| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Division of Reproductive Endocrinology and Infertility (J.S., K.S.A., B.M., B.R.C., W.E.R.), University of Texas Southwestern Medical Center, Dallas, Texas 75390; McGill University Health Center (V.G., J.L.), Montreal, Quebec, Canada H3A 2B4; Tohoku University School of Medicine (T.S., H.S.), Department of Pathology, Sendai 980-8575, Japan
Address all correspondence and requests for reprints to: William E. Rainey, PhD, Department of Obstetrics and Gynecology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, Texas 75390-9032. E-mail: william.rainey{at}utsouthwestern.edu.
| Abstract |
|---|
|
|
|---|
, -ß, and -
) are a subfamily of orphan nuclear receptors (designated NR3B1, NR3B2, and NR3B3) that are structurally and functionally related to estrogen receptors
and ß. Herein we test the hypothesis that ERR
regulates transcription of the genes encoding the enzymes involved in adrenal steroid production. Real-time RT-PCR was first used to determine the levels of ERR
mRNA in various human tissues. Adult adrenal levels of ERR
transcript were similar to that seen in heart, which is known to highly express ERR
. Expression of ERR
in the adult adrenal was then confirmed using Western blotting and immunohistochemistry. To examine the effects of ERR
on steroidogenic capacity we used reporter constructs with the 5'-flanking regions of steroidogenic acute regulatory protein (StAR), cholesterol side-chain cleavage (CYP11A), 3ß-hydroxysteroid dehydrogenase type II (HSD3B2), 17
-hydroxylase/17,20-lyase (CYP17), and dehydroepiandrosterone sulfotransferase (SULT2A1). Cotransfection of these reporter constructs with wild-type ERR
or VP16-ERR
expression vectors demonstrated ERR
enhanced reporter activity driven by flanking DNA from CYP17 and SULT2A1. SULT2A1 promoter activity was most responsive to the ERR
and VP16-ERR
, increasing activity 2.6- and 79.5-fold, respectively. ERR
effects on SULT2A1 were greater than the stimulation seen in response to steroidogenic factor 1 (SF1). Transfection of serial deletions of the 5'-flanking DNA of the SULT2A1 gene and EMSA experiments indicated the presence of three functional regulatory cis-elements which shared sequence similarity to binding sites for SF1. Taken together, the expression of ERR
in the adrenal and its regulation of SULT2A1 suggest an important role for this orphan receptor in the regulation of adrenal steroid production. | Introduction |
|---|
|
|
|---|
(NR3B1), ERRß (NR3B2), and ERR
(NR3B3) (1, 2). Although all three ERR family members are closely related to the classic estrogen receptors, natural estrogens do not activate these receptors. At present, only synthetic compounds such as 4-hydroxytamoxifen, diethylstilbestrol, and XCT90 have been shown to bind and antagonize the effects of ERR family members (3, 4, 5, 6). The question remains as to whether an endogenous activating ligand actually exists for this receptor family. Recent crystallographic studies suggest that in the absence of ligand, ERRs assume the conformation of ligand-activated nuclear receptors (7). It is thus possible that ERRs are constitutively active orphan nuclear receptors regulated mainly in an antagonistic manner.
Of the three isoforms of the ERR, ERR
is the most widely expressed in adult tissues (1, 8). ERR
is expressed in both fetal and adult tissues with high levels of expression noted in the heart and kidney (1, 9, 10, 11, 12). However, relatively little is known concerning its regulation or gene targets in development or adulthood.
Although ERR
displays some sequence similarity to estrogen receptors (ER), its transcriptional activity is not limited by recognition of estrogen response elements. Although ERR
can bind estrogen response elements as homodimers or heterodimers (13, 14), it can also bind extended nuclear receptor half-sites (i.e. TnAGGTCA), also known as ERR response elements (ERRE) as monomers or homodimers (8, 13, 15, 16) and have been shown to both enhance and repress gene transcription (8, 9, 14, 15, 17, 18, 19, 20, 21, 22). Another orphan receptor, steroidogenic factor 1 (SF1; NR4A1) also regulates transcription through nuclear receptor half-sites and has been shown to be critical for development of adrenals and gonads (23, 24). In addition, SF1 regulates transcription of the genes encoding the steroidogenic acute regulatory (StAR) protein and several of the enzymes involved in steroid hormone biosynthesis (25, 26, 27, 28).
The ability of SF1 and ERR
to regulate transcription through similar cis-elements and their coexpression within adrenocortical cells led us to define the role of ERR
in the regulation of steroidogenic enzyme gene transcription. Herein, we demonstrate that ERR
is expressed in the human adrenal gland and that it acts to increase expression of 17
-hydroxylase/17,20-lyase (CYP17) and dehydroepiandrosterone (DHEA) sulfotransferase (SULT2A1). In addition, the effects of ERR
on transcription of the genes encoding steroidogenic enzymes was unique from that seen for SF1.
| Materials and Methods |
|---|
|
|
|---|
Primers for the amplification were based on published sequences for human ERR
and SULT2A1. The following primer sequences were used: ERR
(NM_004451) forward, 5'-CACCATCAGCTGGGCCAAGAG-3' (exon 5), and reverse, 5'- GGTCAGACAGCGACAGCGATG (exon 6), which produced a 55-bp fragment; and SULT2A1 (NM_003167) forward, 5'-TCGTGATAAGGGATGAAGATGTAATAA-3' (exon 1), and reverse, 5'-TGCATCAGGCAGAGAATCTCA-3' (exon 2), which produced an 83-bp fragment. PCR were performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems) in a total volume of 30 µl reaction mixture following the manufacturers recommendations using the SYBR Green Universal PCR master mix (Applied Biosystems), 0.1 µM of each primer, and 5 µl of each first-strand cDNA sample. A dissociation protocol was performed at the completion of each experiment to verify that a single specific PCR product was amplified. Standard curves were prepared using the human ERR
expression vector. No-template controls contained water in place of first-strand cDNA. Each sample was normalized on the basis of its 18S rRNA content. The 18S quantification was performed using a TaqMan rRNA reagent kit (Applied Biosystems) following the manufacturers recommendations.
Protein immunoblotting analysis
Cultured H295R adrenocortical cells and adult adrenal and liver samples were used to prepare nuclear extract following the protocol described previously (30). PAGE was carried out on the samples using a precast Novex gel electrophoresis system with 412% bis-Tris NuPage gels (Invitrogen, Carlsbad, CA). Proteins were electrophoretically transferred onto polyvinylidene difluoride membranes by wet transfer for 1 h at 30 V. After transfer, the membranes were incubated overnight at 4 C with rabbit ERR
-specific antibody (1:1000 dilution) designed against the N-terminal region of ERR
(catalog no. AB16363; Abcam, Cambridge, MA). Membranes were incubated with horseradish peroxidase-conjugated secondary antibodies, and immunoreactive bands were visualized using enhanced chemiluminescence Western blotting detection reagents from Amersham Pharmacia Biotech (Piscataway, NJ). Lamin B (catalog no. SC-6216; Santa Cruz Biotechnology, Santa Cruz, CA) was used as a loading control for nuclear extracts.
Cell culture and transfection assay
Transfection assays were performed using CV-1 cells, which were derived from the kidney of the African green monkey (ATCC CCL-70; American Type Culture Collection, Rockville, MD) (31) because of their significantly lower levels of ERR
expression than adrenal cells (data not shown). CV-1 cells were cultured in DMEM/F12 medium (Invitrogen) supplemented with 5% NuSerum (Collaborative Biom, Bedford, MA) and antibiotics. For transfection experiments, Fugene 6 (Roche, Indianapolis, IN) was used to transfect 1 µg of reporter plasmid and 0.3 µg of expression vectors. To assure constant amounts of DNA per well for each transfection, pCMX empty vector was used. The cells were cotransfected with 50 ng/well of ß-galactosidase plasmid (Promega, Madison, WI) to normalize luciferase activity. Cells were harvested 2224 h after recovery and assayed for luciferase activity using the luciferase assay system (Promega).
Preparation of reporter constructs and expression vectors
The 5'-flanking DNA from the human genes for StAR, cholesterol side-chain cleavage (CYP11A1), 3ß-hydroxysteroid dehydrogenase type II (HSD3B2), 11ß-hydroxylase (CYP11B1), aldosterone synthase (CYP11B2), CYP17, and SULT2A1 were inserted upstream of the firefly luciferase gene in the reporter vector pGL3basic (Promega). SULT2A1 deletion constructs were described previously (32). Empty pGL3basic served as the control vector to measure basal activity in all transfections. The human ERR
and VP16-ERR
were described previously (4). The coding regions of human SF1 and DAX (dosage-sensitive sex reversal, adrenal hypoplasia congenital, critical region on the X chromosome, gene 1) were inserted into the eukaryotic expression vector pcDNA 3.1 zeo (Invitrogen) (26). Mutations to putative ERR
binding sites in the SULT2A1 promoter were created using the QuikChange XL site-directed mutagenesis kit (Stratagene, La Jolla, CA) following the manufacturers recommendations. Primer sets used for the mutations have been previously described (32).
Immunohistochemistry
Immunohistochemical analysis was performed employing the streptavidin-biotin amplification method using a Histofine Kit (Nichirei, Tokyo, Japan). Antibodies used include SULT2A1 (rabbit polyclonal) (33), SF1 (rabbit polyclonal) (kindly provided by Dr. K. Morohashi, National Institute for Basic Biology, Okazaki, Japan) (34), and ERR
(mouse monoclonal; 2ZH5844H) purchased from Perseus Proteomics (Tokyo, Japan) (35). Antigen retrieval for immunostaining of SF1 and ERR
was performed by heating the slides in an autoclave at 121 C for 5 min in citric acid buffer (2 mM citric acid and 9 mM trisodium citrate dehydrate, pH 6.0). The dilutions of the primary antibodies used in this study were 1:1000. The antigen-antibody complex was visualized with 3.3'-diaminobenzidine solution [1 mM diaminobenzidine, 50 mM Tris-HCl buffer (pH 7.6), and 0.006% H2O2] and counterstained with hematoxylin. For negative controls (data not shown), normal rabbit or mouse IgG was used instead of primary antibodies, and no specific immunoreactivity was detected in these sections. Histological identification of three zones of the human adrenal cortex was based on previously published criteria (36).
EMSA
Nuclear extracts from human adult adrenal tissue were prepared as described above. EMSA were performed as previously described (30) using the oligonucleotides for cis-elements in the SULT2A1 gene as described previously (32).
Data analysis and statistical methods
Data from at least three experiments run in triplicate, for a total of nine independent observations for each condition, were pooled and analyzed using single-factor ANOVA with Student-Newman-Keuls multiple comparison method, using SigmaStat version 3.0 (SPSS, Chicago, IL). Significance was accepted at the 00.05 level of probability.
| Results |
|---|
|
|
|---|
mRNA and protein
in the human adult adrenal gland and to characterize the expression pattern of ERR
in steroidogenic tissues, quantitative real-time RT-PCR was performed using mRNA isolated from human adult adrenal, ovary, testis, placenta, and fetal adrenal as well as control tissues (fetal brain, heart, and kidney) reported to highly express ERR
(1, 8) (Fig. 1
transcripts in the fetal adrenal (0.61 amol/µg 18S) and placenta (0.60 amol/µg 18S) were comparable to the levels detected in the testis (0.50 amol/µg 18S), fetal brain (0.49 amol/µg 18S), and fetal kidney (0.60 amol/µg 18S) tissue samples. Compared with other tissues, the expression of ERR
mRNA in the liver was low (0.205 amol/µg 18S). This observation is in agreement with the levels of ERR
mRNA detected in previously published Northern analysis data (1, 11). Once the presence of ERR
mRNA in the human adrenal was demonstrated, Western analyses were performed to confirm the presence of the ERR
protein (Fig. 2
-specific antibody revealed the presence of ERR
protein in nuclear extracts of human adult adrenal glands as well as in the H295R adrenocortical cell line. No detectable level of ERR
protein was found in liver nuclear extract, which correlates with the real-time RT-PCR data and with previous studies indicating low levels of ERR
expression in liver (1, 11).
|
|
within the human adrenal gland (Fig. 3
immunoreactivity was detected in nuclei of cortical cells of the entire adrenal cortex, including zona glomerulosa (Fig. 3A
was detected in the cells of the adrenal capsule or inner medullary cells. No staining was observed in the absence of ERR
antibody.
|
activates the transcription of SULT2A1 and CYP17
in the regulation of adrenal steroidogenesis, we examined its effects on the transcription of the genes encoding the enzymes involved in steroid hormone biosynthesis and the StAR protein. The promoter constructs tested include CYP11A1, StAR, HSD3B2, CYP17, CYP11B1, CYP11B2, and SULT2A1. To minimize competition with endogenously expressed ERR
, CV-1 cells were used for transfection studies because these cells express low levels of ERR
(data not shown). Of all constructs tested, only CYP17 (1.5-fold) and SULT2A1 (2.6-fold) showed transcriptional activation when cotransfected with 0.1 µg ERR
(Fig. 4A
chimera, which contains a VP16 insert directly 5' to the ERR
coding sequence. This VP16 insert is a portion of the viral protein 16 promoter region isolated from the herpes simplex virus, and when placed upstream to the ERR
coding sequence, it mimics a ligand-activated transcriptional response. Again, only the CYP17 (12.1-fold) and SULT2A1 (79.5-fold) reporter constructs exhibited a marked responsiveness to the VP16-ERR
chimera (Fig. 4B
|
was then cotransfected into CV-1 cells with the SULT2A1 reporter construct and increasing concentrations of expression vectors encoding ERR
or VP16-ERR
(Fig. 5
and VP16-ERR
in a concentration-dependent manner with activity increasing to 10.2- and 223.4-fold above basal levels, respectively, when cells were cotransfected with 1.0 µg/well of expression plasmid.
|
. To determine whether these nuclear receptor half-sites were potential ERREs, a series of deletion constructs were created containing progressively shorter fragments of SULT2A1 5'-flanking DNA. These deletion constructs were cotransfected into CV-1 cells with empty pCMX expression plasmid or pCMX containing the ERR
(Fig. 6B
(Fig. 6C
responsiveness was reduced by approximately 50% of that seen with the wild-type promoter when the 1063 promoter deletion construct was cotransfected. Reporter activity further decreased after transfection with the 50 deletion fragment of the SULT2A1 to a level similar to that observed with pGL3basic vector. The pattern of effects of the various SULT2A1 promoter deletions on reporter activity was similar for both wild-type ERR
and VP16-ERR
. The combination of sequence and deletion analyses indicates three potential ERR
cis-elements: 1191, 85, and 65.
|
cis-element, all three sites were individually mutated in the context of the full-length (1259 bp) SULT2A1 gene promoter (Fig. 7A
(Fig. 7B
(Fig. 7C
responsiveness to approximately 40% of wild type. After mutation of the 85 site, VP16-ERR
responsiveness is lowered to 5% of wild type. Finally, VP16-ERR
responsiveness of the SULT2A1 gene promoter is lowered to 16% of wild type after mutation of the possible ERRE at 65. The effect of mutation of these cis-elements was similar for both wild-type ERR
and VP16-ERR
with regard to the fold induction of reporter activity.
|
binding to putative ERR
cis-elements of the SULT2A1 promoter
interacts directly with either the 85 or 65 cis-element of the SULT2A1 promoter, 32P-labeled oligonucleotides containing sequence to correspond with these specific elements were prepared and used in EMSA analysis (Fig. 8
was added to the reaction mixture in a dose-dependent fashion.
|

also enhances transcription of a steroid-metabolizing enzyme gene, SULT2A1, via binding of nuclear receptor half-sites. Therefore, we next examined the combined effects of SF1 and ERR
on the SULT2A1 reporter construct.
CV-1 cells were cotransfected with the luciferase reporter construct for SULT2A1 and expression plasmids containing the coding sequences for ERR
, SF1, or a combination of both ERR
and SF1 (Fig. 9
). The level of SF1 (0.1 µg/well) used in the transfection was optimized before testing and enhanced transcription of the SULT2A1 promoter approximately 4-fold over basal, whereas ERR
(0.3 µg/well) enhanced transcription 5.1-fold over basal. When SF1 and ERR
were cotransfected, SULT2A1 transcription was enhanced 4.4-fold over basal, indicating that these factors likely exert their effects on SULT2A1 transcription independently, perhaps using the same cis-elements.
|
activation of SULT2A1 transcription
use some of the same nuclear receptor half-sites, the question arises whether DAX1 can also inhibit the effects of ERR
on the SULT2A1 promoter. CV-1 cells were cotransfected with the luciferase reporter constructs for SULT2A1 and expression plasmids containing the coding sequences for ERR
, SF1, or both in combination with the expression plasmid for DAX1 (Fig. 9
and SF1 enhances SULT2A1 reporter gene transcriptional activation more than 4.4-fold over basal activity. Addition of DAX1 completely ablated the ability of both ERR
and SF1 to enhance SULT2A1 transcription, reducing activity to that observed with pGL3basic vector. | Discussion |
|---|
|
|
|---|
In the past, the production of DHEAS from the zona reticularis, unlike the products of the zona glomerulosa and zona fasciculata, has received relatively little attention mostly because of its existence only in humans and a few other primates. The primate-specific production of these adrenal steroids has limited model-system access for laboratory research. Also, the fact that DHEAS lacks direct androgen activity and that a definitive receptor has not been defined has slowed research into its function in steroid-mediated biological processes (46, 47). Although the enzymatic activity of SULT2A1 has been studied in some detail, the mechanisms controlling transcriptional regulation of the SULT2A1 gene are still largely unknown.
In recent years, the roles of nuclear hormone receptors in the regulation of physiological processes have been studied widely and with steady progress. Various nuclear hormone receptors are involved in a wide range of functions including development, cell growth, and differentiation (48, 49, 50, 51, 52). The functional roles maintained by nuclear hormone receptors are sometimes mediated by nuclear hormone receptor ligands. However, ligands have not been identified for all of the known nuclear hormone receptor families and thus, these nuclear receptors with no known ligand have been given the name orphan receptors. Identified because of their similarity to the classic ER
, the ERR were among the first orphan nuclear receptors ever described (1). These orphan receptors, along with the estrogen receptors, belong to group III of the nuclear receptor superfamily, which also includes the glucocorticoid, mineralocorticoid, progesterone, and androgen receptors.
The number of target genes for the ERR family of nuclear transcription factors is rapidly growing, whereas the prospect of finding endogenous activating ligands for each family member appears to be decreasing. It is possible that no activating ERR ligands exist and that regulation of ERR activity might reside in the regulation of its expression. ERR
in particular has been attributed with various functional roles involving multiple target genes. ERR
is known as a transcriptional repressor of the simian virus 40 promoter (19), as a repressor of retinoic acid induction of the medium-chain acyl coenzyme A dehydrogenase (MCAD) gene (8), and as a repressor of the aromatase promoter (53) as well as an activator of the thyroid receptor
gene promoter (15) and the osteopontin gene (10). ERR
is widely expressed in adult tissues and exhibits a broad range of target genes, and previous reports have shown expression in the mouse adrenal gland (1). Herein we demonstrated that ERR
is present in the human adrenal and that it is able to regulate transcription of steroidogenic enzymes. Both real-time RT-PCR and Western blot analysis confirm the presence of ERR
in the human adrenal, whereas immunohistochemical staining localizes ERR
to the nuclei of the adrenocortical cells. Transfection analyses indicate that steroid sulfotransferase, encoded by the SULT2A1 gene, was the steroid-metabolizing gene most responsive to cotransfection with ERR
, whereas CYP17 also showed a moderate response.
The consensus extended half-site, 5'TnAAGGTCA-3', also known as the ERRE (8) was first identified in the human lactoferrin gene promoter (16). Subsequent studies have shown that ERR
is capable of binding the ERRE as a monomer (13) or as a homodimer (15). However, ERR
is not the only transcription factor that is known to bind this particular DNA element. This binding site is also recognized by the monomeric orphan nuclear receptor SF1, which is a well known regulator of steroid biosynthesis in the adrenal cortex (54, 55, 56). This SF1 response element, which is identical to the ERRE, has previously been identified within the SULT2A1 gene promoter (32), and SF1 was found to use two such sites (-85 and 65). Thus, ERR
may also act via these cis-elements, as well as other possible SF1 response elements previously identified, further adding to the complexity of regulation of SULT2A1 gene expression within the human adrenal cortex.
Analysis of the SULT2A1 5'-flanking region revealed six possible nuclear receptor half-sites for ERR
action (1191, 895, 499, 302, 85, and 65 sites). However, deletion analysis of the flanking region indicated that when interacting with the ERR
construct, the 85 and 65 sites played significant roles in the activation of the SULT2A1 gene transcription. Use of the VP16-ERR
chimera further indicated that the 1191 site on the SULT2A1 promoter was significantly involved in gene transcription. Mutational manipulation of the individual cis-elements confirmed that maximal ERR
enhancement of SULT2A1 reporter gene activity relied on all three sites but particularly the 85 and 65 sites. Further investigation via EMSA confirmed a direct interaction of the ERR
protein with the 85 and 65 sites in vitro. Because most of the ERR
-related enhancement of SULT2A1 gene activity could be localized to the 85 and 65 sites of the gene promoter, and SF1 has previously been shown to act at the same sites, the question arises as to whether SF1 and ERR
act collectively at these sites or in competition with each other. We have shown that the two nuclear receptors likely compete for the 85 and 65 sites to produce similar levels of gene transcriptional activation.
Because ERR
is expressed throughout the adrenal cortex, this suggests that it may play additional roles in the regulation of adrenal hormone production that are yet to be elucidated. The suggestion that ERR
competes with SF1 for certain of its nuclear receptor half-sites infers a parallel purpose of the two nuclear hormone receptors. In that regard, both SF1 and ERR
are inhibited by DAX1, a nuclear hormone receptor previously shown to interact with SF1 and block its transcriptional activity through the recruitment of corepressors (57). Despite the ability of these factors to compete for certain cis-elements, our results (Fig. 1
) demonstrate that the effects of ERR
are not the same as is seen for SF1, suggesting that the role of these two transcription factors in the adrenal is distinct (26, 37). The ability of SF1 to transactivate all genes encoding adrenal steroidogenic enzymes (except aldosterone synthase) suggests a much broader role for SF1 in the regulation of steroidogenic enzymes. Our data would suggest that both SF1 and ERR
share the ability to enhance SULT2A1 and CYP17 transcription. Intriguingly, both of these enzymes are needed for the production of DHEAS.
The adrenal zona reticularis is known for its production of DHEA and DHEAS, and previous studies have shown the presence of SULT2A1 in the cytosol of the cells composing the reticularis (33, 36, 58). However, little is known about the mechanisms involved in the production of DHEA or DHEAS from this cortical zone. The role of orphan nuclear receptors as regulators of transcription has been the key to understanding the mechanisms controlling regulation of the SULT2A1 gene in the absence of appropriate animal models. The results presented here demonstrate a tissue-specific regulation of the SULT2A1 gene by the orphan nuclear receptor ERR
and thus shed more light on the processes involved in adrenal DHEAS production.
| Footnotes |
|---|
First Published Online May 5, 2005
Abbreviations: DAX, Dosage-sensitive sex reversal, adrenal hypoplasia congenital, critical region on the X chromosome, gene 1; DHEA, dehydroepiandrosterone; DHEAS, DHEA sulfate; ER, estrogen receptor; ERR, estrogen-related receptors; ERRE, ERR response elements; SF1, steroidogenic factor 1; StAR, steroidogenic acute regulatory protein.
Received December 16, 2004.
Accepted for publication April 27, 2005.
| References |
|---|
|
|
|---|
. Endocrinology 142:45724575
. Proc Natl Acad Sci USA 98:88808884
coactivator 1
(PGC-1
) signaling by an estrogen-related receptor
(ERR
) ligand. Proc Natl Acad Sci USA 101:89128917
is a transcriptional regulator of the human medium-chain acyl coenzyme A dehydrogenase gene. Mol Cell Biol 17:54005409[Abstract]
1: molecular cloning and estrogen responsiveness. J Mol Endocrinol 19:299309
1 functionally binds as a monomer to extended half-site sequences including ones contained within estrogen-response elements. Mol Endocrinol 11:342352
(estrogen receptor-related receptor-
). Mol Endocrinol 13:764773
gene promoter by the orphan nuclear receptor ERR
. Oncogene 17:24292435[CrossRef][Medline]
-1 orphan receptor. Cancer Res 59:45194524
1 interacts with coactivator and constitutively activates the estrogen response elements of the human lactoferrin gene. J Biol Chem 275:2083720846
5-
4 isomerase promoter by the transcription factor steroidogenic factor-1/adrenal 4-binding protein and phorbol ester. J Biol Chem 272:79607967
in human breast carcinoma as a potent prognostic factor. Cancer Res 64:46704676
-hydroxydehydroepiandrosterone sulfate in cultured human choriocarcinoma JEG-3 cells: effect on estrone, 17ß-estradiol, and estriol secretion. J Clin Endocrinol Metab 63:751757
. Cancer Res 59:48644869
-1 orphan receptor. Cancer Res 58:56955700This article has been cited by other articles:
![]() |
Y. Nakamura, Y. Xing, H. Sasano, and W. E. Rainey The Mediator Complex Subunit 1 Enhances Transcription of Genes Needed for Adrenal Androgen Production Endocrinology, September 1, 2009; 150(9): 4145 - 4153. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Hu, H. K. Kinyamu, L. Wang, J. Martin, T. K. Archer, and C. Teng Estrogen Induces Estrogen-related Receptor {alpha} Gene Expression and Chromatin Structural Changes in Estrogen Receptor (ER)-positive and ER-negative Breast Cancer Cells J. Biol. Chem., March 14, 2008; 283(11): 6752 - 6763. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Ariazi, R. J. Kraus, M. L. Farrell, V. C. Jordan, and J. E. Mertz Estrogen-Related Receptor {alpha}1 Transcriptional Activities Are Regulated in Part via the ErbB2/HER2 Signaling Pathway Mol. Cancer Res., January 1, 2007; 5(1): 71 - 85. [Abstract] [Full Text] [PDF] |
||||
![]() |
R A Stein and D P McDonnell Estrogen-related receptor {alpha} as a therapeutic target in cancer Endocr. Relat. Cancer, December 1, 2006; 13(Supplement_1): S25 - S32. [Abstract] [Full Text] [PDF] |
||||
![]() |
A M Tarrant, S R Greytak, G V Callard, and M E Hahn Estrogen receptor-related receptors in the killifish Fundulus heteroclitus: diversity, expression, and estrogen responsiveness. J. Mol. Endocrinol., August 1, 2006; 37(1): 105 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-H. Huang, C.-Y. Lee, P.-J. Tai, C.-C. Yen, C.-Y. Liao, W.-J. Chen, C.-J. Liao, W.-L. Cheng, R.-N. Chen, S.-M. Wu, et al. Indirect Regulation of Human Dehydroepiandrosterone Sulfotransferase Family 1A Member 2 by Thyroid Hormones Endocrinology, May 1, 2006; 147(5): 2481 - 2489. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Song, I. Echchgadda, Y.-K. Seo, T. Oh, S. Kim, S.-A Kim, S. Cho, L. Shi, and B. Chatterjee An Essential Role of the CAAT/Enhancer Binding Protein-{alpha} in the Vitamin D-Induced Expression of the Human Steroid/Bile Acid-Sulfotransferase (SULT2A1) Mol. Endocrinol., April 1, 2006; 20(4): 795 - 808. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |