Endocrinology, doi:10.1210/en.2005-1053
Endocrinology Vol. 147, No. 1 543-551
Copyright © 2006 by The Endocrine Society
Stimulation of the Novel Estrogen Receptor-
Intronic TERP-1 Promoter by Estrogens, Androgen, Pituitary Adenylate Cyclase-Activating Peptide, and Forskolin, and Autoregulation by TERP-1 Protein
Winnifred M. Bryant,
Matthew A. Gibson and
Margaret A. Shupnik
Division of Endocrinology and Metabolism, Department of Internal Medicine, University of Virginia, Charlottesville, Virginia 22903
Address all correspondence and requests for reprints to: Margaret A. Shupnik, Ph.D., Department of Internal Medicine/Endocrinology, P.O. Box 800578 HSC, University of Virginia, Charlottesville, Virginia 22908. E-mail: mas3x{at}virginia.edu.
 |
Abstract
|
|---|
The estrogen receptor-
(ER
) pituitary-specific variant, TERP-1, is regulated dramatically by physiological status. We examined hormonal regulation of the TERP-1 promoter in transient transfection assays in GH3 somatolactotrope cells. We found that 17ß-estradiol (E2), genistein, androgen, pituitary adenylate cyclase-activating peptide, and forskolin (FSK) all stimulated TERP-1 promoter activity, whereas progesterone had no effect. ER
bound to a palindromic estrogen response element (ERE) and two half-site EREs; mutation of any of these sites decreased basal expression and completely obliterated E2 stimulation. In contrast, mutation of an activator protein-1 site decreased basal and FSK-stimulated promoter activity, but not E2 or androgen stimulation. The pure antiestrogen ICI 182,780 suppressed E2 and genistein, but not FSK or androgen, stimulation. Similarly, mutation of the ERE palindrome or half-site EREs suppressed promoter stimulation by E2 and genistein, but not by androgen or FSK. Because TERP-1 levels regulate ER
function on model promoters, we tested TERP-1 modulation of its own and other physiological promoters. TERP-1 suppressed basal and E2-stimulated expression of its own promoter. TERP-1 suppression required the ERE regions of the promoter, and the dimerization domain of TERP-1. TERP-1 overexpression also suppressed E2 stimulation of the progesterone receptor and prolactin promoters. Thus, estrogens, androgen, and FSK can stimulate TERP-1 promoter activity, and increased TERP-1 expression modulates E2 stimulation of physiological promoters. These data suggest that TERP-1 regulation may play a significant role in modifying pituitary ER
responses.
 |
Introduction
|
|---|
E2 (17ß-ESTRADIOL) REGULATES gene expression in a number of target tissues and influences complex physiological events such as the coordinated release of pituitary hormones (1, 2). The actions of E2 require association with estrogen receptor (ERs)
or ß, ligand-dependent transcription factors that are members of the superfamily of steroid/nuclear receptors. The ERs are comprised of distinct functional domains with conserved amino acid sequences. Cell and/or promoter-specific ligand-independent gene activation via activation function (AF)-1 requires the amino terminus of the ERs, and DNA binding via two zinc fingers occurs through the central DNA-binding domain (2, 3, 4). The carboxyl terminus of the ER is required for ligand binding as well as ligand-dependent transcription via AF-2. Full ER bioactivity typically involves cooperative interactions between AF-1 and AF-2 (2, 3, 4, 5). Binding of E2 to its cognate receptors initiates conformational changes, receptor dimerization, and binding to specific DNA sequences called estrogen response elements (EREs), or interaction with tethered transcription factors binding to DNA of target gene promoters (6, 7). Finally, the displacement of corepressors from and recruitment of coactivators and integrator proteins to the receptor results in chromatin remodeling and stimulation of target gene transcription (8, 9).
Several ER mRNA splice variants have been identified, but in many cases these are poorly expressed as proteins and have uncertain physiological roles (10). We previously reported the cloning of a pituitary-specific E2-inducible isoform of ER
, truncated ER product-1, or TERP-1 (11). TERP-1 mRNA is composed of a unique 5'end fused to exons 58 of the full-length ER
and is translated as a 20- to 24-kDa protein (12, 13, 14). TERP-1 mRNA and protein expression in female rat pituitary is dramatically regulated by steroids and selective ER modulators, across the rat estrous cycle, and during pregnancy and lactation (12, 14, 15, 16, 17, 18). We and others have also demonstrated that TERP-1 mRNA and protein may be regulated by hormonal treatment of pituitary cell lines. For example, E2 simulates TERP-1 expression in GH3 somatolactotrope cells, RC4B cells that express prolactin and gonadotropins, LßT2 gonadotrope cells, or MMQ lactotrope cells (13, 17, 19). In addition, treatment of GH3 and RC4B cells with dihydroxytestosterone (DHT) and of GH3 and LßT2 cells with pituitary adenylate cyclase-activating peptide (PACAP) can significantly increase TERP-1 mRNA expression and protein expression, with little to no effect on ER
mRNA and protein (17).
Regulation of TERP-1 levels could have physiological significance because the relative ratios of TERP-1 to ER
modulate the ER
transcriptional response to E2 and to ligand-independent pathways such as cAMP in transient transfection assays (19, 20, 21, 22, 23). At high levels (TERP:ER
> 1:1), such as those that might occur at late proestrus, TERP-1 suppresses the activity of ERE-containing model promoters by forming heterodimers with reduced DNA binding ability (21, 22). High TERP-1 levels have also been reported to suppress activity of androgen-responsive model promoters and some viral promoters (22). At lower ratios, TERP-1 can stimulate the activity of model ERE-containing promoters by titration of ER
repressor proteins; this ability appears to be cell and promoter dependent (16, 20). Thus, the hormonal regulation of TERP-1 expression and ER
activity suggest that TERP-1 could play a role in altering pituitary sensitivity to E2 in various hormonal states and throughout the reproductive cycle.
In the rat, TERP-1 expression is driven by an intronic promoter located between exons 4 and 5 of the ER
gene (22). The TERP-1 promoter sequence contains several putative binding sites for pituitary-specific transcription factors such as Pit-1, and several potential binding sites for ER
. Examination of promoter activity in lactotrope cell lines revealed that a proximal palindromic ERE at 208 bp is required for E2 stimulation of the TERP-1 promoter, and this is enhanced by the pituitary-specific transcription factor Pit-1 (19).
We examined the TERP-1 promoter for hormonal regulation by physiological stimuli that alter TERP-1 mRNA and protein levels, including E2, androgens, and PACAP. We also tested the ability of TERP-1 levels to modulate its own and other physiologically relevant promoters. In these studies, we show that the TERP-1 promoter is regulated by E2, androgen, and the hypothalamic peptide PACAP. We demonstrate that the proximal palindromic ERE and half-site EREs are required for E2 but not androgen stimulation of the TERP-1 promoter, and that forskolin (FSK) stimulation requires an activator protein-1 (AP-1) site. Lastly, we show that TERP-1 protein can modulate E2 stimulation of the TERP-1 promoter as well as the prolactin and progesterone receptor promoters. These data suggest that TERP-1 can modify ER activity on E2-sensitive physiological promoters and could influence ER responses in the pituitary.
 |
Materials and Methods
|
|---|
TERP-1 promoter cloning and reporter constructs
Rat genomic DNA was prepared from liver as previously described, and the TERP-1 promoter was cloned by 5'RACE (rapid amplification of DNA 5'-ends) analysis (24, 25). An oligonucleotide primer corresponding to bases 731 of the cloned rat TERP-1-specific cDNA (i.e. TERP-3 = 5'-CTGGTTCGCTGTTCAACAAGCTCAAG-3' representing 5'-untranslated TERP-1 mRNA sequence) was synthesized and used as the 3'downstream primer for 5'-RACE with the AP-1 primer. 5'-RACE was performed on genomic DNA cut with EcoRI using a Marathon cDNA amplification kit (CLONTECH, Palo Alto, CA) with a mixture of 25 U/µl AmpliTaq polymerase (PerkinElmer, Foster City, CA) and 1.5 U/µl Pfu polymerase (Stratagene, La Jolla, CA). This yielded a single major band that was subcloned and sequenced to confirm its identity by comparison with the full-length rat TERP-1 promoter sequence, which lies between exons 4 and 5 of the rat ER
gene (22). Amplified clones were introduced into the Bluescript vector and analyzed for insert size and DNA sequence. An additional primer was synthesized to a region within the amplified genomic DNA, approximately 780 bp 5' to the sequence defined by the TERP-3 primer. This primer was then used in conjunction with the TERP-3 primer to amplify DNA directly from genomic DNA for comparison to the first genomic clones. Additional 3'RACE analysis was performed on EcoRI digests using a complement of the TERP-3 primer to anchor the 5' end and the AP-2 adaptor primer to anchor the 3' end. This resulted in 300 bp of sequence 3' to the TERP primer sequence. Primers against the TERP promoter were then designed and include: - 1) TERP1A (5'-CTGGTCGCTGTTCAACAAGCTCAAGAAATGG-3')
- 2) 1399 (5'-GACTTGCTATGTATCTCAGG-3')
- 3) 684 (5'-CAGTAACATAATGACACCATC-3')
- 4) 665 (5'-TCACTCTCTTGATTATTGG-3')
- 5) +217 (5'-CATCACATTACTTATCTTGG-3')
High-fidelity PCR yielded the following DNA fragments: 684/+31 bp, 665/+31 bp, 665/+217 bp, and 1399/503 bp. The PCR products were cloned into the pCR 2.1 vector (Invitrogen, Carlsbad, CA) at the EcoR1 restriction site, sequenced, then subcloned into pBluescript at the EcoR1 site. The promoter was excised from this plasmid with Kpn1 and BamH1 and cloned into pLucLINK, a promoterless luciferase expression vector, at Kpn1 and BamH1 restriction sites (24). To obtain the construct 1399/+217 bp, 1399/503 bp and 665/+217-bp fragments were each excised from the pBluescript using KpnI and BamHI and the products resolved on a 1.5% agarose gel. The TERP-1 promoter was extracted using a QIAGEN (Valencia, CA) gel extraction kit. Each promoter fragment was separately digested with BsmI, which has a restriction site at 513 bp, and resolved on a 1.5% agarose gel. The 1399/513-bp and 513/+217-bp fragments were extracted from the gel and ligated in the presence of T4 polymerase (Roche, Indianapolis, IN) for 4 h at 4 C. The reaction was continued overnight in the presence of pLucLINK that was previously digested with KpnI and BamHI. The resulting construct 1399/+217 was sequenced from both ends to confirm fidelity to the published sequence. Products were cloned into the pCR 2.1 vector and ultimately subcloned into pLucLINK as described above.
Block and single point mutations of the 208-bp palindromic ERE, and single point mutations of the 151-bp AP-1 site, 637-bp half-palindromic ERE (1/2 ERE), the 319-bp 1/2 ERE, the 94-bp Pit-1 site (94 Pit-1), the 134-bp Pit-1 site (134 Pit-1), and the 188-bp NZF-1 (neural zinc finger factor-1) site (188 NZF) were performed with site directed mutagenesis (QuikChange by Stratagene, La Jolla, CA) and with the following oligonucleotide primers and their reverse complements:
- 1) 208 ERE mutant 1 (5'-CTCTCTGTGTTCCAGTTCAAACTGAACTTTATAG-3')
- 2) 208 ERE mutant 2 (5'-GTGTTCCAGTTCAAACTCAACTTTATAGAGAG-3')
- 3) 319 1/2 ERE (5'-CTCTCTTGATTATTGAATCAATGTCAAGGGCTG-3')
- 4) 637 1/2 ERE (5'CCTAGAGAGACCCTGACCTGAAAAAAAAATGAATACTGGG-3')
- 5) 151 AP-1 (5'-CCTAGAGAGACCCTGACATAAAAAAAAAAATGAATAC TTGGG-3')
- 6) 188 NZF-1 (5'-CTGAACTTTATAGAGAGCCCCAGGCCATCCTGGC-3')
- 7) 96 Pit-1 (5'GGATTTACTTTTAATCTTCAAATCTTGATGCCTTTTCAAAC ATTCTTTGTTTAGGTAAAG-3')
- 8) 134-Pit-1 (5'-GACCCTGACTCAAAAAAAAAATGCCTACTTGGGATTTACT TTTAATCTTCAA-3')
Bold underlined letters indicate base changes made. All mutations were made in the context of the 684/+31-bp proximal TERP promoter, and in addition to single mutations included multiple ERE mutations at: 208 palindromic ERE/ 319 1/2 ERE (m208/319), 208 palindromic ERE/ 637 1/2 ERE (m208/639), and 319 1/2 ERE/ 637 1/2 ERE (m319/637), where the letter m indicates the site of the mutations.
Cell lines and transfection analysis
GH3 somatolactotrope cells were maintained in DMEM supplemented with 10% fetal bovine sera and 100 U/ml penicillin, 100 µg/ml streptomycin at 37 C in 95% O2/5% CO2. Serum and media were obtained form Mediatech, Inc. (Herndon, VA). For transfection experiments, cells were plated in 12-well (22-mm in diameter) plates and grown until 6080% confluent. On the day of the experiment, media were replaced with phenol red-free DMEM supplemented with 5% charcoal-stripped newborn calf serum and 100 U/ml penicillin, 100 µg/ml streptomycin. TERP-1 promoter luciferase constructs (1 µg) were transfected into GH3 cells using Fugene 6 Transfection Reagent (Roche, Indianapolis, IN), according to manufacturers instructions. After the 16-h transfection period, media were changed and cells were treated with either ethanol vehicle control, E2 (10 nM),100 nM propyl-pyrazole-triol (PPT), 1 µM ICI 182,780, 4-hydroxytamoxifen (TAM), or genistein (G), 10 nM dihyrotestosterone (DHT), 1 µM progesterone,1 µM FSK or 100 nM PACAP, and incubated at 37 C for an additional 24 h. All compounds were solubilized in ethanol, which was added as the vehicle control. After treatment, cells were washed twice with PBS (pH 7.4) and collected in 5x Lysis buffer (Promega Corp., Madison, WI) for luciferase assays. Luciferase assays of the lysate samples were performed with a Turner TD-20E luminometer and protein content was determined by the total lysate protein using protein dye (Bio-Rad Laboratories, Inc., Richmond, CA). All steroids, peptides and drugs were obtained from Sigma Chemical Co. (St. Louis, MO), with the exception of the pure antiestrogen ICI 182,780 and the selective ER
agonist PPT, which were obtained from Tocris Cookson Ltd. (Avonmouth, UK).
GH3 cells were transfected with 1 µg 684/+31-bp TERP-1 promoter luciferase construct, and 100 ng, 1 or 4 µg cytomegalovirus (CMV) TERP using Fugene 6. Promoter activity was also examined in the presence of a mutant form of TERP-1, TERP L509R (CMV TERPL509R), which contains a mutated dimerization domain (16), to examine the mechanism of TERP-1 regulation of its promoter. Total DNA transfected was normalized with pcDNA 3.1 vector (Invitrogen). Cells were transfected for 24 h and treated for an additional 24 h with 10 nM E2 or vehicle. Cells were collected and assayed as above.
To test for effects of increasing TERP-1 levels on TERP-1 or other physiological promoter expression, the CMV TERP-1 expression vector, consisting of the rat TERP-1 cDNA cloned into pcDNA3.1, was cotransfected (100 ng or 1 or 4 µg) into cells along with 1 µg of the TERP-1 promoter, a rat progesterone receptor promoter construct PRd-ERE3, containing the distal promoter (131 to +65 bp) fused to the estrogen-responsive region of the proximal promoter (+615 to +637 bp) (Refs.26 and 27 ; kind gift of Dr. Benita Katzenellenbogen, University of Illinois, Urbana, IL) or the rat prolactin promoter from 2.5 kb to +39 bp (Ref.28 ; kind gift from Dr. Richard N. Day, University of Virginia) contained in luciferase reporters. Total DNA transfected was normalized with pcDNA 3.1. Cells were transfected for 24 h then treated for 24 h with 10 nM E2 or vehicle for all promoters tested. All experiments were performed a minimum of three times with triplicate samples per group.
EMSAs
The binding of ER
to putative regulatory regions of the TERP-1 promoter was assessed by nonradioactive EMSAs. Double-stranded oligonucleotides corresponding to the 208-bp palindromic ERE, the 319-bp half-site ERE, and 637-bp half-site ERE, were designed and include:
- 208 ERE (5-CTCTCTGTGTGTTCCAGGTCAAACTGAACTTTATAG-3');
- 637 1/2 ERE (5'CTCTCTTGATTATTGGGTCAATGTCAAGGGCTG-3')
- 319 1/2 ERE (5'ATTTTGAGATTCTTTGGGTCACTTCCCAATTTAT-3').
Five picomoles of each oligonucleotide were labeled at the 3' end with biotinylated ribonucleotides (Biotin 3' End DNA Labeling Kit; Pierce, Rockford, IL). Oligonucleotides containing identical mutations to those made in the TERP-1 promoter for transfection assays, described above, were also made. Complementary oligonucleotides were labeled individually, then annealed. Nuclear proteins were isolated from GH3 cells. Approximately 6.0 µg of nuclear protein were incubated with 10 nM biotinylated probe for wild-type or mutant oligonucleotides in buffer, in the absence or presence of C1355 (12), a C-terminal ER
antibody to verify the presence of ER
in DNA protein complexes (21), or approximately 100-fold unlabeled competitor nucleotide. Complexes were analyzed on 6% polyacrylamide gels containing 0.5x TBE, and subjected to electrophoresis in 0.5x TBE at 4 C for 1.5 h. After electrophoresis, complexes were transferred to Biodyne membrane (Pierce), and labeled DNA was detected using the Streptavidin-Horseradish Peroxidase conjugate and chemiluminescent substrate (Lightshift Chemiluminescent EMSA Kit; Pierce).
RT-PCR
GH3 cells were plated in 5% newborn calf serum-DMEM at a density of 8 x 106 cells/100-mm cell culture dish (Corning Glass, Corning, NY). Cells were treated with vehicle, E2, DHT, or FSK, in the absence or presence of ICI 182,780 (1 µM). After 48 h of treatment, total RNA was extracted from these cells using the RNeasy Mini Kit (QIAGEN), and levels of TERP-1 mRNA were measured and normalized for levels of RPL19. PCR primer sequences, the expected product sizes, and the conditions for RT-PCR were previously determined and described (17). After PCR, 8 µl of each reaction were separated on 1% agarose gels containing ethidium bromide (0.7 µg/ml). Gels were photographed and analyzed with ImageQuant software (Molecular Dynamics, Inc., Sunnyvale, CA).
Statistical analysis
Values are expressed as mean ± SEM. Each experiment was performed a minimum of three times and treatment groups within each transfection were composed of three to six replicates. Statistical significance was determined one-way ANOVA using GraphPad Prism version 4.00 for Windows (GraphPad Software, San Diego, CA). The Tukeys post hoc test was used to determine significant differences between the means, and differences were considered to be significant at P < 0.05.
 |
Results
|
|---|
The TERP-1 promoter is stimulated by ER ligands, androgen, and PACAP
We first tested basal expression of several TERP-1 promoter constructs in GH3 cells. TERP-1 promoter constructs containing + 31 bp at the 3'end include the TERP-1-specific 5' mRNA sequence, but no additional regulatory sequences (Fig. 1A
). Promoter constructs containing 217 bp at the 3' end includes additional Pit-1 binding sites and an mRNA splice site, which stimulates promoter expression in some cases (29, 30). All TERP promoter constructs tested had basal activity significantly above that of control luciferase vector alone, with the construct containing 684/+31 bp of TERP-1 promoter sequence exhibiting the highest basal activity. Deletion of sequences between 1399 and 684 bp resulted in increased basal expression, suggesting that repressor sequences were lost. Deletion of just 19 bp from the 5' end of the 684/+31-bp construct to 665 bp decreased basal expression, and the inclusion of 217 bp vs. 31 bp of 3' sequence did not alter promoter activity. Subsequent transfection studies used the 684/+31 bp TERP-1 promoter construct to test hormonal responsiveness.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 1. The TERP-1 promoter is stimulated by estrogens, PACAP, and androgen. A, TERP-1 promoter regions were cloned into a promoterless luciferase vector (pLucLink). GH3 cells were transiently transfected with 1.0 µg of relevant TERP-1 promoter constructs. After collection of cell lysate, luciferase and protein assays were performed to determine promoter activity. Data are expressed as normalized luciferase activity and the mean ± SEM for three experiments with three samples per group in each experiment. B, GH3 cells were transfected with 1.0 µg of the 684/+31-bp TERP-1 promoter. After transfection for 16 h, cells were treated with ethanol vehicle, 10 nM E2 or DHT, 100 nM PACAP or PPT, and 1 µM ICI 182,780 (ICI), TAM, genistein (GEN) progesterone (P), or FSK for 24 h. Cell lysate was collected, luciferase and protein assays were performed to determine promoter activity. Values represent the mean ± SEM of three experiments with three samples per group. *, P < 0.01 compared with vehicle-treated control. ALU, Arbitrary light units.
|
|
We previously demonstrated that TERP-1 mRNA is regulated by several hormones, including E2, androgens, and PACAP (17), and we tested the ability of the TERP-1 promoter to respond to these stimuli (Fig. 1B
). Promoter activity was stimulated by several compounds thought to act through the ER, including E2 (2.4-fold), the ER
agonist PPT (4.2-fold), and the phytoestrogen genistein (G, 4.9-fold), but not by TAM. TERP-1 promoter activity was also stimulated 2.7-fold by the androgen DHT; however, treatment with progesterone had no effect on promoter activity. TERP-1 promoter regulation was not limited to steroids because the hypothalamic peptide PACAP and the adenylate cyclase-stimulating compound FSK also stimulated promoter activity 2.2- and 2.7-fold, respectively.
The palindromic ERE and half-site EREs cooperate for E2 stimulation of the TERP-1 promoter
The TERP-1 promoter contains several putative regulatory elements, including those for AP-1, the pituitary-specific transcription factor Pit-1, NZF-1, a palindromic ERE at 208 bp, and several putative ER binding half-sites (Fig. 2A
). Because E2 has dramatic effects on expression of TERP-1 mRNA and protein, we examined potential ER binding sites within the context of the 684/+31-bp promoter for effects on E2 stimulation. Single or double mutations were made in the ERE, and block mutations were made in the proximal 319 and 637-bp half-site EREs, in the AP-1 site at 151 bp, the NZF1- site at 188 bp, and in Pit-1 sites at 96 and 134 bp. These mutated constructs were compared with the intact promoter in transient transfection assays in GH3 cells (Fig. 2B
). The intact 684/+31-bp promoter was stimulated 3.0-fold by E2. A one-base mutation in the palindromic ERE did not decrease basal promoter activity compared with the intact promoter, and only slightly diminished E2 stimulation, to 2.2-fold. Introduction of two point mutations in the palindromic ERE, or block mutations in either ERE half-site, the AP-1 site, or either Pit-1 site significantly reduced basal activity by 5080%, whereas mutations in the NZF-1 site had no effect. Interestingly, mutation of two bases in the palindromic ERE, or in either or both putative half-site EREs completely obliterated the E2 stimulation of the TERP-1 promoter. In contrast, mutation of either the AP-1 or NZF-1 sites did not suppress E2 stimulation (3.2-fold) of the promoter, and mutation of either Pit-1 site diminished stimulation only slightly to 2-fold.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 2. The proximal palindromic and half-site EREs mediate E2 sensitivity of the TERP-1 promoter. A, Depiction of the 684/+31-bp TERP-1 promoter and potential regulatory elements and the relevant transcription factor binding sites. The dark box represents the 5' region of TERP-1 mRNA. B, GH3 cells were transiently transfected with 1.0 µg wild-type 684?+31-bpTERP-1 promoter construct, or 1.0 µg of the promoter construct containing mutations in the 188 NZF-1 site, the 96- or 134-bp Pit-1 sites, one or two mutations in the 208 palindromic ERE, or block mutations in the 319 or the 637 half-site EREs, or in the 151 AP-1 site Transcriptional activity was assessed after 24 h treatment with ethanol vehicle or 10 nM E2. Normalized luciferase activity is shown. Values represent mean ± SEM of three experiments. *, P < 0.01 for E2 compared with ethanol vehicle activity in each group. a, P < 0.05 for basal activity of the mutated constructs compared with that of intact 684/+31 TERP-1 promoter. ALU, Arbitrary light units.
|
|
ER
binds the TERP-1 promoter at the palindromic ERE and half-site EREs
Because basal and E2-stimulated expression of the TERP-1 promoter requires both half-site EREs and the palindromic ERE, we tested these regions for ER
binding. Gel shift assays were performed with biotinylated oligonucleotides corresponding to the wild-type and mutated 208-bp palindromic ERE and half-site EREs at 319 and 637 bp, and nuclear protein from GH3 cells (Fig. 3
). ER
binding was observed on all three wild-type, but not mutated, DNA regions. The presence of ER
was verified by supershifting specific complexes with C1355, a C-terminal ER
antibody (ER-Ab) (12) but not preimmune normal rabbit serum. Binding at the palindromic ERE and both ERE half-sites was specific because binding was eliminated in the presence of excess unlabeled wild-type, but not mutated, oligonucleotide. These data indicate that ER
can bind the TERP-1 promoter at all three sites required for E2 stimulation of the promoter.
DHT and FSK stimulation of TERP-1 promoter activity do not require ER
or the ERE regions
Because PACAP and FSK have been shown to activate ER
transcriptional activity in pituitary cells (23), and androgen receptor may also form heterodimers with ER under some conditions (31), we tested whether the DHT and FSK responses required ER or the ERE regions. Treatment of transfected cells with the pure antiestrogen ICI 182,780 obliterated the response of the 681/+31-bp TERP-1 promoter to E2 and the phytoestrogen genistein (G) but did not reduce promoter stimulation by DHT or FSK (Fig. 4A
). Thus, the estrogenic compounds require ER for the biological response, and androgen and FSK do not.

View larger version (34K):
[in this window]
[in a new window]
|
FIG. 4. TERP-1 promoter stimulation by DHT and FSK is not mediated by ER. A, GH3 cells were transfected with 1.0 µg of the 684/+31-bp TERP-1 promoter construct. After transfection for 16 h, cells were treated for 24 h with vehicle ± 1 µM ICI 182,780 (ICI), 10 nM E2 (E) ± 1 µM ICI, 1 µM FSK ± 1 µM ICI, or 1 µM genistein (G) ± 1 µM ICI. After 24 h, cells were collected and assayed. Shown is a representative experiment in which transfections were performed in triplicate. *, P < 0.01 compared with vehicle-treated cells. B, The proximal palindromic and half-site EREs mediate E2 sensitivity of the 684/+31-bp TERP-1 promoter construct. GH3 cells were transiently transfected with 1.0 µg wild-type TERP-1 promoter construct, or 1.0 µg TERP-1 promoter containing the following mutations: two mutations in the 208 palindromic ERE, mutation in the 319-bp half-site ERE, mutation in the 637-bp ERE, and mutation in the 151-bp AP-1 site. After transfection, cells were treated with ethanol vehicle (V), 10 nM E2 (E) or DHT, or1 µM genistein (G), or FSK for 24 h. Shown is a representative experiment in which transfections were performed in triplicate. Values represent mean ± SEM. *, P < 0.01, treatment compared with vehicle-treated cells in each group. ALU, Arbitrary light units.
|
|
To determine whether DHT or FSK required any of the defined ERE regions for their biological response, we tested the intact 684/+31-bp TERP-1 promoter luciferase construct, as well as promoter constructs mutated at the palindromic or half-site EREs or AP-1 site (Fig. 4B
). E2 and genistein stimulation required all three previously defined response elements, including the palindromic ERE, and both ERE half-sites at 637 and 319 bp, and mutations in any of the three regions also decreased basal promoter activity. DHT stimulation was not affected by mutation of any of the ERE regions or the AP1 site. FSK stimulation was not affected by mutation of any E2-sensitive region; however, it was eliminated when the AP-1 site was mutated. In support of these data, we measured levels of endogenous TERP-1 mRNA with these treatments in the absence or presence of the antiestrogen ICI 182,370 (Table 1
). We found that E2, DHT, and FSK treatment all stimulated endogenous levels of TERP-1 mRNA, but only E2 stimulation was suppressed in the presence of antiestrogen. Thus, stimulation of the promoter by androgens and FSK does not require any E2-sensitive promoter region, or ER.
TERP-1 protein regulates TERP-1 promoter activity via dimerization with ER
Because TERP-1 can have both stimulatory and suppressive effects on model ERE reporters, depending on the relative TERP-1:ER
ratio (20), and the TERP promoter contains binding sites that mediate E2 sensitivity, we investigated the ability of TERP to regulate activity of its own promoter. GH3 cells were transfected with the E2-responsive TERP-1 promoter construct in the absence or presence of a TERP-1 expression vector (Fig. 5
). Transfection of exogenous TERP-1 at several concentrations (100 ng, 1 or 4 µg) reduced basal activity and E2-stimulation of the TERP-1 promoter. We previously demonstrated that TERP-1 forms inactive heterodimers with ER
(21). Thus, TERP-1s ability to suppress the activity of its own promoter may involve sequestration of ER
. To test this, GH3 cells were also transfected with the 684/+31-bp TERP-1 promoter luciferase construct in the presence or absence of TERP L505R, a dimerization mutant of TERP-1 (16) (Fig. 5
). The TERP-1 promoter was not suppressed by transfection of increasing levels of TERP L509R, in contrast to effects observed with the addition of wild-type TERP-1. In fact, overexpression of TERP L509R increased basal promoter activity in a dose-dependent manner. This agrees with previous data on TERP-1 regulation of model promoters because the TERP L509R mutant can titrate suppressor proteins away from ER
(16). Overall, the data suggest that dimerization is required for the suppressive effects of TERP-1 on its own promoter.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5. Autoregulation of the TERP-1 promoter requires dimerization of the TERP-1 protein. GH3 cells were transiently transfected with 1 µg of the 684/+31-bp TERP-1 promoter construct in the absence or presence of transfected wild-type TERP-1 (CMV-TERP) or dimerization mutant of TERP-1 (CMV-L509R) expression vector at 100 ng, 1 µg, or 4 µg. Total transfected DNA was normalized with pcDNA 3.1. Cells were treated with 10 nM E2 for 24 h. Cell lysate was collected and assayed for protein levels and luciferase activity. Values represent mean ± SEM for three experiments with triplicate samples per group. *, P < 0.01, E2 compared with ethanol vehicle-treated cells in the same group. a, P < 0.01, compared with basal activity of the TERP-1 promoter alone. ALU, Arbitrary light units.
|
|
Autoregulation of the TERP-1 promoter requires the ERE regions
Mutational analysis was used to determine whether the E2-sensitive regions in the TERP-1 promoter were the sites of TERP-1 autoregulation. GH3 cells were transfected with the 684/+31-bp TERP-1 luciferase construct containing mutations in the palindromic ERE and half-site EREs with or without cotransfection of TERP-1 protein (Fig. 6
). Compared with intact TERP-1 promoter, promoter constructs containing mutations in the palindromic ERE or either half-site ERE had lower basal expression and E2 responses. Increasing amounts of TERP protein did not further suppress the activity of the mutated constructs. These data suggest that the palindromic ERE and the half-site EREs at 637 and 319 bp are sites of TERP-1 promoter autoregulation.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6. Autoregulation of the TERP-1 promoter is regulated through EREs. GH3 cells were transiently transfected with wild-type or mutated 684 + 31-bp TERP-1 promoter constructs ± 4 µg CMV-TERP expression vector. After 24 h E2 (10 nM) treatment, cell lysate was collected and assayed for protein levels and luciferase activity. Data represent the mean ± SEM for three experiments with triplicate samples. *, P < 0.01, compared with vehicle-treated cells in the same group. ALU, Arbitrary light units.
|
|
TERP-1 regulates the E2-sensitive rat prolactin and progesterone receptor promoters
Because TERP-1 can regulate the E2 stimulation of its own promoter, we investigated the ability of TERP-1 to modulate other relevant E2-sensitive physiological promoters with complex E2-responsive regions. We first examined the rat prolactin promoter (Fig. 7A
), which is stimulated by E2 through a mechanism requiring a nonconsensus palindromic ERE and Pit-1 (28). In cotransfection experiments, TERP-1 slightly enhanced the basal and the E2-stimulated activity of the promoter at low concentrations (100 ng), but higher concentrations of TERP-1 (1 or 4 µg) completely suppressed E2-stimulated prolactin promoter activity. As observed with the TERP-1 promoter, overexpression of the dimerization mutant of TERP-1 failed to suppress, and even enhanced, overall basal and E2-stimulated PRL promoter activity. GH3 cells were also transfected with an E2-sensitive (26, 27) rat progesterone receptor promoter construct in the absence or presence of expression vectors for the wild-type or dimerization mutant of TERP-1 (Fig. 7B
). Wild-type, but not the dimerization mutant of TERP-1, decreased the E2 response of the PR promoter in a dose-dependent manner, without altering basal promoter activity. Thus, TERP-1 can modulate the E2 stimulation of several complex physiological promoters with at variety of E2-responsive regulatory elements and may play a role in regulating pituitary sensitivity to E2.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7. TERP-1 expression regulates E2 stimulation of the rat prolactin and progesterone receptor promoters. A, GH3 cells were transiently transfected with 0.5 µg of the rat prolactin promoter-luciferase construct (PRL) in the absence or presence of 100 ng or 1 or 4 µg of cotransfected expression vector for the wild-type TERP-1 (CMV-TERP) or the TERP-1 dimerization mutant, TERP- L509R (CMV-L509R). Cells were treated with 10 nM E2 for 24 h. Cell lysate was collected and assayed for protein levels and luciferase activity. Data shown are the mean ± SEM for three experiments with triplicate samples per group. Values represent mean ± SEM. *, P < 0.01, E2 compared with vehicle-treated cells in the same group. a, P < 0.01, compared with basal activity of the PRL promoter construct alone. B, GH3 cells were transiently transfected with 0.5 µg rat progesterone receptor promoter-luciferase construct (PR) in the absence or presence of 100 ng or 1 or 4 µg of cotransfected expression vector for the wild-type TERP-1 (CMV-TERP) or the TERP-1 dimerization mutant, TERP-L509R (CMV-L509R). Cells were treated with 10 nM E2 for 24 h. Data shown are the mean ± SEM for three experiments with triplicate samples per group. *, P < 0.01, E2 compared with vehicle-treated cells in the same group. a, P < 0.01, compared with basal activity of the progesterone receptor promoter construct alone. ALU, Arbitrary light units.
|
|
 |
Discussion
|
|---|
E2 regulates many pituitary functions, including expression and secretion of the gonadotropins and PRL, and cell proliferation. One component contributing to the varied and cell-specific actions of E2 is the regulated expression of the receptors that mediate these biological functions. The cloning of the E2-regulated rat truncated ER
isoform, TERP-1, from female pituitary tissue and the finding that TERP-1 can modify ER
and ERß activity, provides another potential level of complexity to E2 pituitary actions (11, 12, 13, 14, 15, 16). TERP-1 is transcribed from an intronic promoter within the rat ER
gene (19), and the mRNA is expressed primarily if not exclusively in pituitary cells, and particularly in lactotropes (12, 13, 14, 15). We examined TERP-1 promoter expression and hormonal regulation in GH3 rat somatolactotrope cells, and found that regulation occurs through several distinct hormonal signals and gene regulatory elements. Furthermore, TERP-1 protein expression can regulate E2 stimulation of the TERP-1 promoter itself, as well as of other physiological promoters.
The sequence of the rat TERP-1 promoter contains several putative regulatory elements that could govern basal expression and hormonal responsiveness, in addition to cell- and tissue-specific expression of the gene (22). We used deletion and mutational analysis to characterize the role of several promoter regions on TERP-1 basal and hormone-regulated promoter activity. Removal of the region between 1399 to 684 bp stimulated promoter expression, suggesting that this region contained suppressive regulatory elements. Basal expression and E2 stimulation of the TERP-1 promoter was most robust in the promoter construct spanning 684/+31 bp, and stimulation by several hormones correlated with TERP-1 mRNA responses previously measured in these cells (17). Thus, this construct was used in subsequent experiments. A significant decrease in basal expression resulted from deletion of just 19 bp (from 684 to 665 bp) from the 5' end of the promoter. Analysis of the DNA sequence identified a putative Oct-1 binding site at 680 bp. Oct-1, like other POU domain proteins such as Pit-1, may act alone or in concert with nuclear receptors such as ER
to stimulate basal expression or enhance E2-stimulated expression (17, 32, 33). However, binding of Oct-1 or similar proteins to this region has not been demonstrated. Schausi et al. (19) previously showed that Pit-1 sites were important for both promoter basal expression and E2 stimulation through the palindromic ERE, and that ER could associate with Pit-1 in EMSA gel shift assays on an oligonucleotide containing the 98/82-bp Pit-1 binding site. Within the context of the 684/+31-bp TERP-1 promoter, our mutation studies showed that several putative or demonstrated transcription factor binding sites, including Pit-1 sites at 96 and 134 bp, ERE half-sites at 319 and 637 bp, the palindromic ERE, and the AP-1 site, all influence basal promoter expression. Our data demonstrate that, in GH3 cells, several hormones and ER ligands stimulate the novel ER
intronic TERP-1 promoter. These include E2, the synthetic ER
agonist PPT, genistein, DHT, the hypothalamic peptide PACAP, and FSK. These results are in agreement with previous work demonstrating that E2, DHT, and PACAP all stimulate expression of TERP-1 mRNA in GH3 cells, whereas progesterone does not (13, 17). Similarly, E2, T, and selective ER modulators, but not progesterone, have been shown to stimulate TERP-1 mRNA in rodent pituitaries (12, 17, 18, 34).
Based on the ability of the pure antiestrogen ICI 182,780 to suppress stimulated TERP-1 promoter activity or mRNA levels, E2, PPT, and genistein act through the ER, whereas DHT and FSK do not. Furthermore, only the estrogenic compounds require the identified EREs for promoter stimulation. A previous study in female rats reported that E2 and the pure ER
agonist PPT stimulated TERP-1 mRNA expression equally well, whereas the ERß agonist DPN only partially stimulated TERP-1 mRNA levels (18). Studies performed in mice with gene disruptions of either ER
or ERß suggest that only ER
plays a significant role in TERP-1 mRNA stimulation (34). Our data with PPT and genistein, a phytoestrogen that is proposed to act primarily via ERß (35), suggest that in the rat somatolactotrope GH3 cell line, both ER
and ERß may be capable of stimulating TERP-1 expression. The difference in the sensitivity to ERß agonists may reflect the relative differential expression of ER
and ERß between the cell lines, mice, and rat pituitaries (34, 36, 37), with relatively little ERß expression in mouse pituitary. Alternatively, the concentration of genistein used may also partially stimulate ER
in GH3 cells.
Both our data and previous work show that the palindromic ERE at 208 bp is critical for E2 stimulation of the TERP-1 promoter (19, 22). However, E2 stimulation of several genes, including prothymosin (38), cathepsin D (39), ovalbumin (40), NHE-RF/EBP50 (41), and the progesterone receptor (26, 27, 42), occurs not just via palindromic EREs but also through half-site EREs, often in combination with other transcription factors. Therefore, we questioned whether the palindromic ERE acted alone, or in conjunction with two proximal ERE half-sites, to mediate E2 sensitivity of the TERP-1 promoter. Within the context of the 684/+31-bp TERP-1 promoter, mutations in the palindromic ERE, and ERE half-sites at 319 and 637 bp each significantly reduced basal promoter activity and eliminated E2 stimulation, suggesting cooperation between the EREs. Previous studies to evaluate the contribution of palindromic and half-site EREs to TERP-1 promoter E2 stimulation deleted these sites, rather than mutating the ERE half-sites in context of the intact promoter (19), and thus potential cooperativity between these regions was lost. Deletion of the promoter region containing half-site EREs permitted E2 stimulation of the palindromic ERE, although the fold-stimulation was somewhat less (19). ER binding to the half-site EREs was not tested previously. Overall, these data suggest that multiple E2-sensitive elements, including the ERE half-sites, cooperate for E2 stimulation of the TERP-1 promoter, as has been observed for other genes such as prothymosin and NHE-RF/EBP50 (38, 41).
Stimulation of the TERP-1 promoter by DHT does not occur through the ER because it is not suppressed by antiestrogen, and does not require ER binding sites on the promoter. This agrees with data in ER
and ERß gene-disrupted mice, in which testosterone still stimulates TERP-1 mRNA in the absence of E2 stimulation (34). DHT is likely acting at least partly through androgen receptors, which are present in numerous rodent pituitary cells and can directly modulate pituitary hormone secretion and expression (42, 43, 44, 45). The absence of a canonical androgen response element (ARE) in the TERP-1 promoter suggests that androgens and AR may be acting through protein-protein interactions, rather than by direct binding to DNA. Mutation of the AP-1 or ERE sites does not suppress DHT stimulation of TERP-1 mRNA. However, the AR can bind to and influence transcription through other tethered transcription factors such as Sp1 (45), and may act via other proteins, or by binding to a nonconsensus ARE. The role of TERP-1 in androgen action is unclear. However, TERP-1 has been demonstrated to suppress androgen and AR stimulation of a model ARE reporter in transient transfection assays and may perhaps serve to limit AR actions when testosterone or DHT levels are high (22).
Pituitary-specific TERP-1 mRNA expression is regulated across the estrous cycle and by pregnancy in rats and could be influenced by both steroid and hypothalamic factors (12, 14, 15). We found that the TERP-1 promoter can be stimulated not only by steroids, but also by the hypothalamic peptide PACAP, and by the adenylate cyclase activator FSK. FSK effects do not require ER, and occur through the AP-1 site. High levels of TERP-1 protein can suppress E2 stimulation of its own promoter, as well as the physiologically relevant promoters for rat PRL and progesterone receptor. Lactotrope cells are unique from other pituitary cells in that they exhibit an alteration in cell proliferation rate throughout the estrous cycle, and chronic E2 treatment suppresses diurnal proliferation patterns (46). In addition, the progesterone receptor response to E2 is blunted at proestrus in lactotropes (47). High levels of TERP-1 expression have been found in isolated lactotropes (15), and our results in the somatolactotrope GH3 cells suggests that high expression of TERP-1 might modulate E2 stimulation of physiological promoters in these cells and perhaps influence cell function. TERP-1 protein levels are also highly regulated through the estrous cycle, rising to levels 3- to 4-fold higher than ER
by late proestrus (15, 16). The resulting increased TERP-1:ER
protein ratio could thus play a role in regulating ER
activity. For example, TERP-1 might play a role in regulating lactotrope cell function, perhaps by limiting E2 stimulation of relevant promoters such as prolactin and progesterone receptor. Changes in ratios between such regulatory molecules as TERP-1, ER
, and nuclear receptor coactivators and corepressors as their expression changes with hormonal and physiological status could thus play a significant role in regulating pituitary responsiveness to E2 (16, 48).
 |
Footnotes
|
|---|
We gratefully acknowledge support from the National Institutes of Health (NIH) (R01-DK57082 to M.A.S, and T32-DK07646 and F32-DK062634 to W.M.B.). We also acknowledge the Core laboratories of the Center for the Study of Reproduction at the University of Virginia supported by the National Institute of Child Health and Human Development/NIH cooperative agreement [U54 HD28934] as part of the Specialized Cooperative Centers Program in Reproductive Research.
Current address for W.M.B.: Department of Biology, University of Wisconsin-Eau Claire, P.O. Box 4004, Eau Claire, Wisconsin 54702.
First Published Online October 6, 2005
Abbreviations: AP-1, Activator protein-1; ARE, androgen response element; CMV, cytomegalovirus; DHT, dihydroxytestosterone; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen response element; ; FSK, forskolin; NZF-1, neural zinc finger factor-1; PACAP, pituitary adenylate cyclase-activating peptide; Pit-1, pituitary-specific transcription factor; PPT, propyl-pyrazole-triol; RACE, rapid amplification of DNA 5'-ends; TAM, 4-hydroxytamoxifen.
Received August 17, 2005.
Accepted for publication September 29, 2005.
 |
References
|
|---|
- Couse JF, Korach KS 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20:358417[Abstract/Free Full Text]
- Nilsson S, Makela S, Treuter E, Tujague M, Thonsen J, Andersson G, Enmark E, Pettersson K, Warner M, Gustafsson J-A 2001 Mechanisms of estrogen action. Physiol Rev 81:15351565[Abstract/Free Full Text]
- Brzozowski AM, Pike AC, Dauter Z, Hubbard RE, Bonn T, Engstrom O, Ohman L, Greene GL, Gustafsson JA Carlquist M 1997 Molecular basis of agonism and antagonism in the oestrogen receptor. Nature 389:753758[CrossRef][Medline]
- El Tanani MK, Green CD 1997 Two separate mechanisms for ligand-independent activation of the estrogen receptor. Mol Endocrinol 11:928937[Abstract/Free Full Text]
- OLone R, Frith MC, Karlsson EK, Hansen U 2004 Genomic targets of nuclear estrogen receptors. Mol Endocrinol 18:18591875[Abstract/Free Full Text]
- Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson J, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER
and ERß at AP1 sites. Science 277:15081510[Abstract/Free Full Text] - Katzenellenbogen JA, Katzenellenbogen BS 1996 Nuclear hormone receptors: ligand-activated regulators of transcription and diverse cell responses. Chem Biol 3:529536[CrossRef][Medline]
- McKenna NJ, Lanz RB, OMalley BW 1999 Nuclear receptor coregulators: cellular and molecular biology. Endocr Rev 20:321344[Abstract/Free Full Text]
- Heinzel T, Lavinsky RM, Mullen TM, Soderstrom M, Laherty CD, Torchia J, Yang WM, Brard G, Ngo SD, Davie JR, Seto E, Eisenman RN, Rose DW, Glass CK, Rosenfeld MG 1997 A complex containing N-CoR, mSin3 and histone deacetylase mediates transcriptional repression. Nature 387:4348[CrossRef][Medline]
- Shupnik MA 2002 Oestrogen receptors, receptor variants and oestrogen actions in the hypothalamic-pituitary axis. J Neuroendocrinol 14:8594[CrossRef][Medline]
- Friend KE, Ang LW, Shupnik MA 1995 Estrogen regulates the expression of several different estrogen receptor mRNA isoforms in rat pituitary. Proc Natl Acad Sci USA 92:43674371[Abstract/Free Full Text]
- Friend KE, Resnick EM, Ang LW, Shupnik MA 1997 Specific modulation of estrogen receptor mRNA isoforms in rat pituitary throughout the estrous cycle and in response to steroid hormones. Mol Cell Endocrinol 131:147155[CrossRef][Medline]
- Mitchner NA, Garlick C, Steinmetz RW, Ben-Jonathan N 1999 Differential regulation and action of estrogen receptors
and ß in GH3 cells. Endocrinology 140:26512658[Abstract/Free Full Text] - Vaillant C, Chesnel F, Schausi D, Tiffoche C, Thieulant ML 2002 Expression of estrogen receptor subtypes in rat pituitary gland during pregnancy and lactation. Endocrinology 143:42494258[Abstract/Free Full Text]
- Demay F, Tiffoche C, Thieulant M-L 1996 Sex- and cell specific expression of an estrogen receptor isoform in the pituitary gland. Neuroendocrinology 63:522529[Medline]
- Lin VY, Resnick EM, Shupnik MA 2003 Truncated estrogen receptor product-1 stimulates estrogen receptor
transcriptional activity by titration of repressor proteins. J Biol Chem 278:3812538131[Abstract/Free Full Text] - Schreihofer DA, Stoler MH, Shupnik MA 2000 Differential expression and regulation of estrogen receptors (ERs) in rat pituitary and cell lines: estrogen decreases ER
protein and estrogen responsiveness. Endocrinology 141:21742184[Abstract/Free Full Text] - Tena-Sempere M, Navarro VM, Mayen A, Bellido C, Sancez-Criado JE 2003 Regulation of estrogen receptor (ER) isoform messenger RNA expression by different ER ligands in female rat pituitary. Biol Reprod 70:671678
- Schausi D, Tiffoche C, Thieulant M-L 2003 Regulation of the intronic promoter of rat estrogen receptor
gene, responsible for truncated estrogen receptor product-1 expression. Endocrinology 144:28452855[Abstract/Free Full Text] - Schreihofer DA, Resnick EM, Soh AY, Shupnik MA 1999 Transcriptional regulation by a naturally occurring truncated rat estrogen receptor (ER), truncated ER product-1 (TERP-1). Mol Endocrinol 13:320329[Abstract/Free Full Text]
- Resnick EM, Schreihofer DA, Periasamy A, Shupnik MA 2000 Truncated estrogen receptor product-1 suppresses estrogen receptor transactivation by dimerization with estrogen receptors
and ß. J Biol Chem 275:71587166[Abstract/Free Full Text] - Tiffoche C, Vaillant C, Schausi D, Thieulant M-L 2001 Novel intronic promoter in the rat ER
gene responsible for the transient transcription of a variant receptor. Endocrinology 142:41064119[Abstract/Free Full Text] - Schreihofer DA, Resnick EM, Lin VY, Shupnik MA 2001 Ligand-independent activation of pituitary ER: dependence on PKA-stimulated pathways. Endocrinology 142:33613368[Abstract/Free Full Text]
- Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik, MA 2000 Divergent and composite gonadotropin-releasing hormone-responsive elements in the rat luteinizing hormone subunit genes. Mol Endocrinol 14:472485[Abstract/Free Full Text]
- LaVoie HA, Garmey JC, Veldhuis JD 1999 Mechanisms of insulin-like growth factor I augmentation of follicle-stimulating hormone-induced porcine steroidogenic acute regulatory protein gene promoter activity in granulosa cells. Endocrinology 140:146153[Abstract/Free Full Text]
- Kraus WL, Montano MM, Katzenellenbogen BS 1994 Identification of multiple, widely spaced estrogen-responsive regions in the rat progesterone receptor gene. Mol Endocrinol 8:952969[Abstract]
- Clemens JW, Robker RL, Kraus WL, Katzenellenbogen BS, Richards JAS 1998 Hormone induction of progesterone receptor (PR) messenger ribonucleic acid and activation of PR promoter regions in ovarian granulosa cells: evidence for a role of cyclic adenosine 3',5'-monophosphate but not estradiol. Mol Endocrinol 12:12011214[Abstract/Free Full Text]
- Day RN, Koike S, Sakai M, Muramatsu M, Maurer RA 1990 Both Pit-1 and the estrogen receptor are required for estrogen responsiveness of the rat prolactin gene. Mol Endocrinol 4:19641971[Abstract]
- Zakaria M, Dunn IC, Zhen S, Su E, Smith E, Patriquin E, Radovick S 1996 Phorbol ester regulation of the gonadotropin-releasing hormone (GnRH) Gene in GnRH-secreting cell lines: a molecular basis for species differences. Mol Endocrinol 10:12821291[Abstract]
- Carr FE, Shupnik MA, Burnside J, Chin WW 1989 Thyrotropin-releasing hormone stimulates the activity of the rat thyrotropin ß-subunit gene promoter transfected into pituitary cells. Mol Endocrinol 3:717724[Abstract]
- Migliaccio A, Castoria G, Di Domenico M, de Falco A, Bilancio A, Lombardi M, Barone MV, Ametrano D, Zannini MS, Abbondanza C, Auricchio F 2000 Steroid-induced androgen receptor-oestradiol receptor ß-Src complex triggers prostate cancer cell proliferation. EMBO J 19:54065417[CrossRef][Medline]
- Préfontaine GG, Walther R, Giffin W, Lemieux ME, Pope L, Haché RJG 1999 Selective binding of steroid hormone receptors to octamer transcription factors determines transcriptional synergism at the mouse mammary tumor virus promoter. J Biol Chem 274:2671326719[Abstract/Free Full Text]
- Rhodes SJ, Chen R, DiMattia GE, Scully KM, Kalla KA, Lin SC, Yu VC, Rosenfeld MG 1993 A tissue-specific enhancer confers Pit-1-dependent morphogen inducibility and autoregulation on the pit-1 gene. Genes Dev 7:913932[Abstract/Free Full Text]
- Schreihofer DA, Rowe DF, Rissman EF, Scordalakes EM, Gustafsson J-A, Shupnik MA 2002 Estrogen receptor-
(ER
) but not ER-ß modulates estrogen stimulation of the ER
-truncated variant, TERP-1. Endocrinology 143:41964202[Abstract/Free Full Text] - Patisaul HB, Melby M, Whitten PL, Young LJ 2002 Genistein affects ERß- but not ER
-dependent gene expression in the hypothalamus. Endocrinology 143:21892197[Abstract/Free Full Text] - Couse JF, Lindzey J, Grandien K Gustafsson, J-Å, Korach KS 1997 Tissue distribution and quantitative analysis of estrogen receptor-
(ER
) and estrogen receptor-ß (ERß) messenger ribonucleic acid in the wild-type and ER
-knockout mouse. Endocrinology 138:46134621[Abstract/Free Full Text] - Shughrue PJ, Lane MV, Scrimo PJ, Merchenthaler I 1998 Comparative distribution of estrogen receptor-
(ER-
) and ß (ER-ß) mRNA in the rat pituitary, gonad, and reproductive tract. Steroids 63:498504[CrossRef][Medline] - Martini PG, Katzenellenbogen BS 2001 Regulation of prothymosin
gene expression by estrogen in estrogen receptor-containing breast cancer cells via upstream half-palindromic estrogen response motifs. Endocrinology 142:34933501[Abstract/Free Full Text] - Wang F, Porter W, Xing W, Archer TK, Safe S 1997 Identification of a functional imperfect estrogen-responsive element in the 5' promoter region of the human cathepsin D gene. Biochemistry 36:77937801[CrossRef][Medline]
- Kato S, Tora J, Yamauchi J, Masushige S, Bellard M, Chambon P 1992 A far upstream estrogen response element of the ovalbumin gene contains several half-palindromic 5'-TGACC-3' motifs acting synergistically. Cell 68:731742[CrossRef][Medline]
- Ediger TR, Park S-E, Katzenellenbogen BS 2002 Estrogen receptor inducibility of the human Na+/H+ exchanger regulatory factor/exrin-radixin-moesin binding protein 50 (NHE-RF/EBP50) gene involving multiple half-estrogen response elements. Mol Endocrinol 16:18281839[Abstract/Free Full Text]
- Petz LN and Nardulli AM 2000 Sp1 binding sites and an estrogen response element half-site are involved in regulation of the human progesterone receptor A promoter. Mol Endocrinol 14:972985[Abstract/Free Full Text]
- Pelletier G, Labrie C, Labrie F 2000 Localization of oestrogen receptor
, oestrogen receptor ß and androgen receptors in the rat reproductive organs. J Endocrinol 165:359370[Abstract] - Okada Y, Fujii Y, Moore Jr JP, Winters SJ 2003 Androgen receptors in gonadotrophs in pituitary cultures from adult male monkeys and rats. Endocrinology 144:267273[Abstract/Free Full Text]
- Curtin D, Jenkins S, Farmer N, Anderson AC, Haisenleder DJ, Rissman E, Wilson EM, Shupnik MA 2001 Androgen suppression of GnRH-stimulated rat LHß gene transcription occurs through Sp1 sites in the distal GnRH-responsive promoter region. Mol Endocrinol 15:19061917[Abstract/Free Full Text]
- Hashi A, Mazawa S, Chen SY, Yamakawa K, Kato J, Arita J 1996 Estradiol-induced diurnal changes in lactotroph proliferation and their hypothalamic regulation in ovariectomized rats. Endocrinology 137:32463252[Abstract]
- Turgeon JL, Shyamala G, Waring DW 2001 Localization and anterior pituitary cell populations in vitro in ovariectomized wild-type and PR-knock-out mice. Endocrinology 142:44794485[Abstract/Free Full Text]
- Misiti S, Schomburg L, Yen PM, Chin WW 1998 Expression and hormonal regulation of coactivator and corepressor genes. Endocrinology 139:24932500[Abstract/Free Full Text]