponding controls were allowed to adhere on the precoated dishes. After 1-h incubation, the adherent thymocytes were harvested, counted, and phenotyped for the expression of CD3, CD4, and CD8 molecules. The relative adhesion was calculated as the ratio of adhesion between GH-Tg or GH-treated over the respective control, which was, by definition, fixed at 1.
Isolation and culture of thymic nurse cells (TNCs)
Migration of immature thymocytes can be investigated in vitro by studying TNCs. These are cortically located lymphoepithelial complexes formed by one TEC, which harbors various numbers of thymocytes (mostly immature cells), being located in the cortical region of thymic lobules. In culture, TNCs spontaneously release thymocytes, and TNC-derived epithelial cells can reconstitute lymphoepithelial complexes after being cocultured with fetal thymocytes, thus corresponding to an in vitro model of thymocyte migration within the TEC context (5). TNCs were isolated from pools of five to 10 C57BL/6 wild-type or GH-transgenic female mice at 1115 wk of age, as currently done in our laboratory (9), and the number of TNC per mouse was then calculated. Once obtained, such lymphoepithelial complexes were settled in culture, so as to obtain, 5 d later, highly purified TNC-derived epithelial cultures. These cells were used for immunocytochemical detection of laminin and CXCL12 or to evaluate reconstitution of thymic nurse cell complexes. In this kind of experiment, 5-d TNC-derived TEC were trypsinized and cocultured with fresh 16- to 17-d-old fetal thymocytes (105 thymocytes/104 TEC/well) in inverted Terasaki plates for 6 h in complete RPMI 1640 medium (9). Alternatively, cocultures were performed in the presence of purified antilaminin antibodies (10 µg/ml). Control cultures were incubated with control rabbit IgG at equivalent protein concentrations. Percentages of newly formed complexes were evaluated in blind by direct counting under the light microscope.
Cell chemotaxis assay
Cell chemotaxis is another strategy to evaluate immature as well as mature thymocyte migration in vitro, under distinct stimuli (5). Thymocyte migratory activity was assessed ex vivo in 5-µm pore size Transwell plates (Corning Costar, Cambridge, MA) using cell suspensions after pooling three thymuses from each group of mice. In this cell chemotaxis assay, membranes were coated on both sides with 10 µg/ml fibronectin, laminin, or BSA for 1 h at 37 C, followed by 1 h of blocking with 1% BSA. Thymocytes (2.5 x 106) were then added to the upper chamber in 100 µl 0.5% BSA/RPMI 1640, and 600 µl 0.5% BSA/RPMI 1640 were added to the lower chamber. After 3 h of incubation at 37 C in 5% CO2-containing air, cells migrated into lower chambers were removed, counted, and analyzed by flow cytometry. In additional experiments, we tested the ability of the chemokines, CXCL12 and CCL25, applied at 100 ng/ml, alone or in combination with laminin.
GH injection and intrathymic fluorescein labeling
One direct strategy to evaluate thymocyte exit in vivo is analysis of the so-called recent thymic emigrants. It is established that intrathymic injection of FITC labels large numbers of thymocytes, allowing the recovery of FITC+ cells that have recently emigrated from the thymus (15, 16). BALB/c as well as GH-Tg and corresponding age-matched control mice were anesthetized with 2,2,2-tribromoethanol, and 10 µl FITC solution (1 mg/ml)/thymic lobe were injected into the thymus in the open chest cavity. Controls for the injection procedure consisted of dropping 10 µl FITC solution into the mediastinal cavity (over the thymus) or intrathymic injection of PBS alone. In the case of BALB/c mice, the volume of 10 µl injected per thymic lobe contained FITC (1 mg/ml) plus GH (105 M, final concentration). In addition, in this model an additional control consisted of injecting heat-denatured GH, applied at the same concentration as the native hormone. We previously ascertained that FITC plus GH or GH alone had similar effects, stimulating TEC proliferation, indicating that FITC does not interfere in the GH activity (data not shown). We also ascertained that TEC proliferation was not enhanced by GH denatured by boiling (2). In additional experiments in which FITC was not injected, intrathymic treatment with GH (or its denatured form) followed the same protocol as that described above.
In all animals the chest cavity was closed with surgical clips; 16 h later, thymus, spleen, and lymph node cells were collected from all mice. In additional experiments, the organs were collected 2 wk after GH injection and 16 h after FITC injection. Mice whose thymuses contained less than 50% FITC-labeled cells were discarded.
Statistical analyses
Data are shown as the mean ± SE. Results were statistically analyzed by unpaired Students test; data were considered statistically different at P
0.05.
| Results |
|---|
|
|
|---|
|
|
Does GH modulate intrathymic ECM ligands and receptors in vivo?
Because we had shown that in vitro treatment of TEC with GH enhanced ECM deposition (9), we evaluated the distribution of laminin and fibronectin in the thymus of GH-Tg mice, compared with respective controls: GH induced an increase in ECM deposition in both cortical and medullary regions of the thymic lobules, as illustrated in Fig. 3
. Interestingly, in situ labeling also revealed an increase in the laminin receptor VLA-6 in the microenvironmental compartment of GH-Tg thymuses compared with controls (Fig. 4A
). Nevertheless, the membrane levels of ECM receptors (VLA-4, VLA-5, and VLA-6) on thymocytes did not change (Fig. 4B
and Table 1
). Similar findings were seen in GH-injected BALB/c mice (data not shown).
|
|
|
|
|
In conjunction with these ex vivo functional data, we found increased levels of CXCL12 in GH-Tg thymic stroma (Fig. 7
, A and B) and GH-Tg-derived TNC cultures compared with corresponding controls; the latter was ascertained by real-time PCR and immunocytochemistry (Fig. 7
, C and D). By contrast, the membrane levels of CXCR4 in thymocytes were similar in wild-type and transgenic animals, independent of the CD4/CD8-defined subset analyzed (Fig. 7E
).
|
Thymocyte migration elicited by laminin, with or without CXCL12, was also investigated with the use of specific blockers, anti-VLA-6 mAb and Bordetella PTX, respectively. As expected, migration induced by laminin was completely prevented by incubation of thymocytes with anti-VLA-6 mAb, whereas CXCL12-induced migration was abrogated by PTX (Fig. 8B
). Control experiments revealed that an isotype-matched mAb did not change thymocyte migration triggered by laminin (not shown), and that CTX, which is known to be inefficient in blocking chemokine receptors (18), did not exert any effect on CXCL12-induced migration of thymocytes from wild-type or GH-Tg mice. Moreover, PTX did not change the profiles of laminin-triggered thymocyte migration in either wild-type or GH-Tg animals. However, when thymocytes from GH-Tg mice were preincubated with anti-VLA-6 and then subjected to CXCL12 stimulation, we found a consistent and statistically significant 20% decrease in the numbers of migrating cells (Fig. 8A
). In control animals, such a decrease was much less and was not statistically significant.
|
|
|
| Discussion |
|---|
|
|
|---|
In this study we evaluated in vivo the effects of high levels of GH in the thymus using two distinct approaches: intrathymic injection of GH in BALB/c mice and evaluation of GH-Tg mice. Accordingly, the first protocol allowed us to evaluate the acute effect of the hormone within the organ; in the second, we could study the effects due to prolonged exposition of the thymus to high circulating levels of GH. Interestingly, in both conditions the numbers of thymocytes were slightly (yet significantly) higher than the corresponding control value. This is in keeping with preliminary data obtained with GH-injected mice, which presented 1015% more cells in the S and G2M phases compared with denatured GH-injected animals, whereas no differences were seen in terms of membrane Fas expression (Smaniotto, S., M. Dardenne, and W. Savino, unpublished observations).
We focused herein on those GH-triggered effects related to thymocyte development. ECM ligands and receptors correspond to one group of players in this process (4). We observed that GH induced an increase in laminin deposition throughout the thymic lobules. This is in keeping with our in vitro data, which showed that treatment of cultured TEC with GH enhanced ECM deposition (9). Additionally, in both GH-Tg and GH-injected mouse thymus sections, we found that the VLA-6 labeling in the microenvironmental compartment was denser than that in the respective controls. This may result in a stronger attachment of laminin to the microenvironmental network, thus favoring its presentation to thymocytes. Such an idea is also supported by the fact that TNC-derived epithelial cells from GH-Tg mice apparently produce more laminin than those from wild-type animals, and that the degree of reconstitution of lymphoepithelial complexes, formed after coculturing GH-Tg-derived TEC with normal thymocytes, was higher than that seen when TEC from wild-type animals were used.
In contrast, however, membrane expression of VLA-6 on thymocytes did not change significantly. Yet, with regard to the laminin receptor, ex vivo binding to laminin was higher when thymocytes from GH-treated mice were applied, suggesting that high GH contents also activate VLA-6 in thymocytes, favoring their migrating progress. Furthermore, such an effect was found in both immature and mature CD4/CD8-defined thymocyte subsets. In keeping with this, thymocyte migration in laminin-containing Transwell chambers was higher in GH-Tg and GH-treated mice compared with controls. Overall, these data tell us that GH promotes a multifaceted change in laminin-mediated interactions; one consequence being an increased migratory response of thymocytes, which probably means a change in the developmental behavior. At present, we cannot explain why the expression of VLA-6 is enhanced in the microenvironment, but not in thymocytes. Yet it is conceivable that the mechanisms controlling the expression of this molecule in thymocytes and TEC are different. This hypothesis is actually supported by our recent data showing a defect in the expression of the fibronectin receptor VLA-5 on nonobese diabetic thymocytes, which is not found in the TEC of the same animals (24).
A nonmutually excluding hypothesis we raised is that chemokine-driven thymocyte migration could also be under the influence of GH. In fact, the thymocyte migratory response triggered by CXCL12 was higher in GH-Tg and GH-treated mice than in controls, although the membrane levels of CXCR4 remained similar in Tg and wild-type animals, suggesting that (similar to what was seen in relation to VLA-6) CXCR4 in GH-Tg thymocytes is spontaneously more activated. Moreover, the enhancement of CXCL12 seen in the thymus and TNC cultures derived from GH-Tg mice, ascertained at both mRNA and protein levels, suggest that in vivo, both microenvironmental and thymocyte sides contribute to the resulting enhancement of CXCL12-mediated interactions revealed in the GH-Tg mouse thymus.
Interestingly, it was shown that in vivo injection of CXCL12 in bovine GH-Tg mice inhibited ex vivo T cell migratory activity of peritoneal cells (25), suggesting that the GH-enhancing, CXCL12-triggered migration shown in this study might be restricted to early T cell developmental stages. In any case, the present data represent, to our knowledge, the first demonstration that chemokine-driven thymocyte migration can be hormonally controlled. This is a relevant issue when designing procedures involving GH-based therapy in both experimental animals and humans.
An additional aspect that we analyzed was the possibility that GH could enhance the combined effects of laminin plus CXCL12. When both molecules were applied, the number of migrating cells was higher than the sum of the two stimuli alone, an effect seen in control, GH-Tg, and wild-type animals and that essentially targeted the CD4+CD8+ cells. The fact that such a synergic effect was seen in both wild-type and GH-Tg animals is evidence that GH enhances a biological circuitry that already exists in the physiological situation. These data fit with the idea that ECM and chemokines may act in combination to drive thymocyte migration (5) and reinforce the idea of a cross-talk between integrin and chemokine receptors, a concept that has been established for CXCL12 and laminin or fibronectin (26, 27, 28). Accordingly it is conceivable that CXCL12/CXCR4-induced signaling also uses the Janus kinase/signal transducer and activator of transcription pathway, similar to integrins of the VLA family. In this respect, it is noteworthy that an antilaminin receptor mAb could significantly block approximately 20% of the migratory activity elicited by CXCL12 in GH-Tg thymocytes. However, because we did not detect a significant reciprocal blocking activity of PTX on laminin-driven thymocyte migration even in GH-Tg animals, it is conceivable that the relative influence of VLA-6 on the CXCR4 signaling pathway is more relevant than the reverse situation. Accordingly, disruption of VLA-6-triggered intracellular signaling, secondary to the binding of the anti-VLA-6 mAb, could somewhat alter the Janus kinase/signal transducer and activator of transcription pathway, which is also partially triggered by CXCR4 stimulation, as recently demonstrated (18). Although additional studies of this issue are obviously necessary, our results place GH-Tg derived thymocytes as an interesting model to study putative CXCR4/VLA-6 functional connections.
The fact that ex vivo migration of mature thymocytes was enhanced in high GH content conditions prompted us to check whether the hormone could also modulate the exit of thymocytes. We found in both GH-Tg and GH-injected animals an augmentation of CD4+FITC+ cells in mesenteric and sc lymph nodes (but not in the spleen), revealing that GH modulates the relative distribution of these cells among peripheral lymphoid organs. The mechanisms governing such differential RTE homing in GH-Tg mice have not been explored. Yet it is likely that CD62L (a well-known homing receptor for lymph nodes) is involved, because in BALB/c mice intrathymically injected with bovine GH, we found an up-regulation of this molecule in lymph node RTEs (29).
The biological circuit(s) triggered by high GH contents has not been addressed in this study. Nevertheless, an IGF-I/IGF-I receptor loop is likely to be involved. GH-Tg mice have high levels of circulating IGF-I (30). Moreover, we defined an intrathymic GH-controlled IGF-I/IGF-I receptor circuitry in human and mouse TEC and thymocytes (31). Lastly, we showed that in vitro GH-enhanced TEC/thymocyte interactions relevant to thymocyte migration could be abrogated not only by anti-ECM and anti-ECM receptor antibodies, but also by anti-IGF-I and anti-IGF-I receptor reagents (9).
Another issue to be discussed refers to whether the effects reported herein are induced via paracrine or endocrine pathways. This is particularly interesting considering that the results seen in GH-Tg mice were similar to those seen in normal animals injected intrathymically with GH. Although this issue has not been approached in a precise way, it is likely that both pathways occur; in vitro GH treatment of thymic cells does promote a multifaceted biological response, comprising, among other effects, the modulation of ECM proteins (9). Additionally, systemic injection of GH into mice enhances thymic hormone production by TEC (22).
Taken together, our data demonstrate that GH-Tg mice as well as GH-injected animals present altered thymocyte migration, with changes in the distribution of exiting thymocytes in the periphery of the immune system. Moreover, such a GH-related thymocyte migration results at least partially from a combined action of laminin and CXCL12. It is not known whether the opposite situation occurs in mouse GH receptor knockout mice, yet such a hypothesis seems plausible considering that these animals do exhibit alterations in the thymic epithelium, as revealed by increased density of the TEC network, the appearance of large epithelial cysts, and a decrease in thymic hormone secretion (32). Nevertheless, one should take into account that these animals as well as IGF-I-null mice (33) do develop negative and positive selection, with rather normal relative numbers of CD4/CD8-defined thymocyte subsets. This fits with the hypothesis recently postulated that the main role of GH and IGF-I in the immune system is a general antistress effect (34). In this context, and if we take into account that the thymus is one of the most stress-sensitive organs in the body, promoting massive thymocyte death as one of the main responses to acute stress, a putative antistress role of GH-IGF-I-related circuits would be crucial for the homeostasis in this organ, with likely consequences for the maintenance of peripheral T cells. In this context, and considering that GH is presently being used as an adjuvant therapeutic agent in immunodeficiencies, including AIDS (23), the concepts defined herein provide important background knowledge for future GH-based immune interventions.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online March 31, 2005
Abbreviations: APC, Allophycocyanin; CTX, cholera toxin; CXCL, CXC chemokine ligand; DN, double negative; ECM, extracellular matrix; FITC, fluorescein isothiocyanate; dGH, heat-denatured GH; mAb, monoclonal antibody; PE, phycoerythrin; PercP, peridinin chlorophyll protein; PTX, pertussis toxin; RTE, recent thymic emigrant; TCR, T cell receptor; TEC, thymic epithelial cell; Tg, transgenic; TNC, thymic nurse cell; VLA, very late antigen.
Received June 7, 2004.
Accepted for publication November 11, 2004.
| References |
|---|
|
|
|---|

C(T) method. Methods 25:402408[CrossRef][Medline]
-induced chemotaxis for CD4/8 double-positive thymocytes by fibronectin and laminin in mice. Immunology 104:4349[CrossRef][Medline]
triggers CXCR4 receptor dimerization and activates the JAK/STAT pathway. FASEB J 13:16991710
4ß1 and
5ß1 integrin avidity by CC chemokines in monocytes: implications for transendothelial chemotaxis. J Cell Biol 134:10631073
modulates
4ß7 integrin-mediated lymphocyte adhesion to mucosal addressin cell adhesion molecule-1 and fibronectin. J Immunol 168:52685277This article has been cited by other articles:
![]() |
D. A. Mendes-da-Cruz, S. Smaniotto, A. C. Keller, M. Dardenne, and W. Savino Multivectorial Abnormal Cell Migration in the NOD Mouse Thymus J. Immunol., April 1, 2008; 180(7): 4639 - 4647. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Savino Neuroendocrine control of T cell development in mammals: role of growth hormone in modulating thymocyte migration Exp Physiol, September 1, 2007; 92(5): 813 - 817. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||