help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0147
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/1/367    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Au, A. Y. M.
Right arrow Articles by Clifton-Bligh, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Au, A. Y. M.
Right arrow Articles by Clifton-Bligh, R. J.
Endocrinology Vol. 147, No. 1 367-376
Copyright © 2006 by The Endocrine Society

PAX8-Peroxisome Proliferator-Activated Receptor {gamma} (PPAR{gamma}) Disrupts Normal PAX8 or PPAR{gamma} Transcriptional Function and Stimulates Follicular Thyroid Cell Growth

Amy Y. M. Au1, Claire McBride1, Kenneth G. Wilhelm, Jr., Ronald J. Koenig, Bridget Speller, Linda Cheung, Marinella Messina, John Wentworth, Vitomir Tasevski, Diana Learoyd, Bruce G. Robinson and Roderick J. Clifton-Bligh

Cancer Genetics Unit (A.Y.M.A., C.M., B.S., L.C., M.M., J.W., V.T., D.L., B.G.R., R.J.C.-B.), Kolling Institute of Medical Research, University of Sydney, and Department of Endocrinology (D.L., B.G.R., R.J.C.-B.), Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia; and Division of Metabolism (K.G.W., R.J.K.), Endocrinology and Diabetes, University of Michigan Medical Center, Ann Arbor, Michigan 48109

Address all correspondence and requests for reprints to: Roderick Clifton-Bligh, Cancer Genetics Unit, Kolling Institute of Medical Research, Royal North Shore Hospital, St. Leonards, New South Wales 2065, Australia. E-mail address: jclifton{at}med.usyd.edu.au.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Follicular thyroid carcinomas are associated with a chromosomal translocation that fuses the thyroid-specific transcription factor paired box gene 8 (PAX8) with the nuclear receptor peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). This study investigated the transcriptional mechanisms by which PAX8-PPAR{gamma} regulates follicular thyroid cells. In HeLa cells, rat follicular thyroid (FRTL-5) cells, or immortalized human thyroid cells, PAX8-PPAR{gamma} stimulated transcription from PAX8-responsive thyroperoxidase and sodium-iodide symporter promoters in a manner at least comparable with wild-type PAX8. In contrast, PAX8-PPAR{gamma} failed to stimulate transcription from the thyroglobulin promoter and blocked the synergistic stimulation of this promoter by wild-type PAX8 and thyroid transcription factor-1. Unexpectedly, PAX8-PPAR{gamma} transcriptional function on a PPAR{gamma}-responsive promoter was cell-type dependent; in HeLa cells, PAX8-PPAR{gamma} dominantly inhibited expression of the PPAR{gamma}-responsive promoter, whereas in FRTL-5 and immortalized human thyroid cells PAX8-PPAR{gamma} stimulated this promoter. In gel shift analyses, PAX8-PPAR{gamma} bound a PPAR{gamma}-response element suggesting that its transcriptional function is mediated via direct DNA contact. A biological model of PAX8-PPAR{gamma} function in follicular thyroid cells was generated via constitutive expression of the fusion protein in FRTL-5 cells. In this model, PAX8-PPAR{gamma} expression was associated with enhanced growth as assessed by soft agar assays and thymidine uptake. Therefore, PAX8-PPAR{gamma} disrupts normal transcriptional regulation by stimulating some genes and inhibiting others, the net effect of which may mediate follicular thyroid cell growth and loss of differentiation that ultimately leads to carcinogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PRIMARY THYROID CANCER may be classified according to its histological appearance as medullary, papillary, follicular, or anaplastic (1). Distinct molecular changes have now been described for each of these differing phenotypes. Papillary thyroid carcinoma is associated with chromosomal translocations fusing the RET (rearranged during transfection)-tyrosine kinase with papillary-specific genes (2), whereas medullary carcinoma is associated with activating mutations within RET (3). In contrast, follicular thyroid carcinoma was recently associated with a novel chromosomal translocation t(2;3)(q13;p25) (4). The genetic consequence of this translocation was to fuse the thyroid transcription factor paired box gene 8 (PAX8) with a nuclear receptor, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). PAX8 is a critical regulator of thyroid differentiation and growth (5), whereas PPAR{gamma} is a ligand-dependent transcription factor that is activated by the thiazolidinedione class of antidiabetic drugs (6, 7, 8) but is not known to have a thyroid-specific role. Therefore, the fusion protein is expressed in thyroid cells under the control of upstream PAX8 promoter elements.

Several studies have now confirmed this initial observation (9, 10, 11, 12, 13, 14). Overall, PAX8-PPAR{gamma} has been detected in about 50% of follicular thyroid carcinomas by a combination of methods (RT-PCR, fluorescent in situ hybridization, and immunohistochemistry) (9, 10, 11, 12, 13). Contrary to the original report, however, PAX8-PPAR{gamma} has now also been reported to occur in follicular adenomas, albeit less frequently (9, 10, 11, 12, 13). Our group noted that follicular adenomas containing the fusion protein were more likely to have a distinct histological phenotype (thick capsule, microfollicular architecture) (13) and two other studies also suggested that PAX8-PPAR{gamma} was more likely to occur with a more aggressive phenotype (9, 12). Therefore, it is possible that PAX8-PPAR{gamma} occurs early in follicular thyroid tumorigenesis or that benign tumors containing PAX8-PPAR{gamma} possess other mechanisms to suppress carcinogenesis. However, given the histological difficulty in distinguishing follicular thyroid adenomas from carcinomas, a more provocative explanation is that apparently benign PAX8-PPAR{gamma}-containing tumors are in fact noninvasive carcinomas.

In this regard, determining the mechanisms by which PAX8-PPAR{gamma} causes follicular thyroid neoplasia is clearly important. At first it seemed probable that the fusion protein would retain at least some functional properties of its individual components, as has been noted for other fusion proteins involving transcription factors (15, 16). On the one hand, PPAR{gamma} mediates transcriptional activation of target genes by recruiting transcriptional coactivators to cognate DNA-binding sites in a ligand-dependant manner (5, 6). Therefore, it was perhaps surprising that not only was PAX8-PPAR{gamma} transcriptionally inactive on a PPAR{gamma}-response element (PPRE), but the fusion protein also dominantly inhibited thiazolidinedione-induced gene transactivation by wild-type PPAR{gamma} (4). It was not known whether the addition of PAX8 to the N terminus of PPAR{gamma} in some way prevented its binding either with ligand or DNA. However, it is notable that in some circumstances, PPAR{gamma} may interact with transcriptional corepressors to mediate gene silencing (17, 18, 19, 20), and that, in other situations, aberrant recruitment of corepressors has been associated with dominant-negative function of mutant nuclear receptors (21, 22, 23). Whereas PPAR{gamma} was previously thought not to be expressed in normal thyroid, recent evidence suggests that it is expressed in certain malignant thyroid cell lines. Indeed, thiazolidinediones have been shown to inhibit growth and promote apoptosis in papillary thyroid cancer cells in vitro (24, 25). PPAR{gamma} has also been implicated as a potential therapeutic target for several other cancer types including liposarcoma, breast, prostate, and colon (26, 27).

PAX8, on the other hand, is a member of a family of transcription factors containing the paired box DNA binding domain (located in the amino terminus of PAX8) (28). During development, PAX8 is expressed in thyroid, kidney, and neural tissue, but adult expression is restricted to thyroid tissue (29, 30). PAX8 targets include the thyroid-specific genes thyroglobulin (Tg), thyroperoxidase (TPO), and sodium-iodide symporter (NIS) (31). On the rat Tg promoter, Pax8 functions synergistically with another thyroid-specific transcription factor, thyroid transcription factor-1 (TITF1; also called TTF-1 and Nkx2–1), mediated via direct interaction on overlapping DNA binding sites (32, 33, 34).

To investigate the role of PAX8-PPAR{gamma} in follicular thyroid tumorigenesis, we have studied the transcriptional function of PAX8-PPAR{gamma} on thyroid- and PPAR{gamma}-specific gene promoters and the effect of PAX8-PPAR{gamma} on thyroid cell growth. We found that PAX8-PPAR{gamma} has mixed transcriptional function, stimulating transcription of some thyroid-specific genes and inhibiting others. We also found that PAX8-PPAR{gamma} transcriptional function was cell type specific, showing no PPAR{gamma}-dependent function in heterologous cells but stimulating transcription from a PPAR{gamma}-responsive promoter in thyroid cells. PAX8-PPAR{gamma} stimulated proliferation and anchorage-independent growth of FRTL-5 cells. Overall these data suggest that PAX8-PPAR{gamma} promotes neoplasia by directly interfering with normal transcriptional programming in follicular thyroid cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning of expression plasmids
The human TPO promoter containing a PAX8 response element (–367 to +51 bp relative to the transcription start site) was amplified from human genomic DNA by forward and reverse primers 5'-ggggtaccgagctgcacccaacccaat-3' and 5'-ctagctagcagtaattttcacggctgt-3', respectively, and cloned into the pGL3-basic vector (Promega, Madison, WI) as a 419-bp KpnI/NheI fragment (35). The NISTK-Luc reporter construct contains a herpes simplex virus thymidine kinase promoter amplified from a TK-CAT plasmid by PCR using the forward and reverse primers 5'-tgtaaagatctggatccggccccgcccagcg-3' and 5'-tgtaaagatctatgccattgggatatatcaa-3', respectively, then cloned into the BglII site in pGL3-basic vector. The rat NIS upstream enhancer (rNUE) that harbors two PAX8 response elements (–2495 to –2264 bp relative to the translation start site) (36) was amplified by PCR using forward and reverse primers 5'-cggggtaccagattgcagctg-3' and 5'-ctagctagctctagaagaagg-3', respectively, and then cloned into the pGL3-TK plasmid as a 231-bp KpnI/NheI fragment such that the rNUE is upstream of the thymidine kinase promoter. The full-length NIS-Luc (flNIS-Luc) was a kind gift from Prof. S. Jhiang (The Ohio State University, Columbus, OH) and contains the rNUE from –2495 to –2264 joined to the proximal 2-kb rat NIS promoter from –1949 to –4 bp relative to the translation start site (37). The Tg-Luc reporter construct contains the human Tg promoter (–372 to +1 bp relative to the translation start site) cloned upstream of the luciferase gene. PPRETK-Luc contains three copies of the acyl-CoA oxidase PPAR response element (underlined: GTCGACAGGGGACCAGGACAAAGGTCACGTTCGGGAGTCGAC, three copies) cloned upstream of the TK-Luc reporter (38). Plasmids for Tg-Luc, PPRETK-Luc, TITF1, PAX8, PPAR{gamma}, and PPAR{gamma} mutant were kindly provided by Prof. V. K. K. Chatterjee (University of Cambridge, Cambridge, UK). The PAX8-PPAR{gamma} plasmid was kindly provided by Dr. T. G. Kroll (University of Chicago, Chicago, IL).

Cell culture
HeLa and HEK293 cells were grown in DMEM (Life Technologies, Inc. Invitrogen, Grand Island, NY) supplemented with 10% fetal calf serum (Trace Biosciences, Castle Hill, Australia). Diploid FRTL-5 cells were grown in F12 Coon’s modification with L-glutamine and zinc sulfate medium (Sigma-Aldrich, St. Louis, MO) supplemented with 5% fetal calf serum, a six hormone combination (1 mIU/ml bovine TSH, 4 ng/ml insulin, 10 ng/ml somatostatin, 5 µg/ml transferrin, 4 mg/ml hydrocortisone, and 10 ng/ml glycyl-L-histidyl-L-lycine acetate; Sigma-Aldrich) and 50 mg/ml penicillin/streptomycin (Invitrogen Life Technologies). Nthy-ori cells were grown in RPMI 1640 supplemented with 10% fetal calf serum. Cells were grown in 37 C humidified conditions with 5% CO2.

Transient transfection experiments
HeLa and Nthy-ori cells were plated at 1 x 105 cells per well and FRTL-5 cells were plated at 2 x 105 cells per well and grown to approximately 80% confluence in 24-well plates. Media was changed to 2% charcoal-stripped calf serum in Opti-MEM (Invitrogen Life Technologies) before transfection. Transient transfections were performed using DMRIE-C (Invitrogen Life Technologies) with 1 µg of transcription factor expression plasmid (PAX8, PPAR{gamma}, PAX8-PPAR{gamma}, TITF1, or pcDNA3 empty vector), 1 µg of luciferase promoter (Tg-Luc, NISTK-Luc, flNIS-Luc, PPRE-Luc, or 8 µg TPO-Luc), and 1 µg of ß-galactosidase plasmid for HeLa cell transfections and 100 ng of transcription factor expression plasmid (PAX8, PPAR{gamma}, PAX8-PPAR{gamma}, or pcDNA3 empty vector), 100 ng of luciferase promoter (Tg-Luc, NISTK-Luc, PPRE-Luc, or 800 ng TPO-Luc), and 100 ng of ß-galactosidase plasmid for FRTL-5 and Nthy-ori cell transfections. Cells were incubated for 16–18 h and replenished with 5% charcoal-stripped calf serum in normal growing media for 24 h together with 10 µM ciglitizone (Sigma-Aldrich) or equivalent volume of solvent control as indicated. Cells were then lysed and assayed for luciferase activity (Promega) and ß-galactosidase activity was used for normalization of reporter activity. Transcriptional response was expressed relative to that seen with empty vector in the absence of ciglitizone, and data shown represent mean ± SEM of at least three experiments, each performed in triplicate wells.

Transfections in dog thyrocytes
Whole thyroid glands were removed from dogs that had been previously anesthetized and exsanguinated as part of an unrelated, institutionally approved study. Thyroid glands were removed within 10 min of exsanguination. Glands were trimmed and minced, and primary cultures of thyrocytes were obtained following the method of Uyttersprot et al. (39). Briefly, minced thyroid tissue was subjected to collagenase digestion, serially rinsed in RPMI, and plated in a serum-free media consisting of DMEM-F12 Ham-MCDB 105 in a 2:1:1 ratio, with additional growth factors including bovine TSH at 15 mIU/ml.

For transfection, primary thyrocytes were plated into 24-well plates in culture media without additives. Transfections were performed with lipofectamine and Plus reagents according to the manufacturer’s protocol (Invitrogen), and included 100 ng of firefly luciferase reporter plasmid, 100 ng of transcription factor expression plasmid (PAX8, PPAR{gamma}, PAX8-PPAR{gamma}, or empty vector), and an internal control Renilla luciferase plasmid (0.1 ng CMV-Rluc, 0.5–1 ng SV40-Rluc, or 5 ng tk-Rluc). After 3 h of transfection, equal volumes of culture media containing 20% charcoal-stripped calf serum and penicillin/streptomycin were added to the wells. Thirty hours after initial transfection, the culture media were replaced with media containing either 10 µM ciglitizone or vehicle for an additional 24 h. Thyrocytes were then rinsed, lysed, and analyzed for firefly and Renilla luciferase activities using the Promega dual luciferase reagents and protocol.

Stable FRTL-5 cell lines
FRTL-5 cells were plated at a density of 6 x 105 cells per 60-mm diameter tissue culture dish, 48 h before transfection. Transfections were performed using FuGENE6 (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocols with either 1 µg of pcDNA3 empty vector or PAX8-PPAR{gamma} expression vector (containing the neomycin resistance gene). Eighteen hours after transfection, selection of transfected FRTL-5 cells was performed by replenishing cells with normal growing medium supplemented with 100 µg/ml Geneticin (Invitrogen Life Technologies) for 10 d. Fresh medium containing Geneticin was replaced twice a week until no cells were remaining in the control plate. Stable transfectants were pooled and maintained in media containing 100 µg/ml Geneticin.

Gel shift analyses
Gel shift experiments were performed using a PPRE oligonucleotide DR+1 made by annealing 5'-aaggggccaactaggtcaaaggtcaccggt-3' and 5'-aaggggaccggtgacctttgacctagttgg-3' primers and labeling with 32P-dCTP. Five to 10 µl of in vitro-translated products were incubated for 30 min at room temperature in a binding buffer composed of 20 mM HEPES (pH 7.8), 1 mM dithiothreitol, 0.1% Nonidet P-40, 50 mM KCl, 20% glycerol, and approximately 20,000 cpm of the radiolabeled probe in a final volume of 45 µl. In supershift studies, in vitro-translated products were preincubated for 30 min with 200 ng of anti-PPAR{gamma} E8 antibody (sc-7273; Santa Cruz Biotechnology, Santa Cruz, CA) before addition of radiolabeled probe. Bound products were separated on a 6% PAGE in 0.5x Tris-borate-EDTA. The gel was fixed in 30% methanol and 10% acetic acid for 20 min, vacuum dried for 2 h at 80 C, and exposed to film at –80 C.

RNA isolation and RT-PCR
RNA was isolated using TRI Reagent (Sigma-Aldrich) according to the manufacturer’s protocol, and 1 µg RNA was reverse transcribed using Superscript II (Invitrogen Life Technologies) and oligo-dT primers (Invitrogen Life Technologies) as per protocol. The cDNAs were amplified by PCR using a forward primer derived from exon 6 of PAX8, 5'-cgcggatccgcattgactcacagagca-3' and an antisense primer from exon 1 of PPAR{gamma}1, 5'-ccggaattcgaagtcaacagtagtgaa-3' for detection of the PAX8-PPAR{gamma} fusion gene. The ß2-microglobulin housekeeping gene was amplified using a forward primer derived from exon 2, 5'-acccccactgaaaaagatga-3' and an antisense primer from exon 4, 5'-atcttcaaacctccatgatg-3'.

Tritiated thymidine uptake assay
FRTL-5 cells were seeded into 24-well plates at a density of 1 x 105 cells per well and grown for 48 h. Each well was pulsed with 37 MBq of [methyl-3H]thymidine (PerkinElmer Cetus, Norwalk, CT) for 4 h at 37 C. Ciglitizone at 10 µM or equal volume of solvent control was added 24 h before the experiment. Cells were washed twice with ice cold PBS (Invitrogen Life Technologies) and once with cold 0.9% NaCl. Ice-cold methanol-acetic acid (3:1) was used to fix the cells for 2 h at 4 C. The methanol-acetic acid was removed and 0.5 M NaOH was added, and the cells were left overnight to solubilize. Lysate (500 µl) was mixed with 4 ml of liquid scintillant (Optima Gold) and counted for 2 min on a liquid scintillation counter (Packard 1500).

Anchorage-independent cell growth assay
A total of 1 x 104 cells from each stable cell line were trypsinized, resuspended in 1 ml of 0.5% agarose (SeaPlaque; Edwards Instrument Co., New South Wales, Australia), and layered on top of a solidified bottom layer of 0.5% agarose in a 6-well plate. One milliliter of normal growing media was added on top of the gel and changed twice a week. The number of colonies in each well was counted after 20 d by staining with 1 mg/ml p-iodonitrotetrazolium for 24 h. Ciglitizone was added for 48 h before staining.

Statistics
The statistical software package for Microsoft Excel was used to analyze the data. Pairwise comparisons using t tests were performed between groups as indicated. P ≤ 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transcriptional function of PAX8-PPAR{gamma} on PAX8-responsive promoters in heterologous cells
We first examined the transcriptional function of PAX8-PPAR{gamma} on reporter genes containing PAX8 response elements from within the NIS, TPO, and Tg genes, in heterologous HeLa cells that have previously been used for study of these promoters (32, 33, 34, 36, 40, 41). In these transient transfection experiments, wild-type PAX8 stimulated transcription more strongly from NISTK-Luc (2.4 ± 0.2-fold; Fig. 1AGo) than Tg-Luc (1.7 ± 0.3-fold; Fig. 1DGo), and we were unable to show significant PAX8 induction of full-length flNIS-Luc (1.3 ± 0.65-fold; Fig. 1BGo) or TPO-Luc constructs (1.2 ± 0.1-fold; Fig. 1CGo). In contrast, PAX8-PPAR{gamma} stimulated NISTK-Luc (3.0 ± 0.4-fold; Fig. 1AGo), flNIS-Luc (4.5 ± 0.2-fold; Fig. 1BGo), and TPO-Luc (1.8 ± 0.2-fold; Fig. 1CGo). Furthermore, the addition of the PPAR{gamma} agonist ciglitizone significantly enhanced PAX8-PPAR{gamma}-mediated transcription of NISTK-Luc and TPO-Luc (Fig. 1Go, A and C), suggesting that the PPAR{gamma} C terminus is functional within the fusion protein in some promoter contexts. Nevertheless, transcriptional activation by PAX8-PPAR{gamma} on NISTK-Luc was at least an order of magnitude less sensitive to thiazolidinedione treatment than that observed with PPAR{gamma} alone on the PPAR{gamma}-responsive promoter (Fig. 1EGo).



View larger version (32K):
[in this window]
[in a new window]
 
FIG. 1. PAX8-PPAR{gamma} transcriptional function on PAX8-responsive promoters in HeLa cells. HeLa cells were transiently transfected with expression vectors for transcription factors (or empty vector, pcDNA) as shown, together with luciferase reporter genes NISTK-Luc (n = 4) (A), flNIS-Luc (n = 3) (B), TPO-Luc (n = 9) (C), or Tg-Luc (n = 4) (D). Cells were treated with either 10 µM ciglitizone (black bars) or vehicle control (white bars). Data are mean ± SEM, and transcriptional response is shown relative to that seen with empty vector in the absence of ciglitizone. E, Induction of PPRETK-Luc by PPAR{gamma} or NISTK-Luc by PAX8-PPAR{gamma} in the presence of graded doses of ciglitizone (n = 3). Significant differences from empty vector without ciglitizone are indicated with asterisks (*, P < 0.05; **, P < 0.01) and a dagger indicates a significant difference (P < 0.05) between PAX8-PPAR{gamma} transcriptional response in the absence and presence of ciglitizone.

 
However, on the PAX8-responsive Tg promoter, PAX8-PPAR{gamma} not only failed to stimulate but indeed significantly repressed transcription relative to basal levels (0.73 ± 0.1-fold, P = 0.02; Fig. 1DGo). The addition of ciglitizone did not relieve the repressive effect of PAX8-PPAR{gamma} on this promoter. Therefore, PAX8-PPAR{gamma} appeared to be a ligand-dependent positive regulator of NIS and TPO promoter transcription, and a negative regulator of Tg promoter transcription in heterologous cells.

Because the Tg promoter is coordinately regulated by PAX8 and TITF1 together, we next sought to investigate PAX8-PPAR{gamma} transcriptional function in the presence of TITF1. As expected, TITF1 stimulated Tg promoter transcription more strongly than PAX8 alone (9.5 ± 0.8-fold vs. 1.6 ± 0.1-fold, respectively, P = 0.04; Fig. 2Go). However, the addition of PAX8-PPAR{gamma} inhibited TITF1-mediated transcription from the Tg promoter in a dominant-negative manner (0.7 ± 0.1-fold repression, P = 0.01; Fig. 2Go). In contrast, as previously described (31, 32, 33), the addition of PAX8 and TITF1 together synergistically activated transcription from the Tg promoter (17.3 ± 4.1-fold, P = 0.04 compared with TITF1 alone; Fig. 2Go). Nevertheless, PAX8/TITF1-mediated transcription was also dominantly inhibited by the presence of PAX8-PPAR{gamma} (0.6 ± 0.04-fold repression, P = 0.05; Fig. 2Go). The addition of ciglitizone did not relieve this repressive effect (data not shown). Although PAX8-PPAR{gamma} did not significantly inhibit wild-type PAX8 function alone on the Tg promoter (0.8 ± 0.2-fold repression, P = 0.17; Fig. 2Go), the relatively weak activation of this promoter by PAX8 may have limited our ability to detect this.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2. PAX8-PPAR{gamma} dominantly inhibits TITF1 or TITF1/PAX8-mediated transcription of the Tg promoter. HeLa cells were transiently transfected with expression vectors for transcription factors (or empty vector control, pcDNA) as shown, together with Tg-Luc luciferase reporter gene. Cells were transfected with either 1 µg PAX8-PPAR{gamma} (black bars) or empty vector (white bars). Data are mean ± SEM, and transcriptional response is shown relative to that seen with empty vector alone (n = 5). Significant differences between indicated bars are indicated with an asterisk (*, P < 0.05). ns, Not significant.

 
Transcriptional function of PAX8-PPAR{gamma} on PAX8-responsive promoters in thyroid cells
We next wished to examine PAX8-PPAR{gamma} function in cell lines relevant to its proposed role in thyroid neoplasia. We chose the well-differentiated Fischer rat thyroid (FRTL-5) cell line and human Nthy-ori cells that are commonly used in follicular thyroid cell models (42, 43) and that do not contain PAX8-PPAR{gamma} (data not shown). Overall, we found that PAX8-dependent transcription by PAX8-PPAR{gamma} was similar in thyroid cells compared with heterologous cells (Fig. 3Go). Although we expected that FRTL-5 and Nthy-ori cells contain endogenous PAX8, addition of transiently transfected PAX8 further stimulated expression from NISTK-Luc in both cell lines (Fig. 3Go, A and B). As in HeLa cells, PAX8-PPAR{gamma} also stimulated expression of NISTK-Luc and TPO-Luc in either thyroid cell line (Fig. 3Go, A–D). Results of reporter gene expression in the presence of ciglitazone were intriguing, insomuch as there appeared to be a general augmentation of transcription independent of the addition of either PAX8 or PAX8-PPAR{gamma} (Fig. 3Go, A–F), although these promoters lack a PPRE consensus sequence (data not shown). PAX8-PPAR{gamma}-mediated transcription was not specifically activated by the addition of ciglitizone on any promoter in thyroid cells (Fig. 3Go, A–F). Importantly, the lack of PAX8-PPAR{gamma} transcriptional activity on the Tg promoter was also observed in both thyroid cell lines (Fig. 3Go, E and F) indicating that PAX8-PPAR{gamma}-dependent inactivity on this promoter is not due to lack of thyroid-specific transcriptional cofactors in heterologous cells.



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. PAX8-PPAR{gamma} transcriptional function on PAX8-responsive promoters in thyroid cells. FRTL-5 (A, C, and E) and Nthy-ori cells (B, D, and F) were transiently transfected with expression vectors for transcription factors (or empty vector, pcDNA) as shown, together with luciferase reporter genes NISTK-Luc (A and B), TPO-Luc (C and D), or Tg-Luc (E and F). Cells were treated with either 10 µM ciglitizone (black bars) or vehicle (white bars). Data are mean ± SEM (n = 3), and transcriptional response is shown relative to that seen with empty vector in the absence of ciglitizone. Significant differences from empty vector without ciglitizone are indicated with an asterisk (*, P < 0.05).

 
Transcriptional function of PAX8-PPAR{gamma} on PPAR{gamma}-responsive promoters
We then examined PAX8-PPAR{gamma} function on a PPAR{gamma}-responsive promoter (38). In HeLa cells, wild-type PPAR{gamma} stimulated basal transcription from PPRETK-Luc 4.4 ± 0.8-fold (P < 0.01) and responded to thiazolidinedione as expected (further stimulation by 2.1 ± 0.1-fold, P = 0.02; Fig. 4AGo). PAX8-PPAR{gamma} in contrast failed to activate this promoter either in the absence or presence of PPAR{gamma} agonist, but repression of this promoter was not observed (1.1 ± 0.1-fold change; Fig. 3AGo). Conversely, a synthetic PPAR{gamma} dominant-negative mutant that has previously been shown to recruit corepressors (18) did repress basal transcription of PPRETK-Luc 0.7 ± 0.1-fold (P = 0.03), although this effect was partly reversed by the addition of thiazolidinedione (Fig. 4AGo). We also found that PAX8-PPAR{gamma} is inactive and dominantly inhibits PPAR{gamma}-mediated transcription from PPRETK-Luc in HEK293 cells (data not shown). Overall, our data in heterologous cells was comparable to a previous report that studied PAX8-PPAR{gamma} on the PPAR{gamma}-responsive aP2 enhancer (4).



View larger version (26K):
[in this window]
[in a new window]
 
FIG. 4. PAX8-PPAR{gamma} transcriptional function on PPRETK-Luc. Expression vectors for transcription factors (or empty vector, pcDNA) as shown together with PPRETK-Luc were transiently transfected in HeLa cells (A), FRTL-5 cells (B), Nthy-ori cells (C), and dog thyrocytes (D). Cells were treated with either 10 µM ciglitizone (black bars) or vehicle (white bars). Data are mean ± SEM (n = 3), and transcriptional response is shown relative to that seen with empty vector in the absence of ciglitizone. Significant differences from empty vector without ciglitizone are indicated with asterisks (*, P < 0.05; **, P < 0.01) and a dagger indicates a significant difference (P < 0.05) between PAX8-PPAR{gamma} and PPAR{gamma} transcriptional response in the absence and presence of ciglitizone.

 
In FRTL-5 and Nthy-ori cells, however, PAX8-PPAR{gamma} stimulated transcription from PPRETK-Luc (Fig. 4Go, B and C). PAX8-PPAR{gamma}-mediated basal transcription of this promoter was comparable to that seen with wild-type PPAR{gamma} (3.0 ± 0.5-fold vs. 3.0 ± 0.2-fold, respectively, in FRTL-5 cells and 4.7 ± 0.3-fold vs. 4.2 ± 1.2-fold, respectively, in Nthy-ori cells). PAX8-PPAR{gamma}-dependent transcription was significantly stimulated by 10 µM ciglitizone in Nthy-ori cells (Fig. 4CGo), but no significant ligand response was seen in FRTL-5 cells (Fig. 4BGo). The addition of ciglitizone stimulated PPAR{gamma}-dependent transcription 2.8 ± 0.5-fold in FRTL-5 cells (Fig. 4BGo) and 15.5 ± 4.7-fold in Nthy-ori cells (Fig. 4CGo). By comparison, the dominant-negative PPAR{gamma} mutant neither repressed nor stimulated this promoter in FRTL-5 cells (1.1 ± 0.1-fold change).

To address potential concerns that available thyroid cell lines may differ substantially from true thyrocytes, PPRETK-Luc was also transfected into primary cultures of dog thyrocytes (Fig. 4DGo). Luciferase was induced 8.1 ± 2.0-fold by PPAR{gamma} in the absence of ciglitizone and 30.6 ± 6.3-fold in the presence of ciglitizone. Inductions by PAX8-PPAR{gamma} were 7.2 ± 1.8-fold and 17 ± 3.0-fold in the absence and presence of ciglitizone, respectively. These data are similar to the findings in FRTL-5 and Nthy-ori cells.

PAX8-PPAR{gamma} binds to a PPAR{gamma} consensus DNA recognition sequence
Transcription factors mediate gene transactivation through binding to specific cognate response elements located in promoter regions. PPAR{gamma} binds a consensus recognition sequence containing direct repeats of a hexamer spaced by one nucleotide (DR+1) (44). Therefore, we examined the ability of PAX8-PPAR{gamma} to bind this cognate DNA element in gel shift analyses. PPAR{gamma} preferentially interacts with this DNA sequence as a heterodimer with the retinoid X receptor {alpha} (RXR{alpha}) (Fig. 5Go, lane 3) although RXR homodimers also form a complex, albeit less efficiently (Fig. 5Go, lanes 1 and 2). The addition of an anti-PPAR{gamma} monoclonal antibody results in a supershifted complex (Fig. 5Go, lane 4), confirming the identity of the DNA-bound PPAR{gamma}-RXR heterodimer. PAX8-PPAR{gamma} also bound this DNA sequence as a heterodimer with RXR (Fig. 5Go, lane 5) with a size difference consistent with the presence of PAX8 compared with PPAR{gamma}-RXR alone. Translation from an internal start site in PAX8-PPAR{gamma} produced a DNA-bound complex with RXR similar in mobility to the PPAR{gamma}-RXR band. Once again, the addition of the anti-PPAR{gamma} antibody confirmed the identity of the PAX8-PPAR{gamma}-RXR heterodimer-DNA complex (Fig. 5Go, lane 6). No PPAR{gamma} or PAX8-PPAR{gamma} complexes were seen in the absence of RXR, nor did the addition of ciglitizone alter the mobility of either PPAR{gamma}-RXR or PAX8-PPAR{gamma}-RXR DNA-bound complexes (data not shown). We have not as yet been able to demonstrate PAX8-PPAR{gamma} binding to PAX8 response elements in gel mobility shift experiments (data not shown), although it is possible that we are lacking some critical cofactor required for binding.



View larger version (44K):
[in this window]
[in a new window]
 
FIG. 5. PAX8-PPAR{gamma} binds to a PPAR{gamma} DNA-recognition site. A direct repeat of a consensus PPAR{gamma}-binding element spaced by 1 nucleotide (DR+1) was used in gel-shift analysis with in vitro-translated RXR{alpha} (lanes 1–6), PPAR{gamma} (lanes 3 and 4), and PAX8-PPAR{gamma} (lanes 5 and 6). Unprogrammed reticulocyte lysate was included in lane 1 (control) to normalize for protein content. Protein and radiolabeled probe were incubated with monoclonal anti-PPAR{gamma} antibody (lanes 2, 4, and 6) or nonspecific monoclonal antibody (lanes 1, 3, and 5) before gel resolution. The PPAR{gamma}-RXR (lane 3) and PAX8-PPAR{gamma}-RXR (lane 5) heterodimer-DNA complexes, and supershifted complexes in lanes 4 and 6 are as indicated.

 
PAX8-PPAR{gamma} increases proliferation of rat follicular thyroid cells
We then examined the effect of PAX8-PPAR{gamma} expression on follicular thyroid cell growth. A recent report demonstrated that PAX8-PPAR{gamma} expression increased growth and decreased apoptosis in human Nthy-ori cells (43). In contrast, we chose to express PAX8-PPAR{gamma} in the better-differentiated FRTL-5 cell model (45). FRTL-5 cells were stably transfected with pcDNA3-PAX8-PPAR{gamma} constitutively expressing the fusion protein under control of the cytomegalovirus promoter. We confirmed PAX8-PPAR{gamma} expression by RT-PCR (Fig. 6AGo). PAX8-PPAR{gamma} expression was associated with increased FRTL-5 cell growth as assessed by thymidine uptake (Fig. 6BGo) and by proliferation in semisolid media (46) (Fig. 6CGo). The addition of thiazolidinedione did not affect thymidine uptake (Fig. 6BGo) or soft-agar proliferation (data not shown) by PAX8-PPAR{gamma}-expressing FRTL-5 cells.



View larger version (36K):
[in this window]
[in a new window]
 
FIG. 6. PAX8-PPAR{gamma} stimulates growth of FRTL-5 cells. A, PAX8-PPAR{gamma} expression in stably transfected FRTL-5 cells. PCR with primers specific for PAX8-PPAR{gamma} (top panel) or ß2-microglobulin (lower panel) was performed using mRNA from FRTL-5 cells stably transfected with empty vector (lane 1) or the PAX8-PPAR{gamma} expression vector (lane 2) as shown. PCRs performed with controls without reverse transcriptase (–RT, lanes 3 and 4), no RNA with reverse transcriptase (+RT, lane 5), and no cDNA (H2O, lane 6) were negative. B, Tritiated thymidine uptake in FRTL-5 cells stably transfected with empty vector or PAX8-PPAR{gamma} expression vector in the absence (white bars) or presence (black bars) of 10 µM ciglitizone (n = 2). C, Colony formation in soft agar by FRTL-5 cells constitutively expressing PAX8-PPAR{gamma}, compared with FRTL-5 cells containing empty vector (n = 3). In B and C, results are mean ± SD, expressed relative to FRTL-5 cells containing empty vector.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The chromosomal translocation t(2;3)(q13;p25) that produces the PAX8-PPAR{gamma} fusion gene has been associated with a subset of follicular thyroid carcinomas and possibly adenomas, although the transcriptional mechanisms by which PAX8-PPAR{gamma} stimulates thyroid neoplasia have not previously been studied in detail. A prevailing hypothesis is that PAX8-PPAR{gamma} inhibits PPAR{gamma} function in thyroid cells. In support of this, PAX8-PPAR{gamma} was initially shown to disrupt PPAR{gamma}-mediated transcription in a dominant-negative manner (4). A subsequent study also found that PAX8-PPAR{gamma} dominantly inhibited PPAR{gamma}-mediated transcription in human Nthy-ori cells and proposed that PAX8-PPAR{gamma}-stimulated growth of these cells depended at least in part on inhibition of PPAR{gamma} function (43). Finally, PPAR{gamma} expression was shown to be down-regulated in follicular thyroid carcinomas that do not contain the PAX8-PPAR{gamma} translocation (47, 48). In combination, therefore, these previous results suggested that follicular thyroid neoplasia may be associated with net loss of PPAR{gamma} activity either through lack of endogenous PPAR{gamma} expression or by PAX8-PPAR{gamma}-mediated dominant inhibition of wild-type PPAR{gamma} transcriptional function.

Our study provides combined evidence for two alternate hypotheses, namely that PAX8-PPAR{gamma} affects PAX8 function on the one hand, and is capable of inducing PPAR{gamma}-dependent transcription on the other. However the pattern of transcriptional regulation by PAX8-PPAR{gamma} is complex, such that some PAX8-responsive promoters were up-regulated (TPO, NIS), whereas another (Tg) was inhibited in a dominant-negative manner. PAX8-PPAR{gamma} function on a PPRE was similarly complex, capable of stimulating transcription from this promoter when in the appropriate cellular environment. These results are strongly supported by a recent report by Lacroix et al. (61) that found specific up-regulation of several PPAR{gamma} target genes in tumors containing PAX8-PPAR{gamma}, but not in those tumors lacking the translocation. Taken together, these data suggest that inappropriate induction of some PPAR{gamma}-responsive genes, rather than their repression, may contribute to the pathogenesis of follicular thyroid cancer, a hypothesis that is all the more plausible considering the extremely low level of endogenous PPAR{gamma} expression in normal thyrocytes. Therefore, the differences between PAX8-PPAR{gamma}-mediated regulation of the acyl-CoA oxidase PPRE used in our study and the aP2 enhancer PPRE used by Powell et al. (43) are likely to be promoter and/or cofactor dependent. We are now studying PAX8-PPAR{gamma} transcriptional function on those PPAR{gamma}-target genes including angiopoietin-like 4 and aquaporin 7 that were found to be up-regulated in microarray analyses of PAX8-PPAR{gamma}-positive tumors (61).

PAX8-PPAR{gamma} responsiveness to PPAR{gamma} agonist also appeared to be both promoter and cell type dependent. On the NIS promoter, transcriptional activation by PAX8-PPAR{gamma} in response to thiazolidinedione treatment was comparatively weak and at least an order of magnitude less sensitive than that observed with PPAR{gamma} alone on a PPAR{gamma}-responsive promoter (Fig. 1EGo). Although stronger agonist responses were seen on a PPRE in thyroid cells, PAX8-PPAR{gamma} transcription was still not augmented by ciglitizone to the same extent as for wild-type PPAR{gamma} despite comparable basal activities (Fig. 4Go, C and D). Whether this relates to altered ligand affinity in the fusion protein, or to altered cofactor recruitment is not yet clear. We are also now examining whether PAX8-PPAR{gamma} may be more responsive to tyrosine-based PPAR{gamma} agonists, as has been previously reported with PPAR{gamma} mutants that otherwise respond poorly to thiazolidinediones both in vitro and in vivo (18, 59).

Thus, our studies suggest that PAX8-PPAR{gamma} has mixed function that can either replicate the transcriptional effects of either PAX8 or PPAR{gamma} alone when the appropriate promoter- or cell-type-specific conditions are present; or inhibit gene expression when these necessary promoter- or cell-specific conditions are lacking. We have demonstrated that growth of rat FRTL-5 thyroid cells was stimulated by PAX8-PPAR{gamma} expression, as has previously been shown for less well-differentiated human thyroid cells (43). In combination, our results suggest that PAX8-PPAR{gamma} disrupts normal transcriptional pathways in thyroid cells by means of a complex mix of activation of some genes and inhibition of others, the net effect of which is to stimulate follicular thyroid neoplasia.

Differing histological phenotypes of thyroid carcinoma have all now been associated with specific molecular abnormalities. Papillary carcinoma is associated with a chromosomal translocation that leads to activation of the RET proto-oncogene (2, 49) or an activating mutation of the braf kinase (50). Medullary carcinoma is associated with RET mutations that lead to its constitutive activity within C-cells (3). Our finding that PAX8-PPAR{gamma} stimulates PAX8-specific gene expression is consonant with its specific association with follicular thyroid cell neoplasms, and the known role of PAX8 in thyroid follicular cell differentiation (8). Conversely, the mechanism by which PAX8-PPAR{gamma} inhibits transcription from the PAX8-responsive Tg promoter is unclear. It is possible that PAX8-PPAR{gamma} binds the Tg promoter but cannot interact with TITF1 or other cofactors necessary for Tg transcription, and we found that PAX8-PPAR{gamma} dominantly inhibited TITF1 mediated Tg-Luc transcription in a manner that might be consistent with steric hindrance (Fig. 2Go). Alternatively, PAX8-PPAR{gamma} might recruit transcriptional corepressors via PPAR{gamma}. Indeed, specific mutations in the extreme C terminus of PPAR{gamma} have been previously shown to cause corepressor recruitment and dominant-negative transcriptional function by PPAR{gamma} (18, 19). Furthermore, naturally occurring PPAR{gamma} mutations associated with a syndrome of insulin resistance and lipodystrophy have also been shown to be associated with recruitment of corepressors to target genes (20). However, when we compared PAX8-PPAR{gamma} with a corepressor-binding mutant PPAR{gamma} (18), although both dominantly inhibited transcription from PPRETK-Luc in heterologous cells (Fig. 4AGo and data not shown), PAX8-PPAR{gamma} clearly differed from the mutant PPAR{gamma} in its transcriptional function in thyroid cells (Fig. 4Go, B–D). We speculate that this may be due to PAX8-mediated recruitment of thyroid-specific coactivators to the DNA-bound fusion protein (Fig. 5Go).

Dysregulated recruitment of transcriptional corepressors has also been implicated in other clinical syndromes, including thyroid hormone resistance syndrome associated with mutant thyroid hormone ß receptors (TRß) (21) and acute promyelocytic leukemia associated with translocations fusing the myeloid-specific PML or PLZF genes with the retinoic acid receptor {alpha} gene (22, 23, 51). Corepressor-mediated recruitment of histone deacetylases has been proposed to be a key pathogenic feature in acute promyelocytic leukemia (22, 23, 51). Similarly, recent work has also suggested that histone deacetylases may be important in thyroid carcinogenesis (52, 53, 54, 55, 56, 57, 58). Histone deacetylase inhibitors promote reexpression of NIS (52, 53, 54, 55, 56) and increase apoptosis (57, 58) in poorly differentiated thyroid cancer cell lines. We are now investigating whether these compounds specifically derepress PAX8-PPAR{gamma} transcription.

Although PAX8-PPAR{gamma} stimulates NIS and TPO promoter expression in our cell culture models, these genes may be down-regulated in follicular thyroid carcinomas (60). Indeed, the recent report by Lacroix et al. (61) did not find that Tg, TPO, or NIS genes were differentially expressed in follicular tumors harboring or not harboring the PAX8-PPAR{gamma} translocation. However, only a few PAX8-PPAR{gamma} tumors were analyzed (four in microarray, five in quantitative PCR experiments) and since multiple transcription factors regulate these promoters it may be too simplistic to expect PAX8-PPAR{gamma} to have discernible effects in a small sample size. It is also possible that PAX8-mediated transcriptional function is dependent upon as yet unknown cofactors that are lost as thyroid cells become progressively undifferentiated. Even if basal NIS expression is not altered, it will be very interesting to determine whether PPAR{gamma} agonists might up-regulate NIS expression in follicular carcinomas harboring the PAX8-PPAR{gamma} translocation, which would have practical therapeutic relevance in enhancing tumor cell ablation by radioactive iodine.


    Acknowledgments
 
We are indebted to Prof. V. K. K. Chatterjee (University of Cambridge) for providing expression vectors for TITF1, PAX8, PPAR{gamma}, PPAR{gamma} mutant, Tg-Luc, and PPRETK-Luc; Prof. S. Jhiang (The Ohio State University) for the full-length flNIS-Luc; and to Dr. T. G. Kroll (University of Chicago) for the PAX8-PPAR{gamma} expression plasmid.


    Footnotes
 
This work was supported by the Cure Cancer Australia Foundation, University of Sydney Cancer Research Fund (to B.G.R and R.J.C.-B.) and National Institutes of Health Grant DK44155 (to R.J.K.).

First Published Online September 22, 2005

1 A.Y.M.A. and C.M. contributed equally to this work. Back

Abbreviations: NIS, Sodium-iodide symporter; PAX8, paired box gene 8; PPAR, peroxisome proliferator-activated receptor; PPRE, PPAR{gamma}-response element; rNUE, rat NIS upstream enhancer; RET, rearranged during transfection; RXR{alpha}, retinoid X receptor {alpha}; Tg, thyroglobulin; TITF1, thyroid transcription factor-1; TPO, thyroperoxidase.

Received February 4, 2005.

Accepted for publication September 13, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Mazzaferri EL 1996 In Wener and Ingbar’s the thyroid. 7th ed. Philadelphia: Lippincott-Raven
  2. Fusco A, Grieco M, Santoro M, Berlingieri MT, Pilotti S, Pierotti MA, Della Porta G, Vecchio G 1987 A new oncogene in human thyroid papillary carcinomas and their lymph-nodal metastases. Nature 328:170–172[CrossRef][Medline]
  3. Mulligan LM, Kwok JB, Healey CS, Elsdon MJ, Eng C, Gardner E, Love DR, Mole SE, Moore JK, Papi L, Ponder MA, Telenius H, Tunnacliffe A, Ponder BAJ 1993 Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 363:458–460[CrossRef][Medline]
  4. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA 2000 PAX8-PPAR{gamma}1 fusion oncogene in human thyroid carcinoma. Science 289:1357–1360[Abstract/Free Full Text]
  5. Pasca di Magliano M, Di Lauro R, Zannini M 2000 Pax8 has a key role in thyroid cell differentiation. Proc Natl Acad Sci USA 97:13144–13149[Abstract/Free Full Text]
  6. Tontonoz P, Hu E, Graves RA, Budavari AI, Spiegelman BM 1994 mPPAR{gamma}2: tissue-specific regulator of an adipocyte enhancer. Genes Dev 8:1224–1234[Abstract/Free Full Text]
  7. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  8. Willson TM, Cobb JE, Cowan DJ, Wiethe RW, Correa ID, Prakash SR, Beck KD, Moore LB, Kliewer SA, Lehmann JM 1996 The structure-activity relationship between peroxisome proliferator-activated receptor {gamma} agonism and the antihyperglycemic activity of thiazolidinediones. J Med Chem 39:665–668[CrossRef][Medline]
  9. Nikiforova MN, Biddinger PW, Caudill CM, Kroll TG, Nikiforov YE 2002 PAX8-PPAR{gamma} rearrangement in thyroid tumors: RT-PCR and immunohistochemical analyses. Am J Surg Pathol 26:1016–1023[CrossRef][Medline]
  10. Marques AR, Espadinha C, Catarino AL, Moniz S, Pereira T, Sobrinho LG, Leite V 2002 Expression of PAX8-PPAR{gamma}1 rearrangements in both follicular thyroid carcinomas and adenomas. J Clin Endocrinol Metab 87:3947–3952[Abstract/Free Full Text]
  11. Nikiforova MN, Lynch RA, Biddinger PW, Alexander EK, Dorn 2nd GW, Tallini G, Kroll TG, Nikiforov YE 2003 RAS point mutations and PAX8-PPAR {gamma} rearrangement in thyroid tumors: evidence for distinct molecular pathways in thyroid follicular carcinoma. J Clin Endocrinol Metab 88:2318–2326[Abstract/Free Full Text]
  12. Dwight T, Thoppe SR, Foukakis T, Lui WO, Wallin G, Hoog A, Frisk T, Larsson C, Zedenius J 2003 Involvement of the PAX8/peroxisome proliferator-activated receptor {gamma} rearrangement in follicular thyroid tumors. J Clin Endocrinol Metab 88:4440–4445[Abstract/Free Full Text]
  13. Cheung L, Messina M, Gill A, Clarkson A, Learoyd D, Delbridge L, Wentworth J, Philips J, Clifton-Bligh R, Robinson BG 2003 Detection of the PAX8-PPAR{gamma} fusion oncogene in both follicular thyroid carcinomas and adenomas. J Clin Endocrinol Metab 88:354–357[Abstract/Free Full Text]
  14. French CA, Alexander EK, Cibas ES, Nose V, Laguette J, Faquin W, Garber J, Moore Jr F, Fletcher JA, Larsen PR, Kroll TG 2003 Genetic and biological subgroups of low-stage follicular thyroid cancer. Am J Pathol 162:1053–1060[Abstract/Free Full Text]
  15. Fredericks WJ, Galili N, Mukhopadhyay S, Rovera G, Bennicelli J, Barr FG, Rauscher 3rd FJ 1995 The PAX3-FKHR fusion protein created by the t(2;13) translocation in alveolar rhabdomyosarcomas is a more potent transcriptional activator than PAX3. Mol Cell Biol 15:1522–1535[Abstract]
  16. May WA, Gishizky ML, Lessnick SL, Lunsford LB, Lewis BC, Delattre O, Zucman J, Thomas G, Denny CT 1993 Ewing sarcoma 11;22 translocation produces a chimeric transcription factor that requires the DNA-binding domain encoded by FLI1 for transformation. Proc Natl Acad Sci USA 90:5752–5756[Abstract/Free Full Text]
  17. Lavinsky RM, Jepsen K, Heinzel T, Torchia J, Mullen TM, Schiff R, Del-Rio AL, Ricote M, Ngo S, Gemsch J, Hilsenbeck SG, Osborne CK, Glass CK, Rosenfeld MG, Rose DW 1998 Diverse signaling pathways modulate nuclear receptor recruitment of N-CoR and SMRT complexes. Proc Natl Acad Sci USA 95:2920–2925[Abstract/Free Full Text]
  18. Gurnell M, Wentworth JM, Agostini M, Adams M, Collingwood TN, Provenzano C, Browne PO, Rajanayagam O, Burris TP, Schwabe JW, Lazar MA, Chatterjee VK 2000 A dominant-negative peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) mutant is a constitutive repressor and inhibits PPAR{gamma}-mediated adipogenesis. J Biol Chem 275:5754–5759[Abstract/Free Full Text]
  19. Park Y, Freedman BD, Lee EJ, Park S, Jameson JL 2003 A dominant negative PPAR{gamma} mutant shows altered cofactor recruitment and inhibits adipogenesis in 3T3–L1 cells. Diabetologia 46:365–377[Medline]
  20. Barroso I, Gurnell M, Crowley VE, Agostini M, Schwabe JW, Soos MA, Maslen GL, Williams TD, Lewis H, Schafer AJ, Chatterjee VK, O’Rahilly S 1999 Dominant negative mutations in human PPAR{gamma} associated with severe insulin resistance, diabetes mellitus and hypertension. Nature 402:880–883[Medline]
  21. Yoh SM, Chatterjee VK, Privalsky ML 1997 Thyroid hormone resistance syndrome manifests as an aberrant interaction between mutant T3 receptors and transcriptional corepressors. Mol Endocrinol 11:470–480[Abstract/Free Full Text]
  22. Lin RJ, Nagy L, Inoue S, Shao W, Miller Jr WH, Evans RM 1998 Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature 391:811–814[CrossRef][Medline]
  23. Grignani F, De Matteis S, Nervi C, Tomassoni L, Gelmetti V, Cioce M, Fanelli M, Ruthardt M, Ferrara FF, Zamir I, Seiser C, Grignani F, Lazar MA, Minucci S, Pelicci PG 1998 Fusion proteins of the retinoic acid receptor-{alpha} recruit histone deacetylase in promyelocytic leukaemia. Nature 391:815–818[CrossRef][Medline]
  24. Martelli ML, Iuliano R, Le Pera I, Sama’ I, Monaco C, Cammarota S, Kroll T, Chiariotti L, Santoro M, Fusco A 2002 Inhibitory effects of peroxisome poliferator-activated receptor {gamma} on thyroid carcinoma cell growth. J Clin Endocrinol Metab 87:4728–4735[Abstract/Free Full Text]
  25. Ohta K, Endo T, Haraguchi K, Hershman JM, Onaya T 2001 Ligands for peroxisome proliferator-activated receptor {gamma} inhibit growth and induce apoptosis of human papillary thyroid carcinoma cells. J Clin Endocrinol Metab 86:2170–2177[Abstract/Free Full Text]
  26. Tontonoz P, Singer S, Forman BM, Sarraf P, Fletcher JA, Fletcher CD, Brun RP, Mueller E, Altiok S, Oppenheim H, Evans RM, Spiegelman BM 1997 Terminal differentiation of human liposarcoma cells induced by ligands for peroxisome proliferator-activated receptor {gamma} and the retinoid X receptor. Proc Natl Acad Sci USA 94:237–241[Abstract/Free Full Text]
  27. Sarraf P, Mueller E, Smith WM, Wright HM, Kum JB, Aaltonen LA, de la Chapelle A, Spiegelman BM, Eng C 1999 Loss-of-function mutations in PPAR{gamma} associated with human colon cancer. Mol Cell 3:799–804[CrossRef][Medline]
  28. Chalepakis G, Fritsch R, Fickenscher H, Deutsch U, Goulding M, Gruss P 1991 The molecular basis of the undulated/Pax-1 mutation. Cell 66:873–884[CrossRef][Medline]
  29. Poleev A, Fickenscher H, Mundlos S, Winterpacht A, Zabel B, Fidler A, Gruss P, Plachov D 1992 PAX8, a human paired box gene: isolation and expression in developing thyroid, kidney and Wilms’ tumors. Development 116:611–623[Abstract]
  30. Kozmik Z, Kurzbauer R, Dorfler P, Busslinger M 1993 Alternative splicing of Pax-8 gene transcripts is developmentally regulated and generates isoforms with different transactivation properties. Mol Cell Biol 13:6024–6035[Abstract/Free Full Text]
  31. Damante G, Tell G, Di Lauro R 2001 A unique combination of transcription factors controls differentiation of thyroid cells. Prog Nucleic Acids Res Mol Biol 66:307–356[Medline]
  32. Di Palma T, Nitsch R, Mascia A, Nitsch L, Di Lauro R, Zannini M 2003 The paired domain-containing factor Pax8 and the homeodomain-containing factor TTF-1 directly interact and synergistically activate transcription. J Biol Chem 278:3395–3402[Abstract/Free Full Text]
  33. Espinoza CR, Schmitt TL, Loos U 2001 Thyroid transcription factor 1 and Pax8 synergistically activate the promoter of the human thyroglobulin gene. J Mol Endocrinol 27:59–67[Abstract]
  34. Fabbro D, Pellizzari L, Mercuri F, Tell G, Damante G 1998 Pax-8 protein levels regulate thyroglobulin gene expression. J Mol Endocrinol 21:347–354[Abstract]
  35. Vilain C, Rydlewski C, Duprez L, Heinrichs C, Abramowicz M, Malvaux P, Renneboog B, Parma J, Costagliola S, Vassart G 2001 Autosomal dominant transmission of congenital thyroid hypoplasia due to loss-of-function mutation of PAX8. J Clin Endocrinol Metab 86:234–238[Abstract/Free Full Text]
  36. Ohno M, Zannini M, Levy O, Carrasco N, di Lauro R 1999 The paired-domain transcription factor Pax8 binds to the upstream enhancer of the rat sodium/iodide symporter gene and participates in both thyroid-specific and cyclic-AMP-dependent transcription. Mol Cell Biol 19:2051–2060[Abstract/Free Full Text]
  37. Tong Q, Ryu KY, Jhiang SM 1997 Promoter characterization of the rat Na+/I symporter gene. Biochem Biophys Res Commun 239:34–41[CrossRef][Medline]
  38. Forman BM, Tontonoz P, Chen J, Brun RP, Spiegelman BM, Evans RM 1995 15-Deoxy-{delta} 12,14-prostaglandin J2 is a ligand for the adipocyte determination factor PPAR{gamma}. Cell 83:803–812[CrossRef][Medline]
  39. Uyttersprot N, Costagliola S, Miot F 1998 A new tool for efficient transfection of dog and human thyrocytes in primary culture. Mol Cell Endocrinol 142:35–39[CrossRef][Medline]
  40. Miccadei S, De Leo R, Zammarchi E, Natali PG, Civitareale D 2002 The synergistic activity of thyroid transcription factor 1 and Pax 8 relies on the promoter/enhancer interplay. Mol Endocrinol 16:837–846[Abstract/Free Full Text]
  41. Schmitt TL, Espinoza CR, Loos U 2001 Transcriptional regulation of the human sodium/iodide symporter gene by Pax8 and TTF-1. Exp Clin Endocrinol Diabetes 109:27–31[CrossRef][Medline]
  42. Tasevski V, Benn D, Peters G, Luttrell B, Simpson A 1998 The Fischer rat thyroid cell line FRTL-5 exhibits a nondiploid karyotype. Thyroid 8:623–626[Medline]
  43. Powell JG, Wang X, Allard BL, Sahin M, Wang XL, Hay ID, Hiddinga HJ, Deshpande SS, Kroll TG, Grebe SK, Eberhardt NL, McIver B 2004 The PAX8/PPAR{gamma} fusion oncoprotein transforms immortalized human thyrocytes through a mechanism probably involving wild-type PPAR{gamma} inhibition. Oncogene 23:3634–3641[CrossRef][Medline]
  44. Lemberger T, Desvergne B, Wahli W 1996 Peroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiology. Annu Rev Cell Dev Biol 12:335–363[CrossRef][Medline]
  45. Ambesi-Impiombato FS, Parks LA, Coon HG 1980 Culture of hormone-dependent functional epithelial cells from rat thyroids. Proc Natl Acad Sci USA 77:3455–3459[Abstract/Free Full Text]
  46. Motti ML, Boccia A, Belletti B, Bruni P, Troncone G, Cito L, Monaco M, Chiappetta G, Baldassarre G, Palombini L, Fusco A, Viglietto G 2003 Critical role of cyclin D3 in TSH-dependent growth of thyrocytes and in hyperproliferative diseases of the thyroid gland. Oncogene 22:7576–7586[CrossRef][Medline]
  47. Aldred MA, Morrison C, Gimm O, Hoang-Vu C, Krause U, Dralle H, Jhiang S, Eng C 2003 Peroxisome proliferator-activated receptor {gamma} is frequently downregulated in a diversity of sporadic nonmedullary thyroid carcinomas. Oncogene 22:3412–3416[CrossRef][Medline]
  48. Marques AR, Espadinha C, Frias MJ, Roque L, Catarino AL, Sobrinho LG, Leite V 2004 Underexpression of peroxisome proliferator-activated receptor (PPAR){gamma} in PAX8/PPAR{gamma}-negative thyroid tumors PAX8-PPAR{gamma} rearrangement in thyroid tumors: RT-PCR and immunohistochemical analyses. Br J Cancer 91:732–738[Medline]
  49. Bongarzone I, Pierotti MA, Monzini N, Mondellini P, Manenti G, Donghi R, Pilotti S, Grieco M, Santoro M, Fusco A, Vechio G, Dello Porta G 1989 High frequency of activation of tyrosine kinase oncogenes in human papillary thyroid carcinoma. Oncogene 4:1457–1462[Medline]
  50. Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA 2003 High prevalence of BRAF mutations in thyroid cancer: genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 63:1454–1457[Abstract/Free Full Text]
  51. He LZ, Guidez F, Tribioli C, Peruzzi D, Ruthardt M, Zelent A, Pandolfi PP 1998 Distinct interactions of PML-RAR{alpha} and PLZF-RAR{alpha} with co-repressors determine differential responses to RA in APL. Nat Genet 18:126–135[CrossRef][Medline]
  52. Kitazono M, Robey R, Zhan Z, Sarlis NJ, Skarulis MC, Aikou T, Bates S, Fojo T 2001 Low concentrations of the histone deacetylase inhibitor, depsipeptide (FR901228), increase expression of the Na+/I symporter and iodine accumulation in poorly differentiated thyroid carcinoma cells. J Clin Endocrinol Metab 86:3430–3435[Abstract/Free Full Text]
  53. Zarnegar R, Brunaud L, Kanauchi H, Wong M, Fung M, Ginzinger D, Duh QY, Clark OH 2002 Increasing the effectiveness of radioactive iodine therapy in the treatment of thyroid cancer using trichostatin A, a histone deacetylase inhibitor. Surgery 132:984–990[CrossRef][Medline]
  54. Catalano MG, Fortunati N, Pugliese M, Costantino L, Poli R, Bosco O, Boccuzzi G 2005 Valproic acid induces apoptosis and cell cycle arrest in poorly differentiated thyroid cancer cells. J Clin Endocrinol Metab 90:1383–1389