help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0529
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/1/166    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shankar, K.
Right arrow Articles by Ronis, M. J. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shankar, K.
Right arrow Articles by Ronis, M. J. J.
Endocrinology Vol. 147, No. 1 166-178
Copyright © 2006 by The Endocrine Society

Different Molecular Mechanisms Underlie Ethanol-Induced Bone Loss in Cycling and Pregnant Rats

Kartik Shankar1, Mats Hidestrand1, Rani Haley, Robert A. Skinner, William Hogue, Chan-Hee Jo, Pippa Simpson, Charles K. Lumpkin, Jr., James Aronson, Thomas M. Badger and Martin J. J. Ronis

Departments of Pharmacology and Toxicology (K.S., M.H., T.M.B., M.J.J.R.), Physiology and Biophysics (T.M.B.), Pediatrics (C.-H.J., P.S., C.K.L.), and Orthopedics (J.A., R.A.S., W.H.), College of Medicine, University of Arkansas for Medical Sciences, and Arkansas Children’s Nutrition Center (K.S., M.H., R.H., T.M.B., M.J.J.R.), Little Rock, Arkansas 72202

Address all correspondence and request for reprints to: Martin J. J. Ronis, Ph.D., Arkansas Children’s Nutrition Center, Slot 512–20B, 1120 Marshall Street, Little Rock, Arkansas 72202. E-mail: ronismartinj{at}uams.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chronic ethanol (EtOH) consumption can result in osteopenia. In the current study, we examined the modulation of EtOH-induced bone loss during pregnancy. Nonpregnant and pregnant dams were intragastrically infused either control or EtOH-containing diets throughout gestation (gestation d 5 through 20 or an equivalent period of 15 d) by total enteral nutrition. The effects of EtOH (8.5 to 14 g/kg/d) on tibial bone mineral density (BMD), mineral content (BMC), and bone mineral area were assessed at gestation d 20 via peripheral quantitative computerized tomography. EtOH caused a dose-dependent decrease in BMD and BMC without affecting bone mineral area. Trabecular BMD and BMC were significantly lower in EtOH-treated, nonpregnant dams, compared with pregnant cohorts at the same infused dose of EtOH and urinary ethanol concentrations. Static histomorphometric analysis of tibiae from pregnant rats after EtOH treatment showed decreased osteoblast and osteoid surface, indicating inhibited bone formation, whereas EtOH-treated cycling rats showed higher osteoclast and eroded surface, indicative of increased bone resorption. Circulating osteocalcin and 1,25-dihydroxyvitamin D3 were lower in both EtOH-fed nonpregnant and pregnant rats. Gene expression of osteoclast markers, 70 kDa v-ATPase, and tartrate-resistant acid phosphatase were increased selectively in nonpregnant EtOH-treated rats but not pregnant rats. Moreover, only nonpregnant EtOH-fed rats showed induction in bone marrow receptor activator of nuclear factor-{kappa}B ligand mRNA and decreased circulating 17ß-estradiol levels. Our data suggest that EtOH-induced bone loss in pregnant rats is mainly due to inhibited bone formation, whereas in nonpregnant rats, the data are consistent with increased osteoclast activation and bone resorption concomitant with decreased estradiol levels.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CHRONIC ETHANOL (EtOH) abuse is correlated with osteoporosis, decreased bone mass, and increased risk of fractures (1, 2, 3), presumably mediated via direct effects of EtOH on the bone (4, 5) or indirect effects via modulating vitamin D3 and calcium regulating hormones (6). Pregnancy and lactation sharply increase maternal bone turnover as the result of increased calcium demand and result in decreased bone mass (7, 8, 9, 10). Surprisingly little research has been conducted to study the effects of EtOH consumption during pregnancy on the maternal skeleton. In the present studies, we examined the hypothesis that the bone loss associated with pregnancy would be markedly exacerbated if EtOH consumption occurs during pregnancy as a result of inhibited bone formation during a period of high bone turnover.

A major pitfall in EtOH toxicity studies in rodents has been the inability to ensure adequate nutrition. Rats administered EtOH via liquid diets (Lieber-Decarli) are often undernourished because they consume nearly 25–40% less calories than ad libitum-fed controls (11, 12, 13). Undernutrition is a particular problem in studies of EtOH consumption during pregnancy due to the increased nutritional requirements imposed by the growing fetal-placental unit. Feeding of regular Lieber-DeCarli diets to pregnant rodents results in a 30–50% reduction in gestational weight gain in pair-fed, compared with ad libitum-fed, dams (14, 15). This effect is directly related to decreased dietary intake and has been reported to be independent of EtOH consumption (14). Hence, we used a rat intragastric infusion model in which EtOH-containing liquid diets are administered directly into the stomach via permanent cannula (16, 17, 18). Infusion of diets occurs over a 14-h period (overnight from 1800 to 0800 h) when the animals are normally awake. This total enteral nutrition (TEN) overcomes the reduced intake of EtOH-containing diets resulting from normal aversion of rodents to EtOH, and provides experimental control over caloric intake, diet composition, and EtOH dose. Overnight infusion allows us to mimic human consumption patterns without compromising normal sleep, and it simulates usual rat eating patterns that occur during the dark cycle.

The objectives of the present studies were 4-fold. First, we aimed to determine whether the reported EtOH-induced skeletal effects are essentially due to nutritional insufficiencies of orally fed EtOH liquid diets. For this purpose we infused nutritionally complete diets appropriate for caloric requirements with and without EtOH using total enteral nutrition and examined effects on skeletal parameters. Next, we investigated whether under conditions of appropriate nutrition, EtOH-induced bone loss is dose responsive. Third, we aimed to determine whether pregnancy exacerbated EtOH-induced bone loss in comparison with cycling females given the same dose of EtOH using peripheral quantitative computerized tomography (pQCT) analyses to assess skeletal parameters. Finally, we examined the mechanistic nature of the bone loss associated with EtOH by measuring skeletal parameters using static histomorphometry. Markers of bone turnover and molecular markers for osteoblasts and osteoclasts were also evaluated. The current data suggest that EtOH-induced bone loss in pregnant rats is mainly due to inhibited bone formation, whereas in nonpregnant rats the data are consistent with decreased circulating estradiol levels resulting in induction of receptor activator of nuclear factor-{kappa}B ligand (RANK-L), increased osteoclast activation and bone resorption.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Chemicals and reagents
All chemicals unless otherwise specified were obtained from Sigma-Aldrich Chemical Co. (St Louis, MO).

Animals and experimental protocol
Time-impregnated female Sprague Dawley rats (250–300 g) and weight-matched nonpregnant cohorts were obtained from Charles River Laboratories (Wilmington, MA). Animals were housed in an Association Assessment and Accreditation of Laboratory Animal Care (AAALAC) approved animal facility. Animal maintenance and experimental treatments were conducted in accordance with the ethical guidelines for animal research established and approved by the Institutional Animal Care and Use Committee at UAMS. Rats were surgically cannulated with intragastric cannulae and infused for 15 d either control or EtOH-containing diets as described previously (16, 17). Animals had access to unlimited water throughout the experiment.

Experimental treatments
To examine whether pregnancy adversely affects changes in the skeleton due to EtOH exposure in the presence of adequate nutrition, nonpregnant and pregnant rats were randomly assigned to two groups. Time-impregnated female Sprague Dawley rats (250–300 g experienced breeders) arrived at our facility on d 4 of gestation. The following day, an intragastric cannula was surgically inserted into pregnant and weight-matched nonpregnant cohorts. Animals were randomly assigned to groups and were infused for 15 d with either non-EtOH-containing diets (control) or EtOH-containing diets in which carbohydrate was isocalorically replaced by ethanol. Control and EtOH diets were isocaloric and levels of dietary protein and fat were held constant at 16% and 25%, respectively. Because the nutritional demands of nonpregnant and pregnant rats are different, pregnant rats were fed 220 kcal/kg3/4/d (to match growth rates in ad libitum-fed pregnant rats), whereas nonpregnant rats received 187 kcal/kg3/4/d. This represents calculated caloric intake for equivalent growth rate to that observed in ad libitum-fed pregnant and nonpregnant animals, respectively. Diets met caloric and nutritional guidelines established by the National Research Council.

Twenty-four-hour urine ethanol concentrations (UECs) were measured daily using a GL5 analyzer fitted with an amperometric oxygen electrode sensor (Analox Instruments Ltd., London, UK) throughout the period of infusion (16, 17). To ascertain whether EtOH treatment had any skeletal effects during pregnancy, a preliminary experiment was conducted in pregnant rats in which measurement of total bone mineral density (BMD) was performed using dual-energy x-ray absorptiometry (DEXA). After 14 d of control or EtOH diet, pregnant dams on gestation d (GD) 19 (controls, n = 4 and dams receiving 11.8 g EtOH/kg/d, n = 5) were anesthetized with pentobarbital, and the BMD of the tibia, femur, and vertebra were assessed using a DEXA Hologic 4500 system (Hologic, Bedford, MA) (19). At the end of this experiment, pregnant dams were killed under anesthesia and serum was collected. Tibias and femurs from both left and right legs were dissected and stored in formalin for pQCT analyses. In a second study, control or EtOH diets were infused for 15 d. Doses of EtOH in nonpregnant rats varied from 0 (control, n = 5), 8.5 (n = 6), 10.35 (n = 8), and 11.8 (n = 8) to 13 g/kg/d (n = 4) and in pregnant rats from 0 (control, n = 10), 8.5 (n = 8), 10.35 (n = 12), 11.8 (n = 6), and 13 (n = 12) to 14 g/kg/d (n = 10). All rats were killed under anesthesia and the tibia and serum collected. At death, serum and tissues were collected and stored at –20 and –70 C, respectively. Tibia and femur from the right leg of each animal were excised and fixed in formalin for 3 d and stored in 70% EtOH until pQCT analysis and static histomorphometric processing. The other tibia and femur were snap frozen in –70°C until RNA extraction.

pQCT analyses
Ex vivo BMD, bone mineral density area (BMA), and bone mineral content (BMC) were measured in the tibia using a STRATEC XCT Research SA+ pQCT machine (Orthometrix Inc., White Plains, NY). All analyses were conducted in a blinded fashion. Five consecutive slices separated by 1 mm (1 through 5, 1 being most distal) were scanned for each tibia beginning immediately below the tibial growth plate. The mean x-ray energy generated by this machine after filtration was 18 keV. Software (version 5.4) thresholds of 570 mg/cm3 to distinguish cortical bone and 214 mg/cm3 to distinguish trabecular from cortical and subcortical bone were used in analyzing pQCT scans.

Histomorphometry
Histomorphometry was carried out in a blinded fashion under a subcontract with Pathology Associates (Charles River) by Dr. Chris Johnsson. Each tibia was processed through to a single methyl-methacrylate block. Two serial frontal sections were taken from each block of which the first one was stained with von Kossa and tetrachrome, whereas the second was stained with toluidine blue. The measurements were performed on each serial section in an approximate 3 x 1 mm deep region of interest located in the secondary spongiosa approximately 1 mm below the lowest portion of the growth plate using True Colors for Windows 98 (Bioquant, Inc., Nashville, TN). The von Kossa- and tetrachrome-stained sections were used to determine total tissue area, total bone area, and total bone surface. Color thresholding with manual editing was used to semiautomatically identify the mineralized bone. From the toluidine blue-stained sections and the same region of interest as above, estimates of total bone surface, osteoid surface, osteoblast surface, osteoclast surface, eroded surface, osteoid area, and osteoid perimeter were obtained by manual tracing. The raw data were exported to an excel sheet and derived indices of bone volume (BV)/tissue volume referent, bone surface (BS)/BV referent, osteoid BS/BV, osteoblast surface/BS referent, osteoclast surface/BS referent, eroded surface/BS referent, osteoid thickness, trabecular thickness, trabecular separation, and trabecular number were calculated using previously described formulae (20).

Number of proliferating chondrocytes in the tibial growth plate
Numbers of proliferating chondrocytes in the growth plate of control and EtOH-treated pregnant animals was determined using hematoxylin and eosin-stained sections. Average numbers of cells in a x400 magnification were counted in three separate fields from three rats from each group using a microscope and imaging software (Olympus, Melville, NY). The proliferating chondrocytes were identified by their semiflattened appearance and deep nuclear staining.

Serum vitamin D3, osteocalcin, estradiol, and IL-6
Serum 25-hydroxyvitamin D3 (25-OH D3) and 1,25-dihydroxyvitamin D3 [1,25(OH)2 D3] were estimated radioimmunometrically using commercially available RIA kits (DiaSorin Inc., Stillwater, MN). Serum osteocalcin and IL-6 levels were measured using an ELISA using the rat-MID osteocalcin ELISA kit (Nordic Biosciences Diagnostic, Herlev, Denmark) and Quantikine rat IL-6 ELISA, (R & D Systems, Minneapolis, MN), respectively. Serum 17ß-estradiol levels was measured immunoradiometrically according to the manufacturer’s instructions (MP Diagnostics, Irvine, CA).

Gene expression analysis
Total RNA in whole bone from the proximal tibia was prepared using a 6750 CertiPrep freezer mill (SPEX Inc., Metuchen, NJ). Samples were pulverized with 1 ml of TRI reagent in liquid nitrogen and were later thawed and the RNA extracted according to the manufacturer’s recommendation. Additional RNA cleanup and DNase digestion was carried out using RNeasy minicolumns (QIAGEN, Valencia, CA). RNA quality was ascertained spectrophotometrically (ratio of A260 to A280) and also by checking ratio of 18S to 28S RNA using the RNA Nano Chip on a 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA). Total RNA (1 µg) was reverse transcribed using Taqman RT core reagents (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Subsequent real-time PCR analysis using the 2x SYBR green master mix and monitored on a ABI Prism 7000 sequence detection system (Applied Biosystems). Gene-specific primers for tartrate-resistant acid phosphatase (TRAP) (forward primer: AATTGCCTACTCCAAGATCTCCAA; reverse primer: TAAAGATGGCCACGGTGATGT), 70-kDa vacuolar ATPase (forward primer: CAGCGCTGGTAGCCAA-TACC; reverse primer: GTACCCCATGTCCCGGAAGTA), RANK-L (forward primer: TGGGCCAAGATCTCTAACATGA; reverse primer: TCATGATGCCTGAAGCAAATG), osteoprotegrin (OPG) (forward primer: GTGTGTCCCTTGCCCTGACTAC, reverse primer, GTTTCACGGTCTGCAGTTCCTT), and 18S (forward primer: CCTGTAATTGGAATGAGTCCACTTT; reverse primer: ATACGCTATTGGAGCTGGAATTACC) were designed using Primer Express software (Applied Biosystems). The relative amounts of gene expression were quantitated using a standard curve according to the manufacturer’s instructions. Gene expression was normalized by using the expression of the 18S ribosomal subunit.

Data and statistical analysis
Data are expressed as means ± SEM. Pearson’s correlation coefficients were calculated to measure the linear association between the variables, dose of EtOH, average UEC, and peak UEC, respectively. Where the relationship might expect to follow some part of a sigmoidal curve, such as the relationship between dose and area under the curve (AUC)-UEC, we fit cubic polynomials to ascertain whether there was a curvilinear relationship and whether it was approximately linear, quadratic, or cubic. A one-way ANOVA was used to compare the EtOH-treated rats with the controls. Furthermore, a linear regression model was used to compare control and EtOH-fed groups for possible relationships between each of the skeletal parameters and UEC variables and for pregnant and nonpregnant rats. A concurrent fit model was used to estimate statistical differences between the nonpregnant and pregnant regression curves. Statistical significance was set at P < 0.05, and all P values are not adjusted for multiple comparisons. Data analyses were generated and plots were constructed using SPSS for Windows (version 12.0; SPSS Inc., Chicago, IL).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Effect of pregnancy on body weights and EtOH metabolism
Body weight data for nonpregnant and pregnant rats fed control or low (≤11.8 g/kg) or high (≥13 g/kg) EtOH diets are represented in Fig. 1Go, A and B. Gestational weight gains were lower in dams having greater alcohol intake and higher UECs. UECs were selected to monitor body ethanol exposure because they are excellent indicators of blood ethanol concentrations because EtOH, unlike many drugs, equilibrates with body water (16, 17). The UECs [and blood ethanol concentration (BECs)] represented by the low- and high-dose levels corresponds to levels of EtOH attained by moderate drinking (below or around the limit for being legally intoxicated, i.e. ~100 mg/dl) and chronic drinking (250–350 mg/dl), respectively. Area under the UEC vs. time curves (UEC-AUC) for each animal was computed using the trapezoidal method using SigmaPlot software (version 8.0). Regression analysis of individual rats infused at doses ranging from 8–14 g/kg/d of EtOH revealed significant positive correlation (P < 0.01) between dose of EtOH and peak UEC (nonpregnant r2 = 0.53, pregnant r2 = 0.78), dose of EtOH and UEC-AUC (nonpregnant r2 = 0.80, pregnant r2 = 0.85), and peak UEC and UEC-AUC (nonpregnant r2 = 0.52, pregnant r2 = 0.77). All correlations were significant in both pregnant and nonpregnant rats receiving EtOH. However, EtOH doses of 10.5 g/kg/d or higher resulted in lower mean peak and AUC-UECs in pregnant rats, compared with nonpregnant rats (Fig. 2Go), suggesting enhanced clearance of EtOH in pregnancy (21).



View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Body weights of nonpregnant (A) and time-impregnated pregnant (B) dams fed control or EtOH-containing diets at various doses of EtOH from GD4 through GD20 (or an equivalent period of 15 d). Doses of EtOH were grouped as either low (≤11.8 g/kg/d) or high (≥13 g/kg/d) and compared with control group receiving no EtOH. Mean UECs of low and high EtOH groups in nonpregnant (C) and pregnant (D) dams were monitored throughout the experiment. Number of rats in the nonpregnant group were control (n = 5), 8.5 (n = 6), 10.35 (n = 8), 11.8 (n = 8), and 13 g/kg/d (n = 4) and in pregnant group were control (n = 10), 8.5 (n = 8), 10.35 (n = 12), 11.8 (n = 6), 13 (n = 12) and 14 g/kg/d (n = 10).

 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. Area under the UEC and time curve as a function of EtOH dose for nonpregnant and pregnant rats. Control or EtOH-containing diets were intragastrically infused at various doses of EtOH (ranging from 8.5 to 14 g/kg/d) to groups of pregnant and weight matched nonpregnant dams from GD4 through GD20 (or an equivalent time period in cycling females). Number of rats in nonpregnant group were control (n = 5), 8.5 (n = 6), 10.35 (n = 8), 11.8 (n = 8), and 13 g/kg/d (n = 4) and in pregnant group control (n = 10), 8.5 (n = 8), 10.35 (n = 12), 11.8 (n = 6), 13 (n = 12), and 14 g/kg/d (n = 10). AUC for the UEC vs. time curve was calculated for each individual animal using the trapezoidal method (SigmaPlot version 8.0). EtOH doses of 10.5 g/kg/d or higher resulted in much lower AUC for UECs in pregnant compared with nonpregnant rats (P < 0.05).

 
EtOH and BMD (DEXA analysis)
In initial studies, to investigate the effects of EtOH exposure during pregnancy on maternal BMD, femoral, vertebral, and tibial BMD were estimated in a preliminary study of anesthetized dams on GD19 receiving control diets (n = 4) or diets containing 11.8 g/kg/d of EtOH (n = 5) using DEXA analyses. Exposure to EtOH led to a 12% decrease in tibial BMD (P < 0.05, Table 1Go). Femoral and vertebral BMDs in the EtOH-treated rats were 94 and 92% of controls but not statistically lower than control rats. At GD20, rats were killed under anesthesia and tibial and femoral BMD, BMA, and BMC were assessed using ex vivo pQCT analyses to confirm DEXA data. Consistent with the DEXA analysis, trabecular, cortical, and total BMD decreased by 33, 13, and 17%, respectively, in the proximal tibia in the EtOH-treated rats, compared with controls (P < 0.05, Table 1Go). However, the pQCT analysis also indicated 8% lower total BMD (P < 0.05) in the distal femur of EtOH-treated rats. BMA at either site was not affected due to EtOH. However, BMC data paralleled BMD changes and were lower (P < 0.05) both in the femur and tibia of EtOH-treated rats (data not shown). These data suggest that despite nutrition adequate to provide growth rates identical with ad libitum feeding in pregnancy, EtOH exposure leads to compromised skeletal health. In addition, pQCT analyses, although consistent with in vivo DEXA data, appear to be a more sensitive estimate of skeletal changes due to EtOH consumption and, moreover, allows for a more detailed examination of bone type (cortical vs. trabecular).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Effect of EtOH on maternal bone density in pregnancy

 
Dose response of EtOH on skeletal parameters in pregnant and nonpregnant rats
To further determine whether EtOH-induced bone loss was dose responsive, we evaluated pQCT bone parameters in cycling female rats infused control or EtOH-containing diets with doses of EtOH ranging from 8 to 14 g/kg·d for 15 d in comparison with weight-matched dams. Trabecular, subcortical, and cortical BMD, BMA, and BMC were assessed in tibial slices 1–4 (Fig. 3Go). For statistical purposes, average values for slices 1 and 2 were combined for each skeletal parameter. All doses of EtOH were grouped as either low (≤11.8 g/kg) or high (≥13 g/kg) and compared with the control group receiving no EtOH. Box plots for trabecular BMD, BMC, and BMA (slices 1 and 2) are represented (Fig. 4Go, A–C). Comparison between groups was done by ANOVA. Pregnancy by itself did not affect BMD, BMC, or BMA in either bone compartment. Trabecular BMD and BMC were decreased by EtOH (P < 0.05, Fig. 4Go, A and B), and this was dose dependent (higher dose causes significantly greater decrease in both BMD and BMC). Subcortical BMD and BMC also follow a similar trend (data not shown). EtOH had no significant effects on trabecular and subcortical BMA (Fig. 4CGo). Interestingly, nonpregnant rats had lower trabecular and subcortical BMD and BMC, compared with pregnant rats (P < 0.01) at the same dose of ethanol. BMA between pregnant and nonpregnant rats was not significantly different in trabecular or subcortical bone.



View larger version (51K):
[in this window]
[in a new window]
 
FIG. 3. A, Scout view of rat tibia using pQCT. Five consecutive slices (1 through 5, 1 being most distal) from each tibia were scanned using a STRATEC XCT Research SA+ pQCT machine in a blinded fashion. Each slice was separated by 1 mm. Software (version 5.4) thresholds of 570 mg/cm3 to distinguish cortical bone and 214 mg/cm3 to distinguish trabecular from cortical and subcortical bone were used in analyzing pQCT scans. B, Representative tibial pQCT scans (slice 3) from control and EtOH-fed rats. The pseudocolored images approximately represent various bone compartments, viz. cortical depicted as white, subcortical depicted as blue, and trabecular bone seen as orange to red.

 


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 4. Box-plot of trabecular BMD (A), BMC (B), and BMA (C) (slices 1 and 2) and ethanol dose in pregnant (P) and nonpregnant (NP) dams. Control or EtOH-containing diets were intragastrically infused to groups of pregnant and nonpregnant dams from GD4 through GD20 (or an equivalent time period in cycling females) at various doses of EtOH (ranging from 8 to 14 g/kg/d). Numbers of rats in each group are given in the figure at the bottom of respective group; in nonpregnant group control (n = 5), 8.5 (n = 6), 10.35 (n = 8), 11.8 (n = 8), and 13 g/kg/d (n = 4) and in pregnant group control (n = 10), 8.5 (n = 8), 10.35 (n = 12), 11.8 (n = 6), 13 (n = 12), and 14 g/kg/d (n = 10). For statistical purposes, all doses of EtOH were grouped as either low (≤11.8 g/kg/d, nonpregnant, n = 22; pregnant, n = 26) or high (≥13 g/kg/d, nonpregnant, n = 4; pregnant, n = 22) and compared with the control group (nonpregnant, n = 5; pregnant, n = 10) receiving no EtOH. BMD of tibia was assessed ex vivo via pQCT analysis after dams were killed on GD20 (see Materials and Methods for details). *, P < 0.05 vs. control group. #, P < 0.05 vs. low EtOH group. $, P < 0.01 vs. nonpregnant group at same dose level.

 
Linear regression of pQCT parameters with EtOH dose
Linear regression analyses were performed to compare peak UEC and each skeletal parameter (trabecular or subcortical) BMD, BMA, or BMC for every animal. Similar regression analyses were performed with UEC-AUC. Tibial cortical BMD, BMA or BMC did not show significant differences between control and EtOH-fed groups in nonpregnant or pregnant rats. Trabecular BMD (slices 1 and 2) negatively correlated (P < 0.001; r2 = 0.203 and 0.397 in pregnant and nonpregnant rats, respectively) with peak UEC (Fig. 5AGo). Trabecular BMC (slices 1 and 2) also decreased with increasing UEC [P < 0.0001; r2 = 0.146 and 0.478 in pregnant and nonpregnant rats, respectively] (Fig. 5BGo). Similarly, subcortical BMD and BMC also decreased with peak UEC (P < 0.001) in both nonpregnant and pregnant rats (Fig. 5Go, C and D). Data from tibial slices 3 and 4 were consistent with slices 1 and 2 (data not shown). Both trabecular BMD (r2 = 0.073 and 0.426 in pregnant and nonpregnant rats, respectively) and BMC (r2 = 0.046 and 0.495 in pregnant and nonpregnant rats, respectively) negatively correlated with UEC-AUC. Similarly, subcortical BMD (r2 = 0.11 and 0.599 in pregnant and nonpregnant rats, respectively) and BMC (r2 = 0.158 and 0.741 in pregnant and nonpregnant rats, respectively) negatively correlated with UEC-AUC. Neither trabecular nor subcortical BMA (slices 1 through 4) showed any changes with peak or UEC-AUC (data not shown). To statistically compare the slopes of the regression lines, a concurrent-fit model was used. For all four of the above-mentioned parameters (subcortical and trabecular, BMD, and BMC), the nonpregnant rats showed a greater negative relationship (P < 0.001) between peak UEC (or UEC-AUC) and the respective skeletal parameter, compared with the pregnant dams. Hence, it appears that pregnancy actually protects against EtOH-induced bone deficits.



View larger version (30K):
[in this window]
[in a new window]
 
FIG. 5. Linear regression analysis of trabecular BMD (A), trabecular BMC (B), subcortical BMD (C), and subcortical BMC (D) and peak UEC in pregnant (P) and nonpregnant (NP) dams. Control or EtOH-containing diets were intragastrically infused to groups of (n = 4–12/group) of pregnant and nonpregnant dams from GD4 through GD20 (or an equivalent time period in cycling females) at various doses of EtOH (ranging from 8 to 14 g/kg/d). Number of rats in nonpregnant group were control (n = 5), 8.5 (n = 6), 10.35 (n = 8), 11.8 (n = 8), and 13 g/kg/d (n = 4) and in pregnant group were control (n = 10), 8.5 (n = 8), 10.35 (n = 12), 11.8 (n = 6), 13 (n = 12), and 14 g/kg/d (n = 10). Correlation coefficients (r2) indicate significant correlation between trabecular BMD and peak UEC (P < 0.05). A concurrent fit model was used to estimate statistical differences between the nonpregnant and pregnant regression curves (P < 0.001).

 
Histomorphometry
Histomorphometric analyses revealed a greater than 50% decrease in osteoblast surface (ObS/BS) in EtOH-fed pregnant animals at low and high doses, but no statistical effect on the osteoclast surface (OcS/BS) (Fig. 6Go, B and D). On the other hand, there was no significant change of ObS/BS in nonpregnant animals, whereas the high-EtOH group showed a 4-fold increase in the OcS/BS (Fig. 6Go, A and C). Consistent with the ObS/BS data, osteoid surface was decreased selectively in pregnant animals and did not change in the nonpregnant animals (Fig. 6Go, E and F). On the other hand, eroded surface mimicked the OcS/BS values and was increased 2-fold in the nonpregnant animals fed with high-EtOH concentrations (Fig. 6Go, G and H). In addition, although not reaching statistical significance, osteoid thickness tended to increase in pregnant rats but not in nonpregnant rats, whereas trabecular thickness and number tended to decrease in nonpregnant but not pregnant rats receiving EtOH. This was accompanied by increased trabecular separation in the EtOH-treated nonpregnant rats (Table 2Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIG. 6. Static histomorphometric parameters from either control or EtOH-fed pregnant (left panel) and nonpregnant (right panel) rats. Doses of EtOH were grouped as either low (≤11.8 g/kg/d, nonpregnant, n = 22; pregnant, n = 26) or high (≥13 g/kg/d, nonpregnant, n = 4; pregnant, n = 22) and compared with control (nonpregnant, n = 5; pregnant, n = 10) group receiving no EtOH. Percentage area covered by bone-forming osteoblasts (osteoblast surface/BS) (A and B) and bone-resorbing osteoclasts (osteoclast surface/BS) (C and D). Percentage area covered by osteoid (OS/BS) (E and F) and eroded surface (ES/BS) (G and H), expressed as a ratio of total bone surface. Data are expressed as means ± SEM. *, P < 0.05 vs. control group.

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Static histomorphometric parameters assessed in tibae of either control or EtOH-fed pregnant and nonpregnant rats

 
Effect of EtOH and pregnancy on serum vitamin D3 metabolites and osteocalcin
Pregnancy itself significantly decreased mean 25-OH vitamin D3 levels to half the circulating levels in nonpregnant rats (P ≤ 0.05). Whereas serum concentrations of 25-OH D3 were unchanged after EtOH consumption in nonpregnant rats, a significant increase (158% of control) was observed in the pregnant rats treated with EtOH (Fig. 7AGo). Hence, EtOH treatment partially blocked the pregnancy-induced decrease in the concentration of 25-OH D3 to the intermediate level of 17.9 ± 1.6 ng/ml (Fig. 7AGo). These changes were associated with conversion of 25-OH D3 to the active metabolite, 1,25(OH)2 D3. 1,25(OH)2 D3 was increased 1.7-fold by pregnancy (P ≤ 0.05), and EtOH prevented that rise and decreased the levels by 50% in nonpregnant animals (P ≤ 0.05) (Fig. 7BGo). Pregnant animals had higher (P ≤ 0.05) concentrations of circulating osteocalcin, compared with nonpregnant animals (Fig. 8Go). EtOH treatment resulted in decreased serum levels of osteocalcin in pregnant and nonpregnant rats (P ≤ 0.05, Fig. 8Go).



View larger version (19K):
[in this window]
[in a new window]
 
FIG. 7. Effect of EtOH on serum concentrations of 25-(OH) D3 (A) and 1,25-(OH)2 D3 (B) in pregnant and nonpregnant dams. Control or EtOH-containing diets were intragastrically infused at 0 (nonpregnant, n = 5; pregnant, n = 12) or 13 g/kg/d EtOH (nonpregnant, n = 4; pregnant, n = 20) to groups of pregnant and weight-matched nonpregnant dams from GD4 through GD20 (or an equivalent time period in cycling females). Serum levels of 25-(OH) D3 and 1,25-(OH)2 D3 were determined immunoradiometrically as described in Materials and Methods. Data are expressed as means ± SEM. Groups with differing superscripts differ significantly (P ≤ 0.05).

 


View larger version (13K):
[in this window]
[in a new window]
 
FIG. 8. Serum osteocalcin levels in nonpregnant (A) and pregnant (B) dams after ETOH treatment. Nonpregnant rats received either 0 (n = 5) or 13 g/kg/d (n = 4) of EtOH. Pregnant rats were intragastrically infused control (n = 12) or various doses of EtOH (8–14 g/kg/d) grouped as either low (≤11.8 g/kg/d, n = 20) or high (≥13 g/kg/d, n = 3) from GD4 through GD20. Data are expressed as means ± SEM. Groups with differing superscripts differ significantly (P ≤ 0.05).

 
Gene expression of osteoclast markers
To confirm histomorphometric assessment of increased osteoclast numbers in nonpregnant rats receiving high-EtOH concentrations, we measured the mRNA levels of TRAP and 70-kDa vacuolar-ATPase, both of which are expressed in active osteoclasts. The gene expression of both enzymes in the pregnant high-EtOH group was below the detection limit. Nonpregnant rats fed diets high in EtOH had increased expression of both genes, compared with nonpregnant controls (Fig. 9Go, A and B, P ≤ 0.05). Consistent with these data, gene expression of RANK-L was also increased 1.8-fold in the nonpregnant EtOH-fed rats (P ≤ 0.05). Pregnant rats receiving the same dose of EtOH failed to show any increase in RANK-L mRNA (Fig. 10Go, A and B). Because the soluble receptor OPG can block RANK-L signaling, we examined whether gene expression of OPG was modulated by EtOH. OPG mRNA levels remained unchanged in both nonpregnant and pregnant rats after ETOH consumption (Fig. 10Go, C and D)



View larger version (8K):
[in this window]
[in a new window]
 
FIG. 9. Gene expression of 70-kDa vacuolar H+-ATPase (A) and TRAP mRNA (B) in the proximal tibia as assessed by real-time RT-PCR analyses (n = 4 per group). Rats received 0 or 13 g/kg/d of EtOH. Data (means ± SEM) are normalized to expression levels of 18S rRNA. *, P < 0.05 vs. control group. NP, Nonpregnant; P, pregnant.

 


View larger version (17K):
[in this window]
[in a new window]
 
FIG. 10. Gene expression analyses of RANK-L (A and B) and OPG (C and D) mRNA in whole bone proximal tibiae from nonpregnant and pregnant rats (n = 3–5 per group) receiving control or EtOH-containing diets. The EtOH groups represent rats receiving 13 g/kg/d of EtOH. Data (means ± SEM) are normalized to expression levels of 18S rRNA. *, P < 0.05 vs. control group.

 
Serum 17ß-estradiol and IL-6 levels
EtOH consumption decreased circulating 17ß-estradiol levels to 20% of that in control cycling rats (P < 0.05). However, pregnant dams receiving the same dose of EtOH had no change in mean circulating estradiol levels (Fig. 11Go, A and B). Serum IL-6 levels were not affected by EtOH in either pregnant or nonpregnant rats (Fig. 11Go, C and D).



View larger version (12K):
[in this window]
[in a new window]
 
FIG. 11. Serum 17ß-estradiol (A and B) and IL-6 (C and D) levels in nonpregnant and pregnant dams, intragastrically infused control or EtOH (13 g/kg/d) containing diets from GD4 through GD20. 17ß-Estradiol (n = 5 and 6 for nonpregnant control and EtOH groups, n = 4 and 4 for pregnant control and EtOH groups) and IL-6 (n = 6 and 6 for nonpregnant control and EtOH groups, n = 5 and 9 for pregnant control and EtOH groups) were measured by RIA and ELISA, respectively. Data are expressed as means ± SEM *, P < 0.05 vs. control group.

 
Quantitation of chondrocyte numbers
The number of proliferating chondrocytes in the tibial growth plate (Fig. 12Go) was lower in the pregnant group receiving EtOH, compared with the pregnant control group (P ≤ 0.05).



View larger version (86K):
[in this window]
[in a new window]
 
FIG. 12. Estimation of proliferating chondrocytes (PC) in the growth plate of pregnant rat tibiae fed either control or EtOH diets (n = 4 per group). A, hematoxylin and eosin-stained sections (5 µm) of proximal tibiae were used for quantitation of proliferating chondrocytes identified by their semiflattened shape and deep nuclear staining. A center area of the growth plate was chosen for counting the number of cells. The area is indicated by a dashed line square in the figure. The EtOH groups represent rats receiving 13 g/kg/d of EtOH. B, Average numbers of cells in a x400 magnification were counted in three separate fields from three rats from each group. HC, Hypertrophic chondrocytes. Data are expressed as means ± SEM. * P < 0.05 vs. control group.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present work, we report robust dose-dependent, EtOH-induced loss of BMD and BMC in female rats chronically infused liquid diets intragastrically at caloric intakes previously reported to produce growth rates, compared with ad libitum-fed animals (16, 17). Detrimental effects of EtOH on the human skeleton have been previously described. Chronic alcoholic subjects showed deranged bone mineral metabolism, lower trabecular bone volume and thickness, decreased bone formation rate and osteoblast function, and increased bone resorption (22, 23, 24, 25). Human data on EtOH-induced bone effects are consistent with the majority of data from experimental animals. In addition to decreasing bone stiffness and strength, EtOH consumption in rats decreases trabecular thickness and trabecular bone volume (26, 27, 28). Histomorphometric studies have shown that chronic EtOH intake in female rats results in reductions in cortical area, bone formation, and mineral apposition rates in the femur (28, 29). Bone repair and attainment of peak bone density and bone mass in young rats consuming EtOH chronically is also deficient due to almost negligible epiphyseal growth and proliferation (30, 31, 32). However, no study to date in females has completely dissected the roles of altered nutrition (as a result of reduced dietary consumption of orally fed alcohol diets) from the effects of alcohol per se.

The present study unambiguously demonstrates that EtOH causes dose-dependent skeletal toxicity despite adequate nutrition. The TEN system provides all the nutrients recommended by the National Research Council for rats and carefully controls for dose of EtOH. The system is also amenable to precise caloric intake, leading to two distinct advantages over previous studies. First, it eliminates artifacts of pairwise feeding regimens or lack of sufficient voluntary diet intake. Second, it presents a robust, highly reproducible, and precise model to control diet intake. Another advantage of this model is the ease of estimating exposure to EtOH. Using the intragastric infusion model, we reported previously in that BECs and UECs mirror each other in cycling and pregnant rats because EtOH equilibrates with body water (16, 17). Over a 14-h infusion period (overnight), EtOH UECs and BECs measured every 2 h were precisely correlated (16, 17). Using the same infusion regimen for 5 d, linear regression analyses demonstrated no significant difference between UECs and BECs (16, 17). Furthermore, linear regression of BECs and UECs in pregnant dams fed EtOH-containing diets at GD15 was significant (P < 0.05, r2 = 0.94) (21). Hence, monitoring UECs is an accurate, convenient, and noninvasive method of tracking BECs.

Although the effects of EtOH in normal physiological states have been studied, few studies have examined the effects of EtOH on maternal bone loss during pregnancy (33). EtOH is the most common teratogen ingested during pregnancy (34), with one of every 29 women who know they are pregnant reporting EtOH consumption (35). A significant number of pregnant women (3.1% or approximately 1 million women) report binge drinking (defined as, consuming more than seven drinks on each occasion once or twice a week) during pregnancy (36). However, almost no information is available on the effects of EtOH on the maternal skeleton during gestation. Pregnancy and lactation are unique physiological states, which place tremendous stress on the maternal skeleton due to the transfer of calcium, phosphorus, and other minerals to the developing fetus. Clinical and experimental studies have reported conflicting effects of pregnancy per se on BMD, reporting either no change or marginal decrease in BMD especially during the third trimester (9, 37, 38, 39). However, most studies consistently agree on significant maternal bone loss during lactation (39, 40). In the present studies, pregnancy itself did not alter BMD or BMC. These data are consistent with reports of increased calcium absorption in pregnant rats and most of the calcium and phosphorous demands of the pregnant dams being supplied from the diet (41, 42). Furthermore, the diets given using the TEN system have been shown to be better than rodent chow diets in maintaining skeletal integrity (43). In addition to the differences in diets, the differences in the sites at which changes in bone density have been measured and techniques of measuring BMD may contribute to the variability among the experimental data.

We asked the question, does pregnancy exacerbates EtOH-induced bone loss? Our data suggest that this does not occur. To our knowledge, only three reports have attempted to answer this question. Keiver and colleagues (33, 44, 45) fed EtOH-containing liquid diets orally to rats during pregnancy and found decreases in the calcium content in the femur and the tibia of EtOH-exposed rats, compared with ad libitum chow-fed controls. However, interpretation of these data were complicated by undernutrition in the EtOH-fed group. Maternal weight gains were significantly reduced in both the EtOH and pair-fed groups of animals. Pair feeding also reduced maternal calcium and phosphorus intake below minimum requirements. Calcium content of maternal femur and tibia in the absence of EtOH were also lower due to pair feeding, and underfeeding may have obscured any direct EtOH effects (44, 45). Because these studies lacked a simultaneous nonpregnant cohort of animals receiving EtOH, a direct one-to-one comparison of pregnancy-associated changes due to EtOH was not possible.

Contrary to our original hypothesis, our studies suggest EtOH-induced bone loss is not enhanced and is in fact lower during pregnancy when appropriately controlled for nutrition and dose of EtOH. Several possible mechanisms have been explored in our studies. It is clear that EtOH clearance itself is increased in pregnancy because pregnant dams have lower UECs, compared with nonpregnant dams at the same dose of EtOH (21). It appears that pregnancy increases EtOH clearance via mechanisms that are not completely understood and are currently being investigated (21).Because skeletal effects of EtOH are clearly dose dependent, it is likely that enhanced metabolism of EtOH (and hence reducing exposure of bone targets to EtOH) in pregnancy is partly responsible for the lower bone loss. However, especially at high EtOH doses, bone loss in cycling females is greater than in pregnant dams, even at identical peak UEC (or BEC) values or AUC-UEC, suggesting additional differences in mechanisms of bone loss between nonpregnant and pregnant rats, even at an equitoxic exposure of EtOH in which differences in metabolism/clearance are compensated for.

Histomorphometric analyses clearly show that the cellular mechanisms causing EtOH-induced bone loss are distinct in pregnant vs. nonpregnant rats. Consistent with these findings, osteocalcin levels were decreased to a greater extent in pregnant rats receiving EtOH, compared with nonpregnant rats. Direct inhibitory effects of EtOH on osteoblast proliferation have been previously reported in vivo (distraction osteogenesis) and in vitro (43, 46, 47, 48). The effects of EtOH on the skeleton can also be mediated indirectly via the modulation of calcicotropic and/or anabolic hormones. Cholecalciferol (vitamin D3) undergoes a series of chemical modifications involving multiple enzymes and multiple organs to its active anabolic form 1,25-(OH)2 D3 (49). 1,25-(OH)2 D3 regulates calcium excretion and absorption in the kidneys and intestine (50). Consistent with previous human data (9, 38), pregnancy increased circulating concentrations of 1,25-(OH)2 D3 in dams in the present study. EtOH consumption led to significant reductions in the concentrations of 1,25-(OH)2 D3 in both pregnant and nonpregnant animals. These data are consistent with previous reports of decreased vitamin D in alcoholic subjects (23) and rats receiving EtOH (6). The mechanisms leading to EtOH-induced reductions in 1,25-(OH) D3 remain unclear. One possible mechanism is that EtOH inhibits the renal mitochondrial 25-hydroxyvitamin D3-1{alpha}-hydroxylase (CYP 27B1) responsible for synthesis of 1,25-(OH)2 D3 from 25-OH D3. Alternatively, EtOH may increase the degradation of 1,25-(OH)2 D3 via activation of the 25-hydroxyvitamin D3 24-hydroxylase (CYP 24A1) enzyme. However, these mechanisms are speculative at this point and are worthy of further investigation.

Bone loss in EtOH-fed cycling females was associated with increased osteoclast parameters as determined by histomorphometry and confirmed by higher gene expression of two osteoclast-specific genes, TRAP and 70-kDa vacuolar-H+-ATPase, in the proximal tibia (51, 52). These data are consistent with earlier reports of increased bone resorption in male EtOH-fed mice (53). Recent studies have implicated IL-6 in EtOH-associated increase in osteoclastogenesis as a central mechanism leading to bone loss in male mice (53, 54). IL-6 knockout mice fed EtOH-containing diets were protected from EtOH-induced bone loss (53). IL-6 is known to induce RANK-L expression, which induces osteoclastogenesis through binding to RANK on the cell membrane of osteoclast precursor cells and thereby promoting their maturation (55). We did not observe an increase in circulating IL-6 levels. However, increased RANK-L expression was observed in conjunction with increased osteoclast parameters in the nonpregnant EtOH rats. It is not clear from the present data whether increased expression of IL-6 locally in the bone marrow is responsible for higher RANK-L expression and osteoclastogenesis.

The most significant finding of the present study is the contrasting mechanisms of bone loss between nonpregnant and pregnant rats fed EtOH diets. It is worth noting that the studies examining the role of IL-6 and RANK-L in EtOH-induced bone loss were performed in male mice (53). Turner and Sibonga (56) suggest that the skeletons of women appear to respond differently to EtOH than those of men. Estrogen regulates the balance of bone remodeling and estrogen depletion leads to an increase in bone resorption without a compensatory increase in bone formation leading to osteopenia (57). Because the female levels of estrogen are 5- to 6-fold higher than males, it is likely that high endogenous estrogen levels mitigate the osteoclast activation initiated by EtOH exposure. Our data indicate that EtOH consumption significantly decreases circulating estradiol levels only in the cycling females, lending further support to the hypothesis that deceased estrogen levels/signaling leads to induction of RANK-L in osteoblasts and osteoclast activation. It remains to be seen whether exogenous supplementation of estrogen in intact cycling females will prevent EtOH-induced RANK-L activation and bone loss. These findings may have important implications in the clinical management of osteopenia in female alcoholics.

To our knowledge, this is the first report describing adverse affects of EtOH on chondrocytes in the growth plate. The numbers of columnar proliferating chondrocytes present in the growth plate were significantly reduced after ETOH intake in the pregnant animals. These cells will eventually differentiate into chondrocytes and start to deposit extracellular matrix, which osteoblasts invade to form new bone (58). A decrease in the number of mature chondrocytes may disrupt the intricate interplay between the chondrocytes and the bone-forming osteoblasts and osteoclast cells via signaling molecules such as Indian hedgehog, PTHrP, and fibroblast growth factors (58).

In conclusion, these studies indicate significant EtOH-induced skeletal deficits that are modified by physiological changes associated with pregnancy. Both nonpregnant and pregnant dams showed strong negative correlations of indices of BMD and BMC dose responsive with EtOH. Consistent with lower UECs, pregnant dams showed lower bone loss than nonpregnant dams. EtOH-induced bone loss in nonpregnant female rats is mainly due to activation of osteoclasts associated with decreased circulating estradiol levels and increased expression of RANK-L, whereas osteoblast proliferation and differentiation appear to be the primary targets for EtOH in pregnant rats.


    Acknowledgments
 
We thank the following people for their technical assistance: Matt Ferguson, Jamie Badeaux, Tammy Dallari, Brandi Yarberry, Kim Hale, Michele Zipperman, Landon Humphrey, Pam Treadaway, and Michele Perry.


    Footnotes
 
This work was supported in part by R01 AA12819 and R01 AA12928 (to M.J.J.R.).

First Published Online October 20, 2005

1 K.S. and M.H. contributed equally to this work. Back

Abbreviations: AUC, Area under the curve; BEC, blood ethanol concentration; BMA, bone mineral area; BMC, bone mineral content; BMD, bone mineral density; BS, bone surface; BV, bone volume; DEXA, dual-energy x-ray absorptiometry; EtOH, ethanol; GD, gestation day; ObS/BS, osteoblast surface; OcS/BS, osteoclast surface; 1,25(OH)2 D3, 1,25-dihydroxyvitamin D3; 25-OH D3, 25-hydroxyvitamin D3; OPG, osteoprotegrin; pQCT, peripheral quantitative computerized tomography; RANK-L, receptor activator of nuclear factor-{kappa}B ligand; TEN, total enteral nutrition; TRAP, tartrate-resistant acid phosphatase; UEC, urine ethanol concentration; UEC-AUC, area under the UEC vs. time curves.

Received May 3, 2005.

Accepted for publication October 10, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Sampson HW 1997 Alcohol, osteoporosis, and bone regulating hormones. Alcohol Clin Exp Res 21:400–403[CrossRef][Medline]
  2. Saville PD 1965 Changes in bone mass with age and alcoholism. J Bone Joint Surg Am 47:492–499[Abstract/Free Full Text]
  3. Pepersack T, Fuss M, Otero J, Bergmann P, Valsamis J, Corvilain J 1992 Longitudinal study of bone metabolism after ethanol withdrawal in alcoholic patients. J Bone Miner Res 7:383–387[Medline]
  4. Farley JR, Fitzsimmons R, Taylor AK, Jorch UM, Lau KH 1985 Direct effects of ethanol on bone resorption and formation in vitro. Arch Biochem Biophys 238:305–314[CrossRef][Medline]
  5. Cheung RC, Gray C, Boyde A, Jones SJ 1995 Effects of ethanol on bone cells in vitro resulting in increased resorption. Bone 16:143–147[Medline]
  6. Turner RT, Aloia RC, Segel LD, Hannon KS, Bell NH 1988 Chronic alcohol treatment results in disturbed vitamin D metabolism and skeletal abnormalities in rats. Alcohol Clin Exp Res 12:159–162[CrossRef][Medline]
  7. Aguado F, Revilla M, Hernandez ER, Menendez M, Cortes-Prieto J, Villa LF, Rico H 1998 Ultrasonographic bone velocity in pregnancy: a longitudinal study. Am J Obstet Gynecol 178:1016–1021[CrossRef][Medline]
  8. Yamaga A, Taga M, Minaguchi H, Sato K 1996 Changes in bone mass as determined by ultrasound and biochemical markers of bone turnover during pregnancy and puerperium: a longitudinal study. J Clin Endocrinol Metab 81:752–756[Abstract]
  9. Cross NA, Hillman LS, Allen SH, Krause GF, Vieira NE 1995 Calcium homeostasis and bone metabolism during pregnancy, lactation, and postweaning: a longitudinal study. Am J Clin Nutr 61:514–523[Abstract/Free Full Text]
  10. Sowers M 1996 Pregnancy and lactation as risk factors for subsequent bone loss and osteoporosis. J Bone Miner Res 11:1052–1060[Medline]
  11. Lieber CS, DeCarli LM 1989 Liquid diet technique of ethanol administration: 1989 update. Alcohol Alcohol 24:197–211[Abstract/Free Full Text]
  12. Fisher H, Yu YL, Sekowski A, Federico E, Ulman E, Wagner GC 1996 Diet composition, alcohol utilization, and dependence. Alcohol 13:195–200[CrossRef][Medline]
  13. Tsukamoto H, French SW 1993 Evolution of intragastric ethanol infusion model. Alcohol 10:437–441[CrossRef][Medline]
  14. Goad PT, Hill DE, Slikker Jr W, Kimmel CA, Gaylor DW 1984 The role of maternal diet in the developmental toxicology of ethanol. Toxicol Appl Pharmacol 73:256–267[CrossRef][Medline]
  15. Wiener SG, Shoemaker WJ, Koda LY, Bloom FE 1981 Interaction of ethanol and nutrition during gestation: influence on maternal and offspring development in the rat. J Pharmacol Exp Ther 216:572–579[Free Full Text]
  16. Badger TM, Crouch J, Irby D, Hakkak R, Shahare M 1993 Episodic excretion of ethanol during chronic intragastric ethanol infusion in the male rat: continuous vs. cyclic ethanol and nutrient infusions. J Pharmacol Exp Ther 264:938–943[Abstract/Free Full Text]
  17. Badger TM, Ronis MJ, Ingelman-Sundberg M, Hakkak R 1993 Pulsatile blood alcohol and CYP2E1 induction during chronic alcohol infusions in rats. Alcohol 10:453–457[CrossRef][Medline]
  18. Ronis MJ, Lumpkin CK, Ingelman-Sundberg M, Badger TM 1991 Effects of short-term ethanol and nutrition on the hepatic microsomal monooxygenase system in a model utilizing total enteral nutrition in the rat. Alcohol Clin Exp Res 15:693–699[CrossRef][Medline]
  19. Weinstein RS, New KD, Sappington L 1991 Dual-energy X-ray absorptiometry versus single photon absorptiometry of the radius. Calcif Tissue Int 49:313–316[Medline]
  20. Parfitt AM, Drezner MK, Glorieux FH, Kanis JA, Malluche H, Meunier PJ, Ott SM, Recker RR 1987 Bone histomorphometry: standardization of nomenclature, symbols, and units. Report of the ASBMR Histomorphometry Nomenclature Committee. J Bone Miner Res 2:595–610[Medline]
  21. Badger TM, Hidestrand M, Shankar K, McGuinn WD, Ronis MJ 2005 The effects of pregnancy on ethanol clearance. Life Sci 77:2111–2126[CrossRef][Medline]
  22. Diamond T, Stiel D, Lunzer M, Wilkinson M, Posen S 1989 Ethanol reduces bone formation and may cause osteoporosis. Am J Med 86:282–288[CrossRef][Medline]
  23. Feitelberg S, Epstein S, Ismail F, D’Amanda C 1987 Deranged bone mineral metabolism in chronic alcoholism. Metabolism 36:322–326[CrossRef][Medline]
  24. Schnitzler CM, Solomon L 1984 Bone changes after alcohol abuse. S Afr Med J 66:730–734[Medline]
  25. Crilly RG, Anderson C, Hogan D, Delaquerriere-Richardson L 1988 Bone histomorphometry, bone mass, and related parameters in alcoholic males. Calcif Tissue Int 43:269–276[Medline]
  26. Baran DT, Teitelbaum SL, Bergfeld MA, Parker G, Cruvant EM, Avioli LV 1980 Effect of alcohol ingestion on bone and mineral metabolism in rats. Am J Physiol 238:E507–E510
  27. Peng TC, Kusy RP, Hirsch PF, Hagaman JR 1988 Ethanol-induced changes in morphology and strength of femurs of rats. Alcohol Clin Exp Res 12:655–659[CrossRef][Medline]
  28. Hogan HA, Sampson HW, Cashier E, Ledoux N 1997 Alcohol consumption by young actively growing rats: a study of cortical bone histomorphometry and mechanical properties. Alcohol Clin Exp Res 21:809–816[CrossRef][Medline]
  29. Turner RT, Greene VS, Bell NH 1987 Demonstration that ethanol inhibits bone matrix synthesis and mineralization in the rat. J Bone Miner Res 2:61–66[Medline]
  30. Chakkalakal DA, Novak JR, Fritz ED, Mollner TJ, McVicker DL, Lybarger DL, McGuire MH, Donohue Jr TM2002 Chronic ethanol consumption results in deficient bone repair in rats. Alcohol Alcohol 37:13–20
  31. Sampson HW, Chaffin C, Lange J, DeFee B 1997 Alcohol consumption by young actively growing rats: a histomorphometric study of cancellous bone. Alcohol Clin Exp Res 21:352–359[CrossRef][Medline]
  32. Sampson HW, Perks N, Champney TH, DeFee B 1996 Alcohol consumption inhibits bone growth and development in young actively growing rats. Alcohol Clin Exp Res 20:1375–1384[CrossRef][Medline]
  33. Keiver K, Weinberg J 2003 Effect of duration of alcohol consumption on calcium and bone metabolism during pregnancy in the rat. Alcohol Clin Exp Res 27:1507–1519[CrossRef][Medline]
  34. Thackray H, Tifft C 2001 Fetal alcohol syndrome. Pediatr Rev 22:47–55[Free Full Text]
  35. Eustace LW, Kang DH, Coombs D 2003 Fetal alcohol syndrome: a growing concern for health care professionals. J Obstet Gynecol Neonatal Nurs 32:215–221[CrossRef][Medline]
  36. Gladstone J, Levy M, Nulman I, Koren G 1997 Characteristics of pregnant women who engage in binge alcohol consumption. CMAJ 156:789–794[Abstract]
  37. Naylor KE, Iqbal P, Fledelius C, Fraser RB, Eastell R 2000 The effect of pregnancy on bone density and bone turnover. J Bone Miner Res 15:129–137[CrossRef][Medline]
  38. Ritchie LD, Fung EB, Halloran BP, Turnlund JR, Van Loan MD, Cann CE, King JC 1998 A longitudinal study of calcium homeostasis during human pregnancy and lactation and after resumption of menses. Am J Clin Nutr 67:693–701[Abstract]
  39. Nishiwaki M, Yasumizu T, Hoshi K, Ushijima H 1999 Effect of pregnancy, lactation and weaning on bone mineral density in rats as determined by dual-energy X-ray absorptiometry. Endocr J 46:711–716[Medline]
  40. Zeni SN, Di Gregorio S, Mautalen C 1999 Bone mass changes during pregnancy and lactation in the rat. Bone 25:681–685[Medline]
  41. Abrams SA 2001 Calcium turnover and nutrition through the life cycle. Proc Nutr Soc 60:283–289[Medline]
  42. Omi N, Ezawa I 2001 Change in calcium balance and bone mineral density during pregnancy in female rats. J Nutr Sci Vitaminol 47:195–200
  43. Brown EC, Perrien DS, Fletcher TW, Irby DJ, Aronson J, Gao GG, Hogue WJ, Skinner RA, Suva LJ, Ronis MJ, Hakkak R, Badger TM, Lumpkin Jr CK 2002 Skeletal toxicity associated with chronic ethanol exposure in a rat model using total enteral nutrition. J Pharmacol Exp Ther 301:1132–1138[Abstract/Free Full Text]
  44. Keiver K, Herbert L, Weinberg J 1996 Effect of maternal ethanol consumption on maternal and fetal calcium metabolism. Alcohol Clin Exp Res 20:1305–1312[CrossRef][Medline]
  45. Keiver K, Ellis L, Anzarut A, Weinberg J 1997 Effect of prenatal ethanol exposure on fetal calcium metabolism. Alcohol Clin Exp Res 21:1612–1618[CrossRef][Medline]
  46. Chavassieux P, Serre CM, Vergnaud P, Delmas PD, Meunier PJ 1993 In vitro evaluation of dose-effects of ethanol on human osteoblastic cells. Bone Miner 22:95–103[Medline]
  47. Friday KE, Howard GA 1991 Ethanol inhibits human bone cell proliferation and function in vitro. Metabolism 40:562–565[CrossRef][Medline]
  48. Wang Y, Li Y, Mao K, Li J, Cui Q, Wang GJ 2003 Alcohol-induced adipogenesis in bone and marrow: a possible mechanism for osteonecrosis. Clin Orthop 213–224
  49. DeLuca HF 2004 Overview of general physiologic features and functions of vitamin D. Am J Clin Nutr 80:1689S–1696S
  50. Holick MF 2003 Vitamin D: a millennium perspective. J Cell Biochem 88:296–307[CrossRef][Medline]
  51. Ek-Rylander B, Bill P, Norgard M, Nilsson S, Andersson G 1991 Cloning, sequence, and developmental expression of a type 5, tartrate-resistant, acid phosphatase of rat bone. J Biol Chem 266:24684–24689[Abstract/Free Full Text]
  52. Regunathan A, Glesne DA, Wilson AK, Song J, Nicolae D, Flores T, Bhattacharyya MH 2003 Microarray analysis of changes in bone cell gene expression early after cadmium gavage in mice. Toxicol Appl Pharmacol 191:272–293[CrossRef][Medline]
  53. Dai J, Lin D, Zhang J, Habib P, Smith P, Murtha J, Fu Z, Yao Z, Qi Y, Keller ET 2000 Chronic alcohol ingestion induces osteoclastogenesis and bone loss through IL-6 in mice. J Clin Invest 106:887–889[Medline]
  54. Zhang J, Dai J, Lin DL, Habib P, Smith P, Murtha J, Fu Z, Yao Z, Qi Y, Keller ET 2004 Osteoprotegerin abrogates chronic alcohol ingestion-induced bone loss in mice. J Bone Miner Res 17:1256–1263
  55. Teitelbaum SL, Ross FP 2003 Genetic regulation of osteoclast development and function. Nat Rev Genet 4:638–649[CrossRef][Medline]
  56. Turner RT, Sibonga JD 2001 Effects of alcohol use and estrogen on bone. Alcohol Res Health 25:276–281[Medline]
  57. Jilka RL, Hangoc G, Girasole G, Passeri G, Williams DC, Abrams JS, Boyce B, Broxmeyer H, Manolagas SC 1992 Increased osteoclast development after estrogen loss: mediation by interleukin-6. Science 257:88–91[Abstract/Free Full Text]
  58. de Crombrugghe B, Lefebvre V, Nakashima K 2001 Regulatory mechanisms in the pathways of cartilage and bone formation. Curr Opin Cell Biol 13:721–727[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
K. Shankar, X. Liu, R. Singhal, J.-R. Chen, S. Nagarajan, T. M. Badger, and M. J. J. Ronis
Chronic Ethanol Consumption Leads to Disruption of Vitamin D3 Homeostasis Associated with Induction of Renal 1,25 Dihydroxyvitamin D3-24-Hydroxylase (CYP24A1)
Endocrinology, April 1, 2008; 149(4): 1748 - 1756.
[Abstract] [Full Text] [PDF]