help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0114
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.
Endocrinology Vol. 146, No. 7 3179-3184
Copyright © 2005 by The Endocrine Society

Athyroid Pax8–/– Mice Cannot Be Rescued by the Inactivation of Thyroid Hormone Receptor {alpha}1

Jens Mittag, Sönke Friedrichsen, Heike Heuer, Silke Polsfuss, Theo J. Visser and Karl Bauer

Max Planck Institute for Experimental Endocrinology (J.M., S.P., K.B.), D-30625 Hannover, Germany; Department of Medicine, University of Manchester (S.F.), Manchester M13 9PT, United Kingdom; Institut für Molekulare Biotechnologie (H.H.), D-07745 Jena, Germany; and Department of Internal Medicine, Erasmus University Medical Center (T.J.V.), NL-3000 DR Rotterdam, The Netherlands

Address all correspondence and requests for reprints to: Dr. Karl Bauer, Max Planck Institut für Experimentelle Endokrinologie, Feodor Lynen Strasse 7, D-30625 Hannover, Germany. E-mail: karl.bauer{at}mpihan.mpg.de.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The Pax8–/– mouse provides an ideal animal model to study the consequences of congenital hypothyroidism, because its only known defect is the absence of thyroid follicular cells. Pax8–/– mice are, therefore, completely athyroid in postnatal life and die around weaning unless they are substituted with thyroid hormones. As reported recently, Pax8–/– mice can also be rescued and survive to adulthood by the additional elimination of the entire thyroid hormone receptor {alpha} (TR{alpha}) gene, yielding Pax8–/–TR{alpha}o/o double-knockout animals. This observation has led to the hypothesis that unliganded TR{alpha}1 might be responsible for the lethal phenotype observed in Pax8–/– animals. In this study we report the generation of Pax8–/–TR{alpha}1–/– double-knockout mice that still express the non-T3-binding TR isoforms {alpha}2 and {Delta}{alpha}2. These animals closely resemble the phenotype of Pax8–/– mice, including growth retardation and a completely distorted appearance of the pituitary with thyrotroph hyperplasia and hypertrophy, extremely high TSH mRNA levels, reduced GH mRNA expression, and the almost complete absence of lactotrophs. Like Pax8–/– mice, Pax8–/–TR{alpha}1–/– compound mutants die around weaning unless they are substituted with thyroid hormones. These findings do not support the previous interpretation that the short life span of Pax8–/– mice is due to the negative effects of the TR{alpha}1 aporeceptor, but, rather, suggest a more complex mechanism involving TR{alpha}2 and an unliganded TR isoform.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONES (THs) are essential for the control of many metabolic and developmental processes (1, 2, 3, 4). The physiological importance of these hormones is evident under the conditions of congenital hypothyroidism, a relatively common disorder mainly caused by thyroid dysgenesis or agenesis (5), which occurs with a frequency of 1 in 3600 newborns (6). If TH replacement therapy is not instituted immediately after birth, severe forms of congenital hypothyroidism lead to the syndrome of cretinism, which is characterized by growth retardation, metabolic disturbances, severe neurological defects, and mental retardation (3).

To study the consequences of congenital hypothyroidism, Pax8–/– mice provide an ideal animal model, because their only primary defect is the complete absence of thyroid follicular cells. Therefore, these mice are completely athyroid in postnatal life, resulting in death around weaning unless they are substituted with TH (7).

The majority of TH effects on growth, development, and metabolism are mediated through the binding of T3 to nuclear hormone receptors that regulate the expression of T3-sensitive genes (8). These TH receptors (TRs) are encoded by two distinct genes, TR{alpha} (NR1A1) and TRß (NR1A2), that give rise to eight different splice variants (TR{alpha}1, -{alpha}2, -{Delta}{alpha}1, -{Delta}{alpha}2, -ß1, -ß2, -ß3, and -{Delta}ß3). However, only four proteins (TR{alpha}1, -ß1, -ß2, and -ß3) can be considered to act as thyroid hormone receptors, because they contain a ligand as well as a DNA-binding domain (9). The nonbinding isoforms have been discussed to act as dominant negative antagonists, as deduced from in vitro experiments; their physiological role in vivo, however, is still poorly defined (10).

Corresponding to the vast array of TH effects on body homeostasis, TRs are found in essentially every tissue, with TR{alpha}1 more ubiquitously expressed than TRß isoforms. Mutant mice deficient in the expression of one or several TR proteins have been generated to assign certain T3 effects to specific TR subtypes. Analysis of TRß–/– mice, for example, has revealed that TRß plays a more specific role in cochlear and retina development and TSH feedback regulation (11, 12), whereas the phenotype of TR{alpha}1-deficient mice suggests a predominant role of TR{alpha}1 with regard to the regulation of heart rate and body temperature (13). However, compared with athyroid Pax8–/– mice, these TR-deficient animals are only mildly affected. Even mice devoid of all TRs (TR{alpha}1–/–TRß–/–) are viable (14), although they are poorly fertile, suggesting a more complex regulation pattern of TH-dependent processes.

That the absence of the ligand results in more deleterious effects than the absence of receptors has underlined the importance of unliganded TR action. Hormone-independent binding of TR to DNA and interaction with corepressors leading to suppression of basal gene expression have been discussed as a putative mechanism of the so-called aporeceptor activity. Recently, Flamant et al. (15) demonstrated that Pax8–/– mice could be rescued by concomitant inactivation of the complete TR{alpha} gene (but not by inactivation of the complete TRß gene), resulting in viable Pax8–/–TR{alpha}o/o mice that survive to adulthood. This observation has led to the hypothesis that the mortality of Pax8–/– mice is due to TR{alpha}1 aporeceptor activity. In this study we report the generation of Pax8–/–TR{alpha}1–/– mice. These animals that still express the non-T3-binding forms, TR{alpha}2 and TR{Delta}{alpha}2, do not survive beyond weaning and exhibit a phenotype similar to that of Pax8–/– mice.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals
Animal procedures were approved by the animal welfare committee of Medizinische Hochschule Hannover. Mice were kept at a constant temperature (22 C) and light cycle (12 h of light, 12 h of darkness) and were provided with standard laboratory chow and tap water ad libitum. Animals were killed by decapitation, and tissues were isolated quickly, frozen in liquid nitrogen, and stored at –80 C until additional processing. Trunk blood was collected, and serum was obtained by centrifugation and stored at –80 C.

Generation of Pax8–/–TR{alpha}1–/– mice and genotype determination
Pax8–/–TR{alpha}1–/– mice were generated by intercrossing Pax8+/– (7) and TR{alpha}1–/– mice (13) (obtained from The Jackson Laboratory, Bar Harbor, ME). Wild-type controls were littermates of Pax8–/– mutants.

For DNA preparation, the mouse tail was incubated overnight at 60 C in extraction buffer [50 mM Tris-HCl (pH 8.0), 100 mM NaCl, 100 mM EDTA, 1% sodium dodecyl sulfate, and 50 µg/ml proteinase K]. DNA was precipitated by isopropanol and was used for standard PCR assays. Pax8 genotyping was performed by PCR using the primers described by Flamant et al. (15), and the protocols provided by The Jackson Laboratory were followed for TR{alpha}1 genotype screening.

Real-time RT-PCR
Total RNA was isolated from pooled mouse pituitaries (n > 3/gender and genotype, at least three pools) using the Absolutely RNA Microprep Kit (Stratagene, La Jolla, CA). cDNA was generated with the Thermoscript RT-PCR System (Invitrogen Life Technologies, Inc., Carlsbad, CA) and digested with ribonuclease, as suggested by the supplier. Samples without reverse transcriptase were used as negative controls to confirm the absence of genomic DNA. Quantitative real-time PCR was performed using the iCycler iQ Multi-Color Real-Time PCR Detection System and the iQ SYBR Green Supermix (Bio-Rad Laboratories, Munich, Germany). Cyclophilin and {gamma}-actin were used as housekeeping genes for normalization. The following primers were chosen to generate the PCR-fragments: cyclophilin, GCAAGGATGGCAAGGATTGA and AGCAATTCTGCCTGGATAGC; {gamma}-actin, AGTCCTGTGGTATCCATGAG and CACCAGACAGCACTGTATTG; TSH-ß, CCGCACCATGTTACTCCTTA and GTTCTGACAGCCTCGTGTAT; prolactin, GCAGTCACCATGACCATGAA and AGATTGGCAGAGGCTGAACA; GH, CGCTTCTCGCTGCTGCTCAT and GTCCGAGGTGCCGAACATCA; TRß, GTGACACGAGGCCAGCTGAA and TAGCAGGACGGCCTGAAGCA; and TR{alpha}1, GAGGCTAGGACCCAAGTTCT and CCTCCTGACCCTACAGTCAA.

In vitro transcription
Digoxigenin-labeled RNA probes were generated from cDNA subclones in Bluescript SKII+ plasmids or pGEM plasmids (Promega Corp., Mannheim, Germany). Transcription was carried out in vitro according to standard protocols using a DIG RNA Labeling Kit (Roche, Mannheim, Germany). Probes were generated from cDNA fragments as described previously (16, 17). cRNA probes were diluted in hybridization buffer [50% formamide, 10% dextran sulfate, 0.05% tRNA, 0.6 M NaCl, 10 mM Tris-HCl (pH 7.4), 1x Denhardt’s solution, 100 µg/ml sonicated salmon sperm DNA, 1 mM EDTA, and 10 mM dithiothreitol] to a final concentration of 5 ng/µl.

In situ hybridization (ISH)
After decapitation, pituitaries were removed rapidly, embedded in Tissue-Tek medium (Sakura Finetek, Torrance, CA), and frozen on dry ice. Sections (16 µm) were cut on a cryostat (Leica, Bentheim, Germany), thaw-mounted on silane-treated slides, and stored at –80 C until additional processing. In situ hybridization histochemistry was carried out as described by Schäfer et al. (18). Briefly, sections were fixed in a 4% phosphate-buffered paraformaldehyde solution (pH 7.4) for 1 h at room temperature, rinsed with PBS, and treated with 0.4% phosphate-buffered Triton X-100 solution for 10 min. After washing with PBS and water, tissue sections were incubated in 0.1 M triethanolamine (pH 8) containing 0.25% (vol/vol) acetic anhydride for 10 min. After acetylation, sections were rinsed several times with PBS, dehydrated by successive washing with increasing ethanol concentrations, and air dried.

After application of the labeled cRNA probes, sections were coverslipped and incubated in a humid chamber at 58 C for 16 h. After hybridization, coverslips were removed in 2x standard saline citrate (2x SSC; 0.3 M NaCl and 0.03 M sodium citrate, pH 7.0). The sections were then treated with ribonuclease A (20 µg/ml) and ribonuclease T1 (1 U/ml) at 37 C for 30 min. Successive washes followed at room temperature in 1x, 0.5x, and 0.2x SSC for 20 min each and in 0.2x SSC at 65 C for 1 h. Sections were rinsed with P1 (100 mM Tris-HCl and 150 mM NaCl, pH 7.5) and then incubated for 2 h in blocking solution provided by the manufacturer of the kit. After incubation overnight with antidigoxigenin antibody conjugated with alkaline phosphatase (1:2500 dilution; Roche), the tissue sections were washed with P1. Staining proceeded for 2–16 h in substrate solution containing nitro blue tetrazolium chloride (340 µg/ml; BIOMOL, Hamburg, Germany), X-Phosphate (5-bromo-4-chloro-3-indolyl phosphate, 175 µg/ml; Biomol, Hamburg, Germany), 100 mM Tris-HCl, 100 mM NaCl, and 50 mM MgCl2, pH 9.5.

Hormone measurements and type 1 iodothyronine deiodinase (D1) activity
Serum T4 and T3 concentrations and liver D1 activity were determined as described in detail previously (17).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Development of Pax8–/–TR{alpha}1–/– mice
Female and male Pax8+/–TR{alpha}1–/– mice showed normal fertility and reproductive capacity. Pregnancy was uneventful, and litter size was normal. Like Pax8–/–TR{alpha} 1+/+ mice, most Pax8–/–TR{alpha}1–/– mice were born with a lower body weight compared with their littermates. Postnatal growth of Pax8–/–TR{alpha}1–/– mice was variable, but clearly retarded (Fig. 1Go) compared with that of Pax8+/–TR{alpha}1–/– animals, which developed indistinguishably from Pax8+/+TR{alpha}1–/– mutants, but clearly more slowly than controls.



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Growth curves of Pax8+/+TR{alpha}1+/+ mice ({bullet}), Pax8+/+TR{alpha}1–/– ({blacktriangleup}), Pax8+/–TR{alpha}1–/– ({triangleup}), Pax8–/–TR{alpha} 1+/+ ({square}), and Pax8–/–TR{alpha}1–/– ({circ}) mutants. For analysis, at least 25 animals were used per genotype.

 
The majority of compound mutants died during the first 2 wk, and only about 25% reached the age of 21 d. Even when litter size was reduced to four pups, Pax8–/–TR{alpha}1–/– mice did not survive weaning. Spontaneous survival was observed in very few cases (two pups of >520 litters). By daily administration of T4 (20 ng/g body weight), Pax8–/–TR{alpha}1–/– mice could be rescued and survived to adulthood, indicating that the mortality of these animals is a direct consequence of their athyroidism.

Serum iodothyronine levels
As in Pax8–/–TR{alpha}1+/+ mice, total T3 and T4 are undetectable in serum of Pax8–/–TR{alpha}1–/– animals, confirming that maternal supply is negligible after birth. In Pax8+/–TR{alpha}1–/– animals, total T4 (nmol/liter) was slightly reduced in both genders [males, 61.2 ± 12.5 in Pax8+/–TR{alpha}1–/– vs. 75.7 ± 13.3 in controls (P < 0.05); females, 67.4 ± 11.9 in Pax8+/–TR{alpha}1–/– vs. 78.3 ± 15.3 in controls (P < 0.05)], and serum T3 levels (nanomoles per liter) were slightly increased [males, 1.29 ± 0.23 in Pax8+/–TR{alpha}1–/– vs. 1.00 ± 0.19 in controls (P < 0.005); females, 1.31 ± 0.22 in Pax8+/–TR{alpha}1–/– vs. 1.04 ± 0.18 in controls (P < 0.001)] with the result that the T3/T4 ratio was increased (T3/T4x 100 values of 2.15 in male Pax8+/–TR{alpha}1–/– vs. 1.34 in controls and 1.97 in female Pax8+/–TR{alpha}1–/– vs. 1.36 in control). Besides the increased T3/T4 ratio, we also observed a higher D1 liver activity in Pax8+/–TR{alpha}1–/– mice (17.19 ± 3.41 pmol/mg·min) compared with controls (10.63 ± 6.53 pmol/mg·min; P < 0.05), whereas no significant difference was observed in the athyroid mouse models (0.99 ± 0.33 pmol/mg·min in Pax8–/–TR{alpha}1+/+ compared with 0.91 ± 0.21 pmol/mg·min in Pax8–/–TR{alpha}1–/–).

Tissue weight analysis
As a first approach to characterize the Pax8–/–TR{alpha}1–/– mice, we analyzed the weights of tissues on postnatal d 21. When normalized to the corresponding body weights, organ weights differed quite remarkably among the various mutants (Fig. 2Go). In Pax8–/–TR{alpha}1+/+ as well as in Pax8–/–TR{alpha}1–/– mice, organ weights of lung and pituitary were increased, whereas the weights of spleen, stomach, and kidney were decreased compared with control and Pax8+/+TR{alpha}1–/– animals. Obviously, tissue weights of Pax8–/–TR{alpha}1–/– mice closely resembled those of Pax8–/–TR{alpha}1+/+ animals with one surprising exception; in all mutant mice analyzed, the relative brain weight was found to be elevated compared with that in control animals, with the highest weight observed in Pax8–/–TR{alpha}1–/– mice (a 1.6-fold increase compared with Pax8–/–TR{alpha}1+/+ mice). Even when absolute brain weights were considered, the relatively small Pax8–/–TR{alpha}1–/– animals had a slightly larger brain (0.425 ± 0.047 g) than control animals (0.336 ± 0.017 g).



View larger version (23K):
[in this window]
[in a new window]
 
FIG. 2. Relative tissue weights of Pax8+/+TR{alpha}1+/+, Pax8–/–TR{alpha}1+/+, Pax8+/+TR{alpha}1–/–, and Pax8–/–TR{alpha}1–/– mice. For analysis, 11 Pax8+/+TR{alpha}1+/+ and Pax8–/–TR{alpha}1+/+ mice were used, and 16 animals of the Pax8+/+TR{alpha}1–/– and Pax8–/–TR{alpha}1–/– mutants were used. *, P < 0.05; **P < 0.005; ***P < 0.001.

 
Although all organs analyzed appeared macroscopically normal, without gross pathological changes, the pituitaries of the athyroid Pax8–/–TR{alpha}1+/+ and Pax8–/–TR{alpha}1–/– mice exhibited a glossy/translucent, not an opalescent appearance like those of control and Pax8+/+TR{alpha}1–/– animals (Fig. 3Go).



View larger version (114K):
[in this window]
[in a new window]
 
FIG. 3. Macroscopical appearance of the pituitaries from Pax8+/+TR{alpha}1+/+ (A), Pax8–/–TR{alpha}1+/+ (B), Pax8+/+TR{alpha}1–/– (C), and Pax8–/–TR{alpha}1–/– (D) animals. Note the opaque appearance of the anterior pituitary of the athyroid animals (B and D). Scale bar, 2 mm.

 
Expression pattern analysis of pituitary hormones
When we also analyzed the pituitary hormone expression pattern by in situ hybridization, we did not observe any differences between control and Pax8+/+TR{alpha}1–/– mice with regard to either the cellular distribution pattern or the hybridization signal intensities (Fig. 4Go). In contrast, the cellular composition of athyroid Pax8–/–TR{alpha}1+/+ and the Pax8–/–TR{alpha}1–/– mouse pituitaries is completely distorted. Not only the TSH-ß transcript levels but also the number of cells expressing TSH-ß mRNA were dramatically increased in both athyroid animal models. Lactotrophs were almost absent in these mice, and the numbers of GH and LH mRNA expressing cells were decreased. Only corticotrophs appeared not to be affected by the absence of THs.



View larger version (113K):
[in this window]
[in a new window]
 
FIG. 4. Expression of pituitary hormone transcripts in 21-d-old mice of the indicated genotypes. As described in Materials and Methods, the analysis was performed by ISH using digoxigenin-labeled cRNA probes for the hormones indicated. Scale bar, 500 µm. PRL, Prolactin.

 
Quantitative real-time PCR analysis revealed that corresponding to the ISH data, TSH-ß transcript levels were highly increased, whereas prolactin and GH levels were dramatically decreased in athyroid animals (Fig. 5Go). No obvious changes in transcript levels were observed after analyzing the pituitaries of Pax8+/+TR{alpha}1–/– mice. Again, the Pax8–/–TR{alpha}1–/– pituitary phenotype closely resembled that of Pax8–/–TR{alpha}1+/+ animals, implying that TR{alpha}1 aporeceptor activity is not responsible for the pituitary malformation observed in Pax8–/–TR{alpha}1+/+ mice.



View larger version (13K):
[in this window]
[in a new window]
 
FIG. 5. Quantitative real-time RT-PCR analysis of TSH, prolactin (PRL), GH, and TR mRNA levels in pituitaries of 21-d-old wild-type mice and the mutant animals as indicated. *, P < 0.05.

 
We also employed quantitative real-time PCR to assess the transcript levels of the T3-binding TR isoforms. Compared with control animals, TR{alpha}1 mRNA levels were not different in Pax8–/–TR{alpha}1+/+ mice. TRß transcript levels were also quite similar in all four genotypes.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pax8–/–TR{alpha}1–/– mice were generated by breeding Pax8+/–TR{alpha}1–/– mice. Because Pax8+/–TR{alpha}1+/+ mice are not different from control animals (16), it was not surprising that Pax8+/–TR{alpha}1–/– animals developed like Pax8+/+TR{alpha}1–/– mice and exhibited the same characteristics. Although it was originally reported that in Pax8+/+TR{alpha}1–/– mutants TH levels are reduced only in males (13), we observed slightly altered serum T4 and T3 levels in both genders, as reported by others (19, 20). Phenotypically Pax8–/–TR{alpha}1–/– closely resembled Pax8–/–TR{alpha}1+/+ mutants, indicating that the absence of THs is the determining factor. Like Pax8–/–TR{alpha}1+/+ mice, the compound mutants were severely growth retarded and did not survive weaning, but could also be rescued to reach adulthood if treated with THs.

In Pax8–/–TR{alpha}1–/– and Pax8–/–TR{alpha}1+/+ mice, the absence of THs similarly affected the relative tissue weights of most organs, whereas the absence of TR{alpha}1 exerted only minor effects. In brain, however, not only the absence of T3 as ligand, but also the absence of TR{alpha}1, led to an increased relative tissue weight. This is not surprising, because TR{alpha}1 (but not TRß) is known to be expressed during early embryonic stages where the TR{alpha}1 aporeceptor seems to exert a suppressive function on tissue development (21). Because Pax8–/–TR{alpha}1+/+ animals lack the stimulatory effects of THs as a differentiation factor (for review, see Ref. 1), it could be speculated that the increased brain mass may be the result of a prolonged proliferation phase during development. Not easily explained is the fact that the brain mass of compound mutants is higher than that of animals with single gene deletions. Of course, this aspect requires additional investigation.

For the pituitaries, the relative tissue weights of the mutants were also moderately increased. With regard to appearance, cellular composition, and signal intensities of hormone transcripts, the pituitaries of the Pax8+/+TR{alpha}1–/– and Pax8+/–TR{alpha}1–/– mice did not differ from those of control animals, indicating that TR{alpha}1 is of minor importance in the control of pituitary development and hormone regulation. Correspondingly, the pituitaries of Pax8–/–TR{alpha}1–/– mice closely resembled those of Pax8–/–TR{alpha}1+/+ mice. Both mutants exhibited a dramatically distorted cellular composition of the anterior pituitary, with severe hypertrophy and hyperplasia of thyrotrophs and an almost complete loss of lactotrophs, indicating that THs are important factors determining pituitary development and maintenance.

The absence of TH as ligand of the TRs is apparently also the decisive factor determining the mortality of the athyroid animals. This contrasts with the fact that the absence of T3-binding receptors has no lethal consequences. As is known, TR{alpha}1–/– (13) as well as TRß–/– mice (12) and even TR{alpha}1–/–TRß–/– compound mutants lacking all T3-binding TRs (14) are viable and survive to adulthood. Surprisingly, Flamant et al. (15) demonstrated that Pax8–/– mice can be rescued by the additional inactivation of the complete TR{alpha} gene. The fact that Pax8–/–TR{alpha}o/o mice survive to adulthood has been taken as an indication that the mortality of the athyroid animals is the consequence of lethal TR{alpha}1 aporeceptor activity. This interpretation is not supported by our observation that Pax8–/–TR{alpha}1–/– mice do not survive weaning, although TR{alpha}1 is absent and therefore cannot exert any negative effects by acting as an aporeceptor. Obviously the mechanisms are more complex, and our data indicate that the TR{alpha}2 isoform, which is still expressed in our compound mutants, might be involved in this process despite the fact that this isoform is unable to bind T3 (13). This interpretation is supported by the observation that in vivo, TR{alpha}2 is indeed expressed as protein and is able to bind to DNA as a heterodimer with retinoid X receptor (9). Moreover, TR{alpha}2 is also known to act as a dominant negative inhibitor of TH response element-driven transcription and is considered a weak antagonist, although not as potent as unliganded TRs (22, 23).

As an alternative interpretation, it could also be speculated that TR{Delta}{alpha}2 might play a role in postweaning survival, because TR{alpha}–/– mice, in which TR{alpha}1 and TR{alpha}2 have been deleted and only the {Delta}{alpha} isoforms are expressed (24, 25), show a more severe phenotype than TR{alpha}1–/– or TR{alpha}o/o mutants, including early death after weaning. However, the physiological functions of the {Delta}{alpha} isoforms are still unknown, and it is not clear whether these isoforms are expressed as proteins. Therefore, an involvement of TR{alpha}2 seems more likely than that of TR{Delta}{alpha}2.

The fact that Pax8–/–TR{alpha}1–/– mice can be rescued by daily administration of THs suggests a hypothetical model that implies a complex formation of TR{alpha}2 with another TR isoform capable of binding T3. Such a complex involving an unliganded isoform such as TRß in the Pax8–/–TR{alpha}1–/– mouse or TR{alpha}1 in the Pax8–/–TRß–/– mutants might theoretically causes mortality around the time of weaning. This model would also explain why TR{alpha}1–/–TRß–/– mice that still express TR{alpha}2 can survive to adulthood simply because these compound mutants are devoid of a T3-binding TR isoform (14).

In light of the growing evidence for nongenomic actions of thyroid hormones in various tissues and organelles of mammalian cells (for review, see Refs. 26 and 27), it also seems conceivable that T4-treated Pax8–/–TR{alpha}1–/– mice might be rescued via such mechanisms. This hypothesis would be in line with the fact that hyperthyroid TR{alpha}1–/–TRß–/– mice lacking all T3-binding receptors are viable (14), but it is not supported by the findings that the athyroid Pax8–/–TR{alpha}o/o animals survive without TH treatment. Obviously, these speculations warrant additional investigation.


    Acknowledgments
 
We thank Dr. Ahmed Mansouri for providing the Pax8+/– mice, Melanie Kraus, Petra Affeldt, Ellen Kaptein, and Hans van Toor for excellent technical assistance, and Valerie Ashe for linguistic help and typing the manuscript.


    Footnotes
 
First Published Online March 31, 2005

Abbreviations: D1, Type 1 iodothyronine deiodinase; ISH, in situ hybridization; SSC, standard saline citrate; TH, thyroid hormone; TR, thyroid hormone receptor.

Received January 31, 2005.

Accepted for publication March 22, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Porterfield SP, Hendrich CE 1993 The role of thyroid hormones in prenatal and neonatal neurological development: current perspectives. Endocr Rev 14:94–106[Abstract/Free Full Text]
  2. Schwartz HL, Ross ME, Oppenheimer JH 1997 Lack of effect of thyroid hormone on late fetal rat brain development. Endocrinology 138:3119–3124[Abstract/Free Full Text]
  3. Bernal J 2002 Action of thyroid hormone in brain. J Endocrinol Invest 25:268–288[Medline]
  4. Anderson GW, Schoonover CM, Jones SA 2003 Control of thyroid hormone action in the developing rat brain. Thyroid 13:1039–1056[CrossRef][Medline]
  5. De Felice M, Di Lauro R 2004 Thyroid development and its disorders: genetics and molecular mechanisms. Endocr Rev 25:722–746[Abstract/Free Full Text]
  6. Kopp P 2002 Perspective: genetic defects in the etiology of congenital hypothyroidism. Endocrinology 143:2019–2024[Abstract/Free Full Text]
  7. Mansouri A, Chowdhury K, Gruss P 1998 Follicular cells of the thyroid gland require Pax8 gene function. Nat Genet 19:87–90[CrossRef][Medline]
  8. Yen PM 2003 Molecular basis of resistance to thyroid hormone. Trends Endocrinol Metab 14:327–333[CrossRef][Medline]
  9. O’Shea PJ, Williams GR 2002 Insight into the physiological actions of thyroid hormone receptors from genetically modified mice. J Endocrinol 175:553–570[Abstract]
  10. Chassande O, Fraichard A, Gauthier K, Flamant F, Legrand C, Savatier P, Laudet V, Samarut J 1997 Identification of transcripts initiated from an internal promoter in the c-erbA{alpha} locus that encode inhibitors of retinoic acid receptor-{alpha} and triiodothyronine receptor activities. Mol Endocrinol 11:1278–1290[Abstract/Free Full Text]
  11. Forrest D, Erway LC, Ng L, Altschuler R, Curran T 1996 Thyroid hormone receptor ß is essential for development of auditory function. Nat Genet 13:354–357[CrossRef][Medline]
  12. Forrest D, Hanebuth E, Smeyne RJ, Everds N, Stewart CL, Wehner JM, Curran T 1996 Recessive resistance to thyroid hormone in mice lacking thyroid hormone receptor ß: evidence for tissue-specific modulation of receptor function. EMBO J 15:3006–3015[Medline]
  13. Wikström L, Johansson C, Saltó C, Barlow C, Campos Barros A, Baas F, Forrest D, Thorén P, Vennström B 1998 Abnormal heart rate and body temperature in mice lacking thyroid hormone receptor {alpha}1. EMBO J 17:455–461[CrossRef][Medline]
  14. Göthe S, Wang Z, Ng L, Kindblom JM, Barros AC, Ohlsson C, Vennström B, Forrest D 1999 Mice devoid of all known thyroid hormone receptors are viable but exhibit disorders of the pituitary-thyroid axis, growth, and bone maturation. Genes Dev 13:1329–1341[Abstract/Free Full Text]
  15. Flamant F, Poguet AL, Plateroti M, Chassande O, Gauthier K, Streichenberger N, Mansouri A, Samarut J 2002 Congenital hypothyroid Pax8–/– mutant mice can be rescued by inactivating the TR{alpha} gene. Mol Endocrinol 16:24–32[Abstract/Free Full Text]
  16. Friedrichsen S, Christ S, Heuer H, Schäfer MKH, Parlow AF, Visser TJ, Bauer K 2004 Expression of pituitary hormones in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 145:1276–1283[Abstract/Free Full Text]
  17. Friedrichsen S, Christ S, Heuer H, Schäfer MKH, Mansouri A, Bauer K, Visser TJ 2003 Regulation of iodothyronine deiodinases in the Pax8–/– mouse model of congenital hypothyroidism. Endocrinology 144:777–784[Abstract/Free Full Text]
  18. Schäfer MKH, Day R 1995 In situ hybridization techniques to study processing enzyme expression at the cellular level. Methods Neurosci 23:16–44[CrossRef]
  19. Amma LL, Campos-Barros A, Wang Z, Vennström B, Forrest D 2001 Distinct tissue-specific roles for thyroid hormone receptors ß and {alpha}1 in regulation of type 1 deiodinase expression. Mol Endocrinol 15:467–475[Abstract/Free Full Text]
  20. Dellovade TL, Chan J, Vennström B, Forrest D, Pfaff DW 2000 The two thyroid hormone receptor genes have opposite effects on estrogen-stimulated sex behaviors. Nat Neurosci 3:472–475[CrossRef][Medline]
  21. Schreiber AM, Das B, Huang H, Marsh-Armstrong N, Brown DD 2001 Diverse developmental programs of Xenopus laevis metamorphosis are inhibited by a dominant negative thyroid hormone receptor. Proc Natl Acad Sci USA 98:10739–10744[Abstract/Free Full Text]
  22. Tagami T, Kopp P, Johnson W, Arseven OK, Jameson JL 1998 The thyroid hormone receptor variant {alpha}2 is a weak antagonist because it is deficient in interactions with nuclear receptor corepressors. Endocrinology 139:2535–2544[Abstract/Free Full Text]
  23. Macchia PE, Takeuchi Y, Kawai T, Cua K, Gauthier K, Chassande O, Seo H, Hayashi Y, Samarut J, Murata Y, Weiss RE, Refetoff S 2001 Increased sensitivity to thyroid hormone in mice with complete deficiency of thyroid hormone receptor {alpha}. Proc Natl Acad Sci USA 98:349–354[Abstract/Free Full Text]
  24. Fraichard A, Chassande O, Plateroti M, Roux JP, Trouillas J, Dehay C, Legrand C, Gauthier K, Kedinger M, Malaval L, Rousset B, Samarut J 1997 The T3R{alpha} gene encoding a thyroid hormone receptor is essential for post-natal development and thyroid hormone production. EMBO J 16:4412–4420[CrossRef][Medline]
  25. Gauthier K, Plateroti M, Harvey CB, Williams GR, Weiss RE, Refetoff S, Willott JF, Sundin V, Roux JP, Malaval L, Hara M, Samarut J, Chassande O 2001 Genetic analysis reveals different functions for the products of the thyroid hormone receptor {alpha} locus. Mol Cell Biol 21:4748–4760[Abstract/Free Full Text]
  26. Bassett JH, Harvey CB, Williams GR 2003 Mechanisms of thyroid hormone receptor-specific nuclear and extra nuclear actions. Mol Cell Endocrinol 213:1–11[CrossRef][Medline]
  27. Davis P, Davis F 2003 Nongenomic actions of thyroid hormone. In: Braverman L, ed. Diseases of the thyroid. Totowa, NJ: Humana Press; 19–37



This article has been cited by other articles:


Home page
EndocrinologyHome page
J. Mittag, S. Friedrichsen, A. Strube, H. Heuer, and K. Bauer
Analysis of Hypertrophic Thyrotrophs in Pituitaries of Athyroid Pax8-/- Mice
Endocrinology, September 1, 2009; 150(9): 4443 - 4449.
[Abstract] [Full Text] [PDF]


Home page
J Mol EndocrinolHome page
J H D. Bassett and G. R Williams
The skeletal phenotypes of TR{alpha} and TR{beta} mutant mice
J. Mol. Endocrinol., April 1, 2009; 42(4): 269 - 282.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Mittag, W. Oehr, H. Heuer, T. Hamalainen, B. Brachvogel, E. Poschl, and K. Bauer
Expression and thyroid hormone regulation of annexins in the anterior pituitary
J. Endocrinol., December 1, 2007; 195(3): 385 - 392.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. Quignodon, S. Vincent, H. Winter, J. Samarut, and F. Flamant
A Point Mutation in the Activation Function 2 Domain of Thyroid Hormone Receptor {alpha}1 Expressed after CRE-Mediated Recombination Partially Recapitulates Hypothyroidism
Mol. Endocrinol., October 1, 2007; 21(10): 2350 - 2360.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
F. Flamant, K. Gauthier, and J. Samarut
Thyroid Hormones Signaling Is Getting More Complex: STORMs Are Coming
Mol. Endocrinol., February 1, 2007; 21(2): 321 - 333.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. Mittag, E. Winterhager, K. Bauer, and R. Grummer
Congenital Hypothyroid Female Pax8-Deficient Mice Are Infertile Despite Thyroid Hormone Replacement Therapy
Endocrinology, February 1, 2007; 148(2): 719 - 725.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. Wistuba, J. Mittag, C M. Luetjens, T. G Cooper, C.-H. Yeung, E. Nieschlag, and K. Bauer
Male congenital hypothyroid Pax8-/- mice are infertile despite adequate treatment with thyroid hormone
J. Endocrinol., January 1, 2007; 192(1): 99 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Winter, C. Braig, U. Zimmermann, H.-S. Geisler, J.-T. Franzer, T. Weber, M. Ley, J. Engel, M. Knirsch, K. Bauer, et al.
Thyroid hormone receptors TR{alpha}1 and TR{beta} differentially regulate gene expression of Kcnq4 and prestin during final differentiation of outer hair cells
J. Cell Sci., July 15, 2006; 119(14): 2975 - 2984.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. P. Farwell, S. A. Dubord-Tomasetti, A. Z. Pietrzykowski, and J. L. Leonard
Dynamic Nongenomic Actions of Thyroid Hormone in the Developing Rat Brain
Endocrinology, May 1, 2006; 147(5): 2567 - 2574.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. H. D. Bassett, R. Swinhoe, O. Chassande, J. Samarut, and G. R. Williams
Thyroid Hormone Regulates Heparan Sulfate Proteoglycan Expression in the Growth Plate
Endocrinology, January 1, 2006; 147(1): 295 - 305.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mittag, J.
Right arrow Articles by Bauer, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals