help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0103
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, Y.
Right arrow Articles by Hyder, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, Y.
Right arrow Articles by Hyder, S. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Endocrinology Vol. 146, No. 8 3632-3641
Copyright © 2005 by The Endocrine Society

Proliferation of Endothelial and Tumor Epithelial Cells by Progestin-Induced Vascular Endothelial Growth Factor from Human Breast Cancer Cells: Paracrine and Autocrine Effects

Yayun Liang and Salman M. Hyder

Dalton Cardiovascular Research Center and Biomedical Sciences, University of Missouri, Columbia, Missouri 65211

Address all correspondence and requests for reprints to: Dr. Salman M. Hyder, Dalton Cardiovascular Research Center, University of Missouri, 134 Research Park Drive, Columbia, Missouri 65211. E-mail: hyders{at}missouri.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Angiogenesis, the formation of new blood vessels, is essential for tumor expansion, and vascular endothelial growth factor (VEGF) is one of the most potent angiogenic growth factors known. We have previously shown that natural and synthetic progestins, including those used in hormone replacement therapy and oral contraception, induce the synthesis and secretion of VEGF in a subset of human breast cancer cells in a progesterone receptor-dependent manner. We now report that conditioned medium from progestin-treated breast tumor cells can induce the proliferation of endothelial cells in a paracrine manner and induce the proliferation of tumor epithelial cells in a paracrine and an autocrine manner. The use of an anti-VEGF antibody and SU-1498, an inhibitor of VEGF receptor-2 (VEGFR-2 or flk/kdr) tyrosine kinase activity, demonstrated that these effects involve interactions between VEGF and VEGFR-2. Also, blockage of progestin-induced VEGF by the antiprogestin RU-486 (mifepristone) eliminated VEGF-induced proliferative effects. The ability of VEGF to increase the proliferation of endothelial cells and tumor cells, including those that do not release VEGF in response to progestins, suggests that these effects are mediated by amplification of the progestin signal, which culminates in angiogenesis and tumor growth. These novel findings suggest that targeting the release of VEGF from tumor epithelial cells as well as blocking interactions between VEGF and VEGFR-2 on both endothelial and tumor epithelial cells may facilitate the development of new antiangiogenic therapies for progestin-dependent breast tumors. Furthermore, these data indicate that it would be useful to develop selective progesterone receptor modulators that prevent the release of angiogenic growth factors from breast cancer cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
CANCER PROGRESSION IS dependent on the development of a rich vascular network that supplies vital nutrients to the growing tumor (1, 2, 3, 4). Angiogenesis, which is the process of new blood vessel formation, is regulated by a number of potent growth factors, one of the most effective of which is vascular endothelial growth factor (VEGF) (5, 6). It has been clearly established that VEGF is produced by many tumor cells, including breast cancer cells (7, 8), and the VEGF content of tumor cells has been shown to correlate with the prognosis of patients with breast cancer (9, 10). It has also been demonstrated that VEGF produced from tumor cells is essential for the expansion of breast cancer (3, 4), presumably by increasing proliferation of endothelial cells from neighboring blood vessels through interactions with the VEGF receptor-2 (VEGFR-2), also known as flk/kdr, present on these cells. Some recent studies have demonstrated that breast cancer cells themselves express VEGFR-2 on epithelial and stromal cells, leading to speculations that tumor-produced VEGF has additional biological functions, perhaps promoting the proliferation and survival of tumor cells (6, 11, 12). These observations raise the interesting possibility that tumor-induced VEGF secretion may function in both a paracrine and an autocrine manner to allow tumor expansion and growth.

Many human breast cancers are dependent on sex steroids for growth and expansion (13). Much emphasis has been placed on the role of estrogens in the proliferation of breast cancer cells. However, the role of progestins in the proliferative response of breast cancer cells is more controversial, and both positive and negative effects of progestins have been described (14, 15). Only limited information is available on the roles of estrogens and progestins in regulating angiogenic growth factors in human breast cancer (16). We recently discovered that progestins induce VEGF in breast cancer cells (17, 18). Additional analysis revealed that such induction was confined to cells that contain the progesterone receptor (PR) and mutant p53 protein (BT-474 and T47-D) or lack p53 tumor suppressor (HCC-1428), but not in cells that contain the wild-type p53 (MCF-7 and HCC-1500) (19). Approximately 50% of all breast tumors are PR positive (20), and 50–60% of all breast tumors are known to carry p53 mutations (21, 22). Thus, there is a large population of patients with breast cancer who might carry tumor cells that have the potential to regulate VEGF via the PR. Therefore, it is critical to investigate the functional role of progestin-induced VEGF in promoting angiogenesis and breast cancer cell growth, because PR could be considered a target for therapeutic intervention of VEGF production (23).

It has been suggested that tumor-secreted VEGF can diffuse from tumor cells and increase the proliferation of surrounding endothelial cells (1, 2). However, the release of VEGF from cells does not always correlate with angiogenesis (24, 25, 26). In addition, inhibitory isoforms of VEGF have been reported that prevent the classical VEGF-mediated proliferative response of endothelial cells and thus prevent angiogenesis (27, 28). Therefore, it cannot be assumed that hormone-induced VEGF from tumor cells is always angiogenically active. Because progestins have been implicated in breast tumor progression, and expansion of tumors is dependent on angiogenesis (1, 2), we asked whether progestin-induced VEGF from breast cancer cells can regulate angiogenesis. In the present study we investigated whether progestin-induced VEGF from three different breast tumor cell lines can function in a paracrine manner to induce the proliferation of human umbilical vein endothelial cells (HUVECs). In addition, we determined whether progestin-induced VEGF from breast tumor cell lines can function in a paracrine/autocrine manner to increase the proliferation of tumor epithelial cells themselves. Our novel findings indicate that progestin-induced VEGF from tumor cells can increase the proliferation of both endothelial and tumor epithelial cells. The biological implications of these observations with respect to hormone replacement therapy (HRT) regimens used in the clinical setting are discussed.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Materials
Human breast cancer cell lines (T47-D, BT-474, HCC-1428, and MDA-MB-231) and HUVECs were obtained from American Type Culture Collection (Manassas, VA). RPMI 1640 and F-12K media were also obtained from American Type Culture Collection. Phenol red-free DMEM/Ham’s F-12 (DME/F12) medium, PBS, and 0.05% trypsin-EDTA were purchased from Invitrogen Life Technologies (Grand Island, NY). Fetal bovine serum (FBS) was obtained from JRH Biosciences (Lenexa, KS). Recombinant human VEGF165 (rhVEGF; 293-E), the anti-VEGF antibody (AF-293-NA), the IgG antibody control, and a Quantikine VEGF ELISA kit were acquired from R&D Systems, Inc. (Minneapolis, MN). Progesterone, medroxyprogesterone acetate (MPA), endothelial cell growth supplement, sulforhodamine B (SRB), and heparin were purchased from Sigma-Aldrich Corp. (St. Louis, MO). The flk/kdr tyrosine kinase inhibitor SU-1498 was obtained from Calbiochem (La Jolla, CA). The ELISA kit to detect bromodeoxyuridine (BrdU) incorporation in cells was purchased from Roche (Indianapolis, IN). All the primers were synthesized at IDT (Coralville, IA). Protein was quantified using the bicinchoninic acid assay (Pierce Chemical Co., Rockford, IL), and absorbance was measured at 562 nm with a SpecTRA MAX 190 microplate reader (Molecular Devices, Sunnyvale, CA).

Cell culture
Cells were grown in phenol red-free DME/F12 supplemented with 10% FBS (T47-D, BT-474) or 5% FBS (MDA-MB-231). HCC-1428 cells were grown in RPMI 1640 medium supplemented with 10% FBS, 10 mM HEPES, 1 mM sodium pyruvate, 2 mM L-glutamine, 4500 mg glucose/liter, and 1500 mg sodium bicarbonate/liter. HUVECs (passages 4–6) were cultured in F-12K medium supplemented with 0.1 mg/ml heparin, 0.05 mg/ml endothelial cell growth supplement, and 15% FBS. All of the cells were grown in 100 x 20-mm tissue culture dishes and harvested with 0.05% trypsin-EDTA.

Cell proliferation assay
BrdU incorporation, a nonradioactive alternative to [3H]thymidine incorporation, is based on the incorporation of the pyrimidine analog BrdU instead of thymidine into the newly synthesized DNA of proliferating cells. The incorporated DNA is detected with an ELISA against BrdU. Cells were seeded into each well of a 96-well plate and incubated overnight at 37 C in 5% CO2. Twenty-four hours before the experiment, the medium was replaced with serum-free DME/F12 for tumor cells or with DME/F12 with 0.5% FBS for HUVECs, after which cells were exposed to the desired pharmacological agents (VEGF, anti-VEGF antibody, progesterone, MPA, or SU-1498) for various periods, as indicated. BrdU (100 µM) was then added to wells containing tumor cells for 3 h or to wells containing endothelial cells for 15 h before termination of assay. After the BrdU-labeled culture medium was removed, Fixdenat solution (200 µl/well) was added for 1 h at room temperature. Fixdenat solution was removed, anti-BrdU-peroxidase working solution (100 µl/well) was added, and the plates were incubated for 90 min at room temperature. The antibody conjugate was removed, the wells were rinsed three times with 300 µl/well washing solution, and substrate solution (100 µl/well) was added. The plates were then incubated for 20 min at room temperature. Absorbance was read at 370 nm with a SpecTRA MAX 190 microplate reader. Each experimental point was assayed in six different wells, and each study was carried out in duplicate or triplicate.

Paracrine effects of progesterone- and MPA-induced VEGF on endothelial cell and epithelial breast tumor cell proliferation
BT-474, T47D, and HCC-1428 cells were grown in medium containing 10% FBS in 100-mm tissue culture dishes and allowed to reach approximately 70–80% confluence. Cells were then washed twice with PBS and placed in serum-free DME/F12 overnight. The medium was then changed, and the cells were treated with 10 nM progesterone or MPA for 24 h. Conditioned medium was collected, filtered through a 0.2-µm pore size membrane, and stored at –80 C. HUVECs or MDA-MB-231 were seeded at 5 x 103 cells/well in culture medium with FBS into a 96-well plate overnight as described above. For HUVECs, the medium was replaced with DME/F12 containing 0.5% FBS for 12 h, after which the medium was removed, and conditioned medium was added for 24 h with and without the anti-VEGF antibody or IgG control as previously reported (29). Fifteen hours before termination of the experiment, 100 µM BrdU was added to each well. BrdU incorporation was measured using the BrdU ELISA. For measuring the paracrine effects of progestin-induced VEGF on MDA-MB-231 cells, the plated cells were washed once with PBS and then incubated with serum-free DME/F12 for 24 h. The medium was then replaced with conditioned or unconditioned medium for 24 h. BrdU (100 µM) was added to each well 3 h before the termination of treatment, followed by ELISA for determination of BrdU incorporation in the cells. To neutralize the VEGF effect in the hormone-treated conditioned medium or the rhVEGF before addition to the cells, aliquots (100 µl containing 100 ng/ml rhVEGF or conditioned medium) were incubated with anti-VEGF antibody (2 µg/ml) or a control IgG (2 µg/ml) at 37 C for 1 h and then placed over the cells.

Autocrine effects of progesterone- and MPA-induced VEGF on tumor cell proliferation
Human breast cancer cells T47D (6 x 103), BT-474, and HCC-1428 (8 x 103) were seeded into each well of a 96-well plate in the appropriate medium with 10% FBS and incubated overnight at 37 C in 5% CO2. The medium was removed, the plated cells were washed once with DME/F12, and the cells were incubated with serum-free DME/F12 for 24 h. Serum-free medium was once again replaced, and the cells were preincubated at 37 C with 2 µM SU-1498 to block the tyrosine kinase activity of VEGFR2 (flk/kdr) for 2 h. Incubation was continued by replacing the medium with medium containing SU-1498, 10 nM progesterone or MPA, 1 µM RU-486 (antiprogestin mifepristone), and 100 ng/ml rhVEGF in the presence or absence of 2 µg/ml anti-VEGF antibody or IgG control for 24 h. BrdU (100 µM) was added 3 h before termination of the experiment, followed by ELISA for determination of BrdU incorporation by the cells. To neutralize rhVEGF before addition to the cells, aliquots (100 µl containing 100 ng/ml rhVEGF) were incubated with anti-VEGF antibody (2 µg/ml) or a control IgG (2 µg/ml) at 37 C for 1 h and then placed over the cells.

Cell viability assay
Viable cells were quantitated using the SRB assay as described previously (30, 31). This cell protein dye-binding assay is based on measurement of the protein content of surviving cells as an index to determine cell growth and cell viability. Briefly, 5 x 103 cells/well (HUVEC) or 8 x 103 cells/well (MDA-MB-231) in 100 µl culture medium were seeded into each well of a 96-well plate and incubated overnight at 37 C in 5% CO2. Medium was changed to DME/F12 and 0.5% FBS for 12 h (HUVEC) or to serum-free DME/F12 for 24 h (MDA-MB-231). Cells were then treated with VEGF, anti-VEGF antibody, or conditioned medium for different periods up to 48 h. Surviving or adherent cells were fixed in situ by adding 100 µl 50% cold trichloroacetic acid, then incubated at 4 C for 1 h. Cells were washed five times with ice-cold water, dried, and stained in 50 µl 4% SRB for 8 min at room temperature. Unbound dye was washed five times with cold 1% acetic acid, the plate was dried at room temperature, and bound stain was solubilized with 150 µl 10 mM Tris. The absorbance of samples was read at 520 nm with a SpecTRA MAX 190 microplate reader (Sunnyvale, CA). There were six to 12 wells/concentration, and each experiment was performed in duplicate or triplicate.

VEGF ELISA
BT-474, T47D, and HCC-1428 cells were grown in the appropriate medium containing 10% FBS in 100-mm tissue culture dishes and allowed to reach 60–70% confluence. Cells were washed twice with PBS, and the medium was changed to serum-free DME/F12 and incubated for 24 h. The serum-free medium (SFM) was replaced, and the cells were treated with or without 10 nM progesterone or MPA for 18 h. Conditioned medium was collected for determination of VEGF. VEGF was quantitated using a Quantikine kit according to the manufacturer’s protocol. Inter- and intraassay coefficients of variance, provided by the manufacturer for cell culture supernatant assay, were 5.0–8.5% and 3.5–6.5%, respectively. VEGF values were calculated by plotting absorbance at 450 and 540 nm and comparing unknown values to standards. Estimated VEGF expression was normalized to the total protein concentration per assay. Total cellular protein was isolated as follows. Cell pellets were washed once with cold PBS and resuspended in 0.3 ml lysis buffer [50 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 1% Nonidet P-40]. The cell suspension was vortexed for 10 sec, incubated on ice for 30 min, and centrifuged at 14,000 rpm for 15 min at 4 C. The supernatant was transferred to a fresh tube, and the protein concentration was determined by bicinchoninic acid assay.

RT-PCR for VEGF receptors flk/kdr and flt-1
Cells were grown in DME/F12 supplemented with 5% dextran-coated charcoal (DCC) serum for 24 h. RNA was prepared using UltraSpec (Biotecx, Houston, TX), according to the manufacturer’s protocol. RT-PCR was carried out using Platinum PCR Supermix (Invitrogen Life Technologies, Inc., Carlsbad, CA) in an Applied Biosystems 2700 thermocycler (Foster City, CA). PCR parameters were as follows: 94 C for 5 min, 35 cycles at 94 C for 30 sec, 55 C for 30 sec, 72 C for 30 sec, and, finally, 72 C for 7 min. The PCR product was analyzed on a 2% agarose gel containing 1 µg/ml ethidium bromide. Electrophoresis was carried out in 0.5x TBE, pH 8.0, at 80 V for 2 h, after which the gels were photographed under UV light. The 18S RNA was used as an internal control. Primer sequences were as follows: flk (400-bp product): sense, CATCACATCCACTGGTATTGG; antisense, GCCAAGCTTGTACCATGTGAG; and flt-1 (300-bp product): sense, TACACAGGGGAAGAAATCCT; antisense, ACAGAGCCCTTCTGGTTGGT. Primers were synthesized by IDT. Primers for the 18S internal control were obtained from Ambion, Inc. (Austin, TX).

Statistical analysis
Statistical analysis was carried out using ANOVA. Nonparametric tests based on ranks were used as needed. Values were considered significant at P < 0.05. The Student-Newman-Keuls multirange test was used to compare means. Values are reported as the mean ± SEM.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Previously, we showed that natural and synthetic progestins increase VEGF mRNA and protein levels in breast cancer cells through a PR-mediated mechanism (17, 18, 19, 32, 33). In those studies we speculated that progestin-induced VEGF from tumor cells could promote angiogenesis by inducing the proliferation of endothelial cells, leading to tumor expansion. The outcome of a recent clinical HRT trial showed that treatment with progestins combined with estrogens increases the risk for breast cancer in postmenopausal women (34, 35). Because these tumors develop at a rate that cannot be explained by new tumorigenic events (36, 37), it is likely that progestins may influence the angiogenic cascade in at least a subset of undetected breast tumors or preneoplastic lesions to increase their expansion and detection within a short time frame. It has also been suggested that tumors detected after estrogen/progestin treatment of postmenopausal women are larger, of better prognostic value, and retain estrogen receptor (ER) and PR (36, 37). Thus, it is likely that progestins provide the angiogenic switch in previously undetected tumors or preneoplastic lesions that retain hormone receptors to allow expansion of tissue that is detected within a short time after HRT. However, the role of progestins in breast cancer biology is controversial, and both proproliferative and antiproliferative effects have been described (14, 15, 38, 39). Recent evidence suggests that progestins are mitogenic for breast cells in vivo in animal experiments (40), and the greatest proliferation of breast cells is observed during the luteal phase, when the concentration of progesterone is maximum (41).

Because of the uncertain role of progestins in breast cancer cells and due to the recent isolation of angiogenically inactive isoforms of VEGF (27, 28), we began an investigation to assess whether progestin-induced VEGF from breast cancer cells is proliferative for vascular endothelial cells. In the course of our study, we discovered that progestin-induced VEGF increased the proliferation not only of human endothelial cells, but also of breast tumor cells in an autocrine and a paracrine manner. This proliferation could be blocked by an anti-VEGF antibody or a small-molecule inhibitor of tyrosine kinase activity of VEGFR-2, SU-1498, indicating that a ligand/receptor (VEGF/VEGFR2)-mediated signaling loop is responsible for the proliferative response. The evidence obtained supporting our hypothesis is discussed below.

Our previously reported studies to demonstrate progestin-dependent induction of VEGF in tumor cells were conducted in 5% DCC serum devoid of steroids. This medium was collected for VEGF analysis after progestin or antiprogestin treatment (17, 18). However, to demonstrate that tumor-produced VEGF is angiogenically active, we needed to collect conditioned medium under serum-free conditions after tumor cells were treated with progesterone or MPA, as has been shown in other studies (42). Therefore, it was essential to establish that tumor cells retain progestin-dependent induction of VEGF under such serum-free conditions. Cells were therefore incubated overnight in DME/F12 without serum, followed by incubation with DME/F12 without serum and in the presence or absence of the hormones for 18–24 h. Figure 1Go shows that progesterone and MPA both induced VEGF in BT-474, T47-D, and HCC-1428 breast caner cells under serum-free conditions, with characteristics similar to those previously demonstrated in 5% DCC serum (17). As noted above, the antiprogestin RU-486 suppressed progestin-dependent VEGF in both T47-D and BT-474 cells, indicating that the response was PR dependent. Interestingly, in HCC-1428 cells, which do not express tumor suppressor p53, progestin-mediated induction of VEGF was only partially inhibited by RU-486, and RU-486 alone functioned as an agonist for VEGF induction, as previously demonstrated in 5% serum (Fig. 1Go). The findings shown in Fig. 1Go establish that tumor cells retain progestin-dependent induction of VEGF under serum-free conditions and that the conditioned medium can be collected and analyzed for angiogenic/proliferative activity.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 1. Progestin induction of VEGF in human breast cancer cells in SFM. BT-474, T47-D, and HCC-1428 cells were grown in medium with 10% FBS as described in Materials and Methods. Cells were washed with PBS and incubated in SFM overnight. The medium was then replaced, and incubation was continued for an additional 24 h in SFM without ligand [control (C)] or with progesterone (P) or MPA (10 nM) in the presence or absence of 1 µM RU-486 (RU) or with 1 µM RU-486 alone, as indicated. Conditioned media were collected, and VEGF was measured by ELISA (expressed as picograms of VEGF per milligram of cell protein). Values represent the mean ± SEM from three determinations. *, VEGF induction values significantly different from controls; **, values significantly inhibited compared with the induced values. The control or basal values (±SEM) for VEGF representing 100% (picograms per milligram of cell protein) are 1686 ± 103, 1026 ± 80, and 1301 ± 7.3 for BT-474, T47-D, and HCC-1428 cells, respectively.

 
Progestin-induced VEGF from breast tumor cells can increase the proliferation of endothelial cells
Although multiple growth factors induce the proliferation and migration of endothelial cells, VEGF is one of the best factors to study in this respect because of its multifunctional properties, including its function as a survival and an antiapoptotic factor (6). In the next series of experiments, we determined whether VEGF within conditioned medium collected from progestin-treated tumor cells was angiogenically active and able to increase proliferation of HUVECs.

Breast cancer cells were treated with either 10 nM progesterone or the synthetic progestin MPA, which is used in HRT, and the conditioned medium was collected after 24 h. HUVECs were exposed to the serum-free conditioned medium or to SFM alone for 24 h. Cell proliferation was monitored by measuring BrdU incorporation. As shown in Fig. 2AGo, exposure of HUVECs to conditioned medium collected from either progesterone- or MPA-treated BT-474 or T47-D cells or to rhVEGF significantly increased BrdU incorporation. The proliferative response of HUVECs was abolished in the presence of an anti-VEGF antibody, but not in the presence of nonimmune IgG, indicating that progestin-induced VEGF was the major factor that induces cellular proliferation in endothelial cells. BrdU incorporation in HUVECs exposed to medium collected from hormone-exposed tumor cells was 1.8- to 2.3-fold greater than that in control cells exposed to SFM. This was more than the proliferation observed in response to rhVEGF alone, which was present at an approximately 100-fold higher concentration than VEGF levels in medium collected from tumor cells (1–2 ng/ml; Fig. 2AGo, left panel). We determined that treatment of HUVECs with 100 ng/ml rhVEGF produces maximum proliferative response in our experimental conditions (data not shown). rhVEGF was used to confirm that the population of HUVECs used in our test system contained an intact VEGF-dependent signal transduction pathway that leads to the proliferation of HUVECs, as also reported by others (29). These results suggest that the VEGF produced by tumor cells was sufficient to cause a proliferative response of endothelial cells either by itself or in combination with certain tumor cell- or endothelial cell-derived factors for which VEGF was the predominant partner. When nonconditioned SFM was added to HUVECs as a control, and these cells were then exposed to hormones, proliferation, as measured by BrdU incorporation, was equal to that in controls, demonstrating that previous conditioning of the medium with either T-47D or BT-474 cells was essential for the subsequent proliferation of HUVECs. It was also important to test the effects of progesterone and MPA in nonconditioned medium, because, although human breast cancer cells metabolize progesterone very rapidly, tumor cells are unable to efficiently metabolize the synthetic progestins (43). Therefore, in all likelihood, some of the synthetic progestin is carried over into the conditioned medium transferred to the HUVECs in these experiments, and this progestin could potentially exert its own effects. However, our control data (Fig. 2AGo, left panel; SFM) indicate that such a carryover is not likely to produce any effects by increasing VEGF from the HUVECs, because no proliferation was observed with progesterone or MPA. Furthermore, we showed that neither progesterone nor MPA interacts synergistically with VEGF to influence HUVEC proliferation (Fig. 2AGo). These results indicate that tumor cells can produce angiogenically active VEGF in response to natural and synthetic progestins, which can subsequently increase the proliferation of human endothelial cells.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2. Paracrine effects of progesterone- and MPA-induced VEGF on HUVEC proliferation. Conditioned medium was prepared from progestin-treated BT-474, T47D, and HCC-1428 cells as described in Materials and Methods. HUVECs (5 x 103/well) were seeded in 96-well plates overnight and then incubated in DME/F12 with 0.5% FBS for 12 h. The medium was aspirated and replaced with conditioned medium prepared from various tumor cell lines or with SFM alone as a control, and the incubation was continued for an additional 24 h. Antibody was added to one set of hormone-treated conditioned media before the medium was added to the cells as described in Materials and Methods. BrdU was added 15 h before termination of the treatment, and BrdU incorporation was measured using an ELISA kit. Values represent the mean ± SEM from eight to 18 different determinations representing three different experiments. SFCM, Serum-free conditioned medium; P, progesterone; V-100, VEGF 100 ng/ml; Ab, VEGF antibody. HUVECs (5 x 103/well) were seeded in 96-well plates overnight and then additionally incubated in DME/F12 with 0.5% FBS for the indicated times (B) or treated with hormone-treated conditioned medium from BT-474 cells and VEGF as a positive control (C) for 48 h. Cells were then fixed, and cell viability was measured using the SRB assay as described in Materials and Methods.

 
In contrast to the proliferative response of HUVECs observed with progesterone-treated conditioned medium from BT-474 and T47-D cells, progesterone-treated VEGF from HCC-1428 cells (but not MPA-treated cells) caused exceptionally high proliferation of HUVECs (6-fold higher than controls; Fig. 2AGo, right panel). This result could be due to additional proteins being produced by HCC-1428 cells that could potentially synergize with VEGF and potentiate its proliferative effects. However, the HCC-1428-produced proteins that influence extensive proliferation of HUVECs must depend on VEGF signaling pathways, because an anti-VEGF antibody completely inhibits this proliferative response (Fig. 2AGo). It is also possible that HCC-1428 cells, in contrast to BT-474 and T47-D cells, may not produce an inhibitory factor that restricts the effects of VEGF on HUVEC proliferation. MPA-treated medium from HCC-1428 cells also induced the proliferation of HUVECs; however, the response resembled that obtained with BT-474 and T47-D cells, indicating that progesterone and MPA must have different effects on tumor cells to produce distinct milieu in the medium. Previously, we and others demonstrated that natural and synthetic progestins use different pathways to induce VEGF expression (44, 45). Therefore, natural and synthetic progestins most likely produce a different set of factors in conditioned medium from tumor cells.

To determine whether the increase in BrdU incorporation in HUVECs represents an increase in the number of viable cells, we used the SRB procedure, which is a cellular protein dye-binding assay and is based on the protein content of surviving cells, as an index to determine cell growth and viability (30, 31). In addition, the SRB assay is more sensitive and faster than the 3-[4,5-dimethlthiazol-2-yl]-2,5-diphenyltetrazolium bromide assay (30, 31). Figure 2BGo shows that when HUVECs were placed in 0.5% FBS, there was virtually no decrease in cell number over a 48-h period. However, when HUVECs were exposed to rhVEGF (100 ng/ml) for 48 h, there was a doubling of viable cells, an increase that was suppressed by simultaneous incubation with an antibody against VEGF, but was unaffected by nonrelated IgG (Fig. 2CGo). In addition, when conditioned medium from BT-474 cells previously exposed to progesterone or MPA was used, there was a similar elevation in cell number (Fig. 2CGo). This increase in cell number was also suppressed by an anti-rhVEGF antibody, but not by a nonrelated IgG. These results suggest that the increase in BrdU incorporation shown in Fig. 2AGo represents an actual increase in viable cells.

Progestin-induced VEGF from tumor cells can increase the proliferation of breast tumor cells (paracrine mechanism)
Recent studies have suggested that VEGF can induce the proliferation of breast epithelial cells (46), indicating that locally produced VEGF from tumor cells can influence not only endothelial cells, but potentially also neighboring breast tumor cells in the vicinity. Such a situation could cause the proliferation of neighboring cells that express VEGFR-2 but do not respond to sex steroids for VEGF induction, or cells that are PR and ER negative. This is an insidious possibility, because two of the main soluble isoforms produced generally by breast cancer cells, VEGF165 and VEGF121, can diffuse from the cells and influence other cells at a distance or in the vicinity (5, 6, 12). Both isoforms are also known to be active in promoting angiogenesis by increasing the proliferation of endothelial cells (5, 6, 12).

Before we began to assess the role of progestin-induced VEGF in paracrine effects on tumor epithelial cells, we tested the tumor cell lines used in our study for the expression of VEGF receptors, VEGFR-2 (flk/kdr) or VEGFR-1 (flt), using RT-PCR mRNA amplification. VEGFR-2 has been shown to mainly transmit the VEGF-dependent proliferative signal in endothelial cells (2). The role of VEGFR-1 (flt) is less clear, but most studies indicate that VEGFR1 is involved in the permeability functions of VEGF (5). As shown in Fig. 3AGo, a 400-bp PCR product corresponding to VEGFR-2 (flk/kdr) was strongly amplified in MDA-MB-231 cells, and lower levels were found in T47-D, BT-474, and HCC-1428 cells. VEGFR-1 (flt) was not detected in MDA-MB-231 cells, but was expressed in all of the other cell lines tested. We chose the ER- and PR-negative MDA-MB-231 cells as a representative cell line that is PR negative and unable to respond to progestins for VEGF induction to test the possible paracrine effects of progestin-induced VEGF from BT-474, T47-D, and HCC-1428 cells.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. A, Expression of VEGFR2 (flk/kdr) and VEGFR1 (flt) in different breast cancer cell lines. Cells were grown in DME/F12 containing 5% DCC-treated FBS for 24 h. RNA was extracted, and RT-PCR was carried out using Platinum PCR Supermix as described in Materials and Methods. B, Paracrine effects of progesterone- and MPA-induced VEGF on MDA-MB-231 cell proliferation. Conditioned media from BT-474, T47-D, and HCC-1428 cells were prepared as described in Fig. 2Go and placed onto MDA-MB-231 cells for determining cell proliferation in the absence or presence of anti-VEGF antibody or control IgG. As controls, cells were also treated with progesterone (P) and MPA alone or with exogenous VEGF (left panel). *, Values significantly different from controls; **, values significantly inhibited compared with the induced values. C, Increased viable cells after exposure to rhVEGF. DME/F12 (100 µl) containing 100 ng/ml rhVEGF was placed onto MDA-MB-231 cells as described in Materials and Methods. Cells were then incubated at 37 C for various times as indicated and assayed for cell viability using the SRB assay. *, Values significantly different from corresponding control values. Abbreviations are explained in Fig. 2Go.

 
We assessed the effect of progestin-induced VEGF from BT-474, T47-D, and HCC-1428 tumor cells on the proliferation of MDA-MB-231 cells. We also tested the effect of progestins alone on the proliferation of MDA-MB-231 cells in unconditioned medium to determine whether these hormones had any direct effect on the proliferation of MDA-MB-231 cells. hVEGF was also used as a positive control to determine whether VEGF alone increases the incorporation of BrdU in the tumor cells. Figure 3BGo (left panel) shows that exogenous VEGF in the SFM induced cellular proliferation in MDA-MB-231 cells, and this was inhibited in the presence of an anti-VEGF antibody. This result establishes that MDA-MB-231 cells were capable of exhibiting proliferation in response to VEGF. As shown in Fig. 3BGo, there was no direct effect of progesterone or MPA on cell proliferation. In contrast, progestin-treated conditioned medium from the three breast cancer cell lines increased the proliferation of MDA-MB-231 cells. These results suggest that progesterone or MPA treatment in certain breast cancer cells can produce VEGF that can cause the proliferation of adjacent tumor cells that are negative for PR and do not produce elevated levels of VEGF by themselves in response to progestins (Fig. 3BGo). It is possible that tumor-produced VEGF may have other functions, such as promoting tumor cell survival and/or preventing apoptosis, as previously observed in other systems (47, 48). Nevertheless, the results with MDA-MB-231 cells show that cells can exist within a tumor that will respond to progestin-induced VEGF with proliferation and will most likely gain a growth advantage over other neighboring cells.

It was important to establish whether BrdU incorporation resulted in an actual increase in viable MDA-MB-231 cells. We therefore performed the SRB assay as described in Fig. 3CGo. MDA-MB-231 cells were plated overnight, washed with DME/F12, and then incubated with rhVEGF for 48 h. As shown in Fig. 3CGo, the addition of VEGF increased the number of viable cells after 24-h incubation with rhVEGF, demonstrating that even though MDA-MB-231 cells grow quite rapidly in the absence of serum, exogenous VEGF can still increase the number of viable cells compared with nontreated cells.

Progestin-induced VEGF can increase the proliferation of tumor cells in an autocrine manner
BT-474, T47-D, or HCC-1428 breast tumor cells were incubated in SFM in the presence and absence of progesterone and MPA, with or without the antiprogestin RU-486, for 24 h. In addition to the hormones, cells were exposed either to an antibody against VEGF, to block any tumor cell-produced VEGF, or to the VEGFR-2 tyrosine kinase inhibitor SU1498, to block any VEGFR-mediated effects on tumor cell proliferation. As shown in Fig. 4AGo, progesterone and MPA both induced proliferation of BT-474 tumor cells, which could be inhibited by the anti-VEGF antibody, the VEGFR-2 tyrosine kinase inhibitor SU-1498, or the antiprogestin RU-486, which prevents progestin-dependent VEGF induction. These results show that progestin-induced VEGF promoted proliferation of these tumor cells in an autocrine manner through VEGF/VEGFR-2 interactions. Also, rhVEGF-induced proliferation of tumor cells (data not shown) was similar in magnitude to that observed with the locally produced VEGF (Fig. 4AGo, left panel). Figure 4BGo shows similar results in T47-D cells. Progesterone and MPA both induced the proliferation of T47-D cells during a 24-h period, as previously observed (14, 38, 49), and the antiprogestin RU-486, the anti-VEGF antibody, and SU-1498 all blocked this proliferative response. Interestingly, when T47-D cells were treated with SU-1498 alone, the basal level of cell proliferation was inhibited, indicating that in these cells, basal VEGF levels were required to sustain cell proliferation. In HCC-1428 cells (Fig. 4CGo), both exogenous VEGF as well as progesterone and MPA treatment increased the cell proliferation that was blocked by both anti-VEGF antibody and SU-1498. Interestingly, HCC-1428 cells were very sensitive to SU-1428 with and without the progestin ligand, because the addition of this VEGFR-2 inhibitor alone abolished even the basal level of cell proliferation. This observation suggests that HCC-1428 cells depend strongly on tumor cell-produced VEGF for sustaining basal levels of cell proliferation.



View larger version (34K):
[in this window]
[in a new window]
 
FIG. 4. Autocrine effects of progesterone- and MPA-induced VEGF on tumor cell proliferation. Human breast tumor cells were seeded in 96-well plates (6 x 103 to 8 x 104 /well) overnight. Cells were then washed with SFM and placed in the same medium for 24 h. Medium was replaced, and BT-474 (A), T47-D (B), or HCC-1428 (C) cells were incubated for an additional 24 h with 10 nM progesterone (P) or MPA or with 100 ng/ml VEGF with or without 2 µg/ml anti-VEGF antibody or control IgG, 1 µM RU-486 (RU), or 2 µM SU-1498 (SU). BrdU was added 3 h before the termination of treatment. Cell proliferation was measured by BrdU incorporation as described in Materials and Methods. *, Values significantly (P < 0.05) different from controls; **, values significantly (P < 0.05) inhibited compared with progesterone- or MPA-induced values. Abbreviations are defined in Fig. 2Go.

 
Overall, our findings support a model (Fig. 5Go) in which natural and synthetic progestins can increase the production of VEGF in a subset of tumor epithelial cells, most likely those with PR and abnormal production of tumor-suppressor p53 (19). The progestin-induced VEGF can function in a paracrine manner to increase the proliferation of endothelial cells and promote angiogenesis. The progestin-induced VEGF can also function in a paracrine manner to increase the proliferation of VEGFR-2-expressing breast tumor epithelial cells, including nuclear receptor-negative cells that express VEGFR-2. In addition, the model predicts that progestin-induced VEGF can influence the VEGF-producing cells themselves and increase their proliferation in an autocrine manner. Others have shown that tumor stromal cells express VEGFR2 (7, 50); hence, these cells are also expected to respond to progestin-induced VEGF and increase their proliferation. We propose that such paracrine and autocrine mechanisms may be responsible for the observed increase in occurrence of invasive breast cancers in HRT trials (34, 35, 36). It is likely that some of the participants in these trials have either undetected tumors before the start of HRT or preneoplastic lesions that tend to proliferate in response to progestins. If such is the case, the progestin component in HRT could provide the angiogenic switch to increase the proliferation of tumors or lesions. The mechanism underlying this switch remains to be established. We suggest that targeting hormone-induced angiogenic growth factor production via the PR as well as the biological effects of the produced growth factor via its receptors may provide a better therapeutic strategy than targeting each of these separately. Our findings also suggest that there is an urgent need for the development of safer progestins for HRT that do not induce proliferation of endothelial or breast tumor epithelial cells by paracrine or autocrine mechanisms as a result of inducing growth factors from tumor cells.



View larger version (25K):
[in this window]
[in a new window]
 
FIG. 5. Proposed model to illustrate how progestin-induced VEGF could promote tumor cell proliferation and tumor growth in paracrine and autocrine manners. Tumor epithelial cells (red) containing PR produce VEGF in response to progesterone (P) or MPA. Tumor cells in the immediate vicinity, whether PR positive (white) or PR negative (black), but containing VEGFR2 (flk/kdr), can respond to secreted VEGF and proliferate. Also, endothelial cells respond to secreted VEGF and proliferate (angiogenesis). Wavy lines depict stromal cells. Straight black arrows demonstrate paracrine functions of VEGF for endothelial and tumor epithelial (and potentially for stromal cells) (50 ). The curved black arrow represents autocrine functions of VEGF for VEGF-producing tumor epithelial cells.

 


    Acknowledgments
 
We thank Ms. Sandy Brandt for excellent technical assistance during the project.


    Footnotes
 
This work was supported by National Institutes of Health Grant CA-86916. S.M.H. is the Zalk Missouri Professor of Tumor Angiogenesis.

First Published Online April 21, 1005

Abbreviations: BrdU, Bromodeoxyuridine; DCC, dextran-coated charcoal; DME/F12, DMEM/Ham’s F-12 medium; ER, estrogen receptor; FBS, fetal bovine serum; HRT, hormone replacement therapy; HUVEC, human umbilical vein endothelial cell; MPA, medroxyprogesterone acetate; PR, progesterone receptor; rh, recombinant human; SFM, serum-free medium; SRB, sulforhodamine B; VEGF, vascular endothelial growth factor; VEGFR-2, vascular endothelial growth factor receptor 2.

Received January 25, 2005.

Accepted for publication April 11, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Folkman J 1995 Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat Med 1:27–31[CrossRef][Medline]
  2. Ferrara N 2002 Role of vascular endothelial growth factor in physiologic and pathologic angiogenesis: therapeutic implications. Semin Oncol 29:10–14
  3. Bergers G, Benjamin LE 2003 Tumorigenesis and the angiogenic switch. Nat Rev Cancer 3:401–410[CrossRef][Medline]
  4. Hanahan D, Christofori G, Naik P, Arbeit J 1996 Transgenic mouse models of tumour angiogenesis: the angiogenic switch, its molecular controls, and prospects for preclinical therapeutic models. Eur J Cancer 32A:2386–2393
  5. Ferrara N 1999 Molecular and biological properties of vascular endothelial growth factor. J Mol Med 77:527–543[CrossRef][Medline]
  6. Ferrara N 1999 Vascular endothelial growth factor: molecular and biological aspects. Curr Top Microbiol Immunol 237:1–30[Medline]
  7. Borgstrom P, Gold DP, Hillan KJ, Ferrara N 1999 Importance of VEGF for breast cancer angiogenesis in vivo: implications from intravital microscopy of combination treatments with an anti-VEGF neutralizing monoclonal antibody and doxorubicin. Anticancer Res 19:4203–4214[Medline]
  8. Hyder SM, Stancel GM 2000 Regulation of VEGF in the reproductive tract by sex-steroid hormones. Histol Histopathol 15:325–334[Medline]
  9. Gasparini G, Toi M, Gion M, Verderio P, Dittadi R, Hanatani M, Matsubara I, Vinante O, Bonoldi E, Boracchi P, Gatti C, Suzuki H, Tominaga T 1997 Prognostic significance of vascular endothelial growth factor protein in node-negative breast carcinoma. J Natl Cancer Inst 89:39–147
  10. Obermair A, Kucera E, Mayerhofer K, Speiser P, Seifert M, Czerwenka K, Kaider A, Leodolter S, Kainz C, Zeillinger R 1997 Vascular endothelial growth factor (VEGF) in human breast cancer: correlation with disease-free survival. Int J Cancer 74:455–458[CrossRef][Medline]
  11. Shibuya M 2001 Structure and function of VEGF/VEGF-receptor system involved in angiogenesis. Cell Struct Funct 26:25–35[CrossRef][Medline]
  12. Ferrara N, Gerber HP, LeCouter J 2003 The biology of VEGF and its receptors. Nat Med 9:669–676[CrossRef][Medline]
  13. Spicer DV, Pike MC 1994 Sex steroids and breast cancer prevention. J Natl Cancer Inst Monogr 139–147
  14. Moore MR, Conover JL, Franks KM 2000 Progestin effects on long-term growth, death, and Bcl-xL in breast cancer cells. Biochem Biophys Res Commun 277:650–654[CrossRef][Medline]
  15. Thuneke I, Schulte HM, Bamberger AM 2000 Biphasic effect of medroxyprogesterone-acetate (MPA) treatment on proliferation and cyclinD1 gene transcription in T47D breast cancer cells. Breast Cancer Res Treat 63:243–248[CrossRef][Medline]
  16. Hyder SM, Stancel GM 1999 Regulation of angiogenic growth factors in the female reproductive tract by estrogens and progestins. Mol Endocrinol 13:806–811[Free Full Text]
  17. Hyder SM, Murthy L, Stancel GM 1998 Progestin regulation of vascular endothelial growth factor in human breast cancer cells. Cancer Res 58:392–395[Abstract/Free Full Text]
  18. Hyder SM, Chiappetta C, Stancel GM 2001 Pharmacological and endogenous progestins induce vascular endothelial growth factor expression in human breast cancer cells. Int J Cancer 92:469–473[CrossRef][Medline]
  19. Liang Y, Wu J, Stancel GM, Hyder SM2005 p53-Dependent inhibition of progestin-induced VEGF expression in human breast cancer cells. J Steroid Biochem Mol Biol 93:173–182
  20. Degenshein GA, Bloom N, Tobin E 1980 The value of progesterone receptor assays in the management of advanced breast cancer. Cancer 46:2789–2793[CrossRef][Medline]
  21. Bartek J, Bartkova J, Vojtesek B, Staskova Z, Rejthar A, Kovarik J, Lane DP 1990 Patterns of expression of the p53 tumour suppressor in human breast tissues and tumours in situ and in vitro. Int J Cancer 46:839–844[Medline]
  22. Levine AJ 1997 p53, The cellular gatekeeper for growth and division. Cell 88:323–331[CrossRef][Medline]
  23. Moore MR 2004 A rationale for inhibiting progesterone-related pathways to combat breast cancer. Curr Cancer Drug Targets 4:183–189[CrossRef][Medline]
  24. Monacci WT, Merrill MJ, Oldfield EH 1993 Expression of vascular permeability factor/vascular endothelial growth factor in normal rat tissues. Am J Physiol 264:C995–C1002
  25. Brown LF, Yeo KT, Berse B, Morgentaler A, Dvorak HF, Rosen S 1995 Vascular permeability factor (vascular endothelial growth factor) is strongly expressed in the normal male genital tract and is present in substantial quantities in semen. J Urol 154:576–579[CrossRef][Medline]
  26. Kuroda M, Oka T, Oka Y, Yamochi T, Ohtsubo K, Mori S, Watanabe T, Machinami R, Ohnishi S 1995 Colocalization of vascular endothelial growth factor (vascular permeability factor) and insulin in pancreatic islet cells. J Clin Endocrinol Metab 80:3196–3200[Abstract]
  27. Woolard J, Wang WY, Bevan HS, Qiu Y, Morbidelli Y, Pritchard-Jones RO, Cui TG, Sugiono M, Waine E, Perrin R, Foster R, Digby-Bell J, Shields JD, Whittles CE, Mushens RE, Gillatt DA, Ziche M, Harper SJ, Bates DO 2004 VEGF165b, an inhibitory vascular endothelial growth factor splice variant: mechanism of action, in vivo effect on angiogenesis and endogenous protein expression. Cancer Res 64:7822–7835[Abstract/Free Full Text]
  28. Bates DO, Cui TF, Doughty JM, Winkler M, Sugiono M, Shields JD, Peat D, Gillatt DA, Harper SJ 2002 VEGF165b, an inhibitory splice variant of vascular endothelial growth factor, is down-regulated in renal cell carcinoma. Cancer Res 62:4123–4131[Abstract/Free Full Text]
  29. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N 1998 Vascular endothelial growth factor regulates endothelial cell survival through the phosphatidylinositol 3'-kinase/Akt signal transduction pathway. Requirement for Flk-1/KDR activation. J Biol Chem 273:30336–30343[Abstract/Free Full Text]
  30. Rubenstein LV, Shoemaker RH, Paul KD, Simon RM, Skehan P, Scudiero DA, Monks A, Boyd MR 1990 Comparison of in vitro anticancer-drug-screening data generated with a tetrazolium assay versus a protein assay against a diverse panel of human tumor cell lines. J Natl Cancer Inst 82:1113–1118[Abstract/Free Full Text]
  31. Skehan P, Storeng R, Scudiero D, Monks A, McMahon J Vistica D, Warren JT, Bokesch H, Kenney S, Boyd MR 1990 New colorimetric cytotoxicity assay for anti-cancer-drug screening. J Natl Cancer Inst 82:1107–1112[Abstract/Free Full Text]
  32. Hyder SM, Chiappetta C, Stancel GM 2000 Induction of the angiogenic factor VEGF in the uterus by the antiprogestin onapristone. Cancer Lett 156:101–107[CrossRef][Medline]
  33. Wu J, Richer J, Horwitz KB, Hyder SM 2004 Progestin-dependent induction of vascular endothelial growth factor in human breast cancer cells: preferential regulation by progesterone receptor B. Cancer Res 64:2238–2244[Abstract/Free Full Text]
  34. Writing Group for the Women’s Health Initiative Investigators 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative Randomized Controlled Trial. J Am Med Assoc 288:321–333[Abstract/Free Full Text]
  35. Ross RK, Paganini-Hill A, Wan PC, Pike MC 2000 Effect of hormone replacement therapy on breast cancer risk: estrogen versus estrogen plus progestin. J Natl Cancer Inst 92:328–332[Abstract/Free Full Text]
  36. Chlebowski RT, Hendrix SL, Langer RD, Stefanick ML, Gass M, Lane D, Rodabough RJ, Gilligan MA, Cyr MG, Tomson CA, Cynthia A, Khandekar J, Petrovitch H, McTiernan A 2003 Influence of estrogen plus progestin on breast cancer and mammography in healthy postmenopausal women: the Women’s Health Initiative Randomized Trial. J Am Med Assoc 289:3243–3253[Abstract/Free Full Text]
  37. Chen WY, Hankinson SE, Schnitt SJ, Rosner BA, Holmes MD, Colditz GA 2004 Association of hormone replacement therapy to estrogen and progesterone receptor status in invasive breast carcinoma. Cancer 101:1490–1500[CrossRef][Medline]
  38. Clarke CL, Sutherland RL 1990 Progestin regulation of cellular proliferation. Endocr Rev 11:266–301[Abstract/Free Full Text]
  39. De Lignieres B 2003 Effects of progestogens on the postmenopausal breast. Climacteric 5:229–235[CrossRef]
  40. Raafat AM, Li S, Bennett JM, Hofseth LJ, Haslam SZ 2001 Estrogen and estrogen plus progestin act directly on the mammary gland to increase proliferation in a postmenopausal mouse model. J Cell Physiol 187:81–89[CrossRef][Medline]
  41. Soderqvist G, Isaksson E, von Schoultz B, Carlstrom K, Tani E, Skoog L 1997 Proliferation of breast epithelial cells in healthy women during the menstrual cycle. Am J Obstet Gynecol 176:123–128[CrossRef][Medline]
  42. Castilla MA, Neria F, Renedo G, Jiménez S, Tramón P, Deudero JJP, Arroyo MVA, Yagüe S, Caramelo C 2004 Tumor-induced endothelial cell activation: role of vascular endothelial growth factor. Am J Physiol 286:C1170–C1176
  43. Fennessey PV, Pike AW, Gonzalez-Aller C, Horwitz KB 1986 Progesterone metabolism in T47Dco human breast cancer cells. I. 5{alpha}-Pregnan-3ß,6{alpha}-diol-20-one is the secreted product. J Steroid Biochem 25:641–648[CrossRef][Medline]
  44. Wu J, Brandt S, Hyder SM 2004 Ligand- and cell-specific effects of signal transduction pathway inhibitors on progestin-induced VEGF levels in human breast cancer cells. Mol Endocrinol 64:2238–2244
  45. Nilsen J, Brinton RD 2003 Divergent impact of progesterone and medroxyprogesterone acetate (Provera) on nuclear mitogen-activated protein kinase signaling. Proc Natl Acad Sci USA 100:10506–10511[Abstract/Free Full Text]
  46. Miralem T, Steinberg R, Price D, Avraham H 2001 VEGF(165) requires extracellular matrix components to induce mitogenic effects and migratory response in breast cancer cells. Oncogene 20:5511–5524[CrossRef][Medline]
  47. Masood R, Cai J, Zheng T, Smith DL, Hinton DR, Gill PS 2001 Vascular endothelial growth factor (VEGF) is an autocrine growth factor for VEGF receptor-positive human tumors. Blood 98:1904–1913[Abstract/Free Full Text]
  48. Mercurio AM, Bachelder RE, Bates RC, Chung J 2004 Autocrine signaling in carcinoma: VEGF and the {alpha}6ß4 integrin. Semin Cancer Biol 14:115–122[CrossRef][Medline]
  49. Skildum A, Faivre E, Lange CA 2005 Progesterone receptors induce cell cycle progression via activation of mitogen activated protein kinases. Mol Endocrinol 19:327–339[Abstract/Free Full Text]
  50. Speirs V, Atkin SL 1999 Production of VEGF and expression of the VEGF receptors Flt-1 and KDR in primary cultures of epithelial and stromal cells derived from breast tumours. Br J Cancer 80:898–903[CrossRef][Medline]



This article has been cited by other articles:


Home page
Endocr Relat CancerHome page
C. Lanari, C. A Lamb, V. T Fabris, L. A Helguero, R. Soldati, M. C. Bottino, S. Giulianelli, J. P. Cerliani, V. Wargon, and A. Molinolo
The MPA mouse breast cancer model: evidence for a role of progesterone receptors in breast cancer
Endocr. Relat. Cancer, June 1, 2009; 16(2): 333 - 350.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
I. Benakanakere, C. Besch-Williford, M. R Ellersieck, and S. M Hyder
Regression of progestin-accelerated 7,12-dimethylbenz[a]anthracene-induced mammary tumors in Sprague-Dawley rats by p53 reactivation and induction of massive apoptosis: a pilot study
Endocr. Relat. Cancer, March 1, 2009; 16(1): 85 - 98.
[Abstract] [Full Text] [PDF]


Home page
Reproductive SciencesHome page
T. Toloubeydokhti, Qun Pan, Xiaoping Luo, O. Bukulmez, and N. Chegini
The Expression and Ovarian Steroid Regulation of Endometrial Micro-RNAs
Reproductive Sciences, December 1, 2008; 15(10): 993 - 1001.
[Abstract] [PDF]


Home page
Cancer Res.Home page
Y. Liang, C. Besch-Williford, R. A. Brekken, and S. M. Hyder
Progestin-Dependent Progression of Human Breast Tumor Xenografts: A Novel Model for Evaluating Antitumor Therapeutics
Cancer Res., October 15, 2007; 67(20): 9929 - 9936.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
A. Y. Ting, B. F. Kimler, C. J. Fabian, and B. K. Petroff
Characterization of a preclinical model of simultaneous breast and ovarian cancer progression
Carcinogenesis, January 1, 2007; 28(1): 130 - 135.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
S M Hyder
Sex-steroid regulation of vascular endothelial growth factor in breast cancer.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 667 - 687.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
Y. Liang, R. A Brekken, and S. M Hyder
Vascular endothelial growth factor induces proliferation of breast cancer cells and inhibits the anti-proliferative activity of anti-hormones.
Endocr. Relat. Cancer, September 1, 2006; 13(3): 905 - 919.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
I. Benakanakere, C. Besch-Williford, J. Schnell, S. Brandt, M. R. Ellersieck, A. Molinolo, and S. M. Hyder
Natural and Synthetic Progestins Accelerate 7,12-Dimethylbenz[a]Anthracene-Initiated Mammary Tumors and Increase Angiogenesis in Sprague-Dawley Rats.
Clin. Cancer Res., July 1, 2006; 12(13): 4062 - 4071.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liang, Y.
Right arrow Articles by Hyder, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liang, Y.
Right arrow Articles by Hyder, S. M.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals