Endocrinology, doi:10.1210/en.2005-0518
Endocrinology Vol. 147, No. 1 70-78
Copyright © 2006 by The Endocrine Society
Osteostat/Tumor Necrosis Factor Superfamily 18 Inhibits Osteoclastogenesis and Is Selectively Expressed by Vascular Endothelial Cells
Bernardetta Nardelli,
Liubov Zaritskaya,
William McAuliffe,
Yansong Ni,
Clint Lincoln,
Yun Hee Cho,
Charles E. Birse,
Wendy Halpern,
Stephen Ullrich and
Paul A. Moore
Human Genome Sciences, Inc., Rockville, Maryland 20850
Address all correspondence and requests for reprints to: Paul Moore, Ph.D., Celera, 45 West Gude Drive, Rockville, Maryland 20850. E-mail: paul.moore{at}celera.com.
 |
Abstract
|
|---|
Vascular endothelial cells (EC) participate in the process of bone formation through the production of factors regulating osteoclast differentiation and function. In this study, we report the selective expression in primary human microvascular EC of Osteostat/TNF superfamily 18, a ligand of the TNF superfamily. Osteostat protein is detectable in human microvascular EC and is highly up-regulated by IFN-
and IFN-ß. Moreover, an anti-Osteostat antibody strongly binds to the vascular endothelium in human tissues, demonstrating that the protein is present in the EC layers surrounding blood vessels. Functional in vitro assays were used to define Osteostat involvement in osteoclastogenesis. Both recombinant and membrane-bound Osteostat inhibit differentiation of osteoclasts from monocytic precursor cells. Osteostat suppresses the early stage of osteoclastogenesis via inhibition of macrophage colony-stimulating factor-induced receptor activator of NF-
B (RANK) expression in the osteoclast precursor cells. This effect appears to be specific for the differentiation pathway of the osteoclast lineage, because Osteostat does not inhibit lipopolysaccharide-induced RANK expression in monocytes and dendritic cells, or activation-induced RANK expression in T cells. These findings demonstrate that Osteostat is a novel regulator of osteoclast generation and substantiate the major role played by the endothelium in bone physiology.
 |
Introduction
|
|---|
THE MAINTENANCE OF skeletal mass is controlled by the opposing actions of two cell types: the bone-forming osteoblasts, derived from stromal cells, and the bone-resorbing osteoclasts, belonging to the myeloid lineage. However, other cellular types play a crucial role in bone physiology. In particular, vascular endothelial cells (EC) are of central importance in the process of bone formation and remodeling. Vascularization precedes and supports osteogenesis, and, in the bone tissue, there is a close physical association among vascular EC, osteoblasts and osteoclasts. EC produce several factors regulating osteoclast activity (1, 2, 3, 4). Stimulated EC release TNF-
, which induces receptor activator of NF-
B ligand (RANKL) expression in osteoblasts and has multiple actions on osteoclasts (5, 6, 7, 8, 9). In addition, human microvascular EC (HMVEC) express two TNF-related proteins crucial for bone metabolism: RANKL and osteoprotegerin (OPG) (10). RANKL is an integral modulator of bone formation inducing the differentiation of progenitor cells into fully mature osteoclasts and enhancing the survival and activation state of differentiated osteoclasts (11, 12, 13, 14, 15, 16). Administration of RANKL caused bone loss and development of osteoporosis in normal mice. In contrast, RANKL null mice had a reduced number of osteoclasts and consequent osteopetrosis (17). Although RANKL is expressed predominantly in osteoblasts/stroma cells and activated T cells, it is produced also by other cell types (10, 18, 19, 20). OPG lacks a transmembrane domain and functions as a soluble receptor (21, 22, 23). The physiological role of this protein was discovered via the generation of OPG transgenic mice (21), which display a decrease in osteoclasts that is associated with a generalized increase in bone density and profound osteopetrosis. OPG is a receptor for RANKL, and thus blocks the differentiation of osteoclasts through inhibition of the binding of RANKL to its receptor, receptor activator of NF-
B (RANK). As RANKL, OPG is produced by several cell types.
TNF superfamily 18 (TNFSF18) was initially identified as a member of the human TNF ligand superfamily through high throughput sequencing of human cDNAs (24, 25). Hydrophilicity analysis of the full-length cDNA clone predicts for a 177-amino acid type II transmembrane protein. The predicted protein comprises of a short intracellular domain, a hydrophobic transmembrane domain, an extracellular domain with two potential glycosylation sites near the extracellular C-terminal region. The protein is a ligand for a TNF-like receptor [TNFRSF18/glucocorticoid-induced TNF-related (GITR)/activation-inducible TNF receptor (AITR)] and has been named the ligand for activation-inducible TNF receptor (AITRL) (24) and human ligand for glucocorticoid-induced TNF-related (GITRL) (25). However, no clear functional activity of the human protein has been reported so far. In this study, we show that TNFSF18 is a strong negative regulator of osteoclastogenesis, and hence, we have called the protein Osteostat to reflect its biological role. It is constitutively expressed in HMVEC and suppresses the differentiation of myeloid precursor cells into osteoclasts via inhibition of RANK expression in the monocytic cells.
 |
Materials and Methods
|
|---|
Proteins and antibodies
RANKL, macrophage colony-stimulating factor (M-CSF), IFN-
, IL-4, granulocyte macrophage colony-stimulating factor (GM-CSF), IL-2, CD40 ligand, RANK, AITRL, TNFRSF18, and vascular endothelial growth factor were purchased from PeproTech (Rocky Hill, NJ); IFN-
2a and IFN-ß were purchased from PBL Biomedical Laboratories (New Brunswick, NJ); and lipopolysaccharide (LPS), phorbol-12-myristate-13-acetate and ionomycin were purchased from Sigma-Aldrich (St. Louis, MO). Rabbit polyclonal antibodies were affinity purified from antisera generated by immunizing rabbits with recombinant Osteostat. Goat polyclonal anti-GITRL and GITRL were from R&D Systems (Minneapolis, MN). BLyS, OPG-Fc, LIGHT, and APRIL were produced by Human Genome Sciences, Inc. (Rockville, MD).
Cells
Monocytes were purified from human peripheral blood mononuclear cells (PBMC) by centrifugation of leukapheresis preparations (BRT Inc., Baltimore, MD) through Histopaque (Sigma-Aldrich) gradients followed by counter-flow centrifugal elutriation. Monocyte-derived dendritic cells were obtained by culturing monocytes for 710 d in RPMI containing 10% fetal bovine serum, 2 mM L-glutamine, and 50 µg/ml gentamicyn, supplemented with 50 ng/ml GM-CSF and 20 ng/ml IL-4. T cells were purified from blood mononuclear cells using magnetic beads separation (Miltenyi Biotec, Auburn, CA). Primary HMVEC were purchased from Clonetics (Gaithersburg, MD) and grown following the manufacturers instructions.
TaqMan real-time RT-PCR analysis
Osteostat mRNA levels were assessed using a 7700 TaqMan Sequence Detector [Applied Biosystems Inc. (ABI), Foster City, CA]. Total RNA was isolated from homogenized cell lysates using a RNeasy mini kit (Qiagen, Valencia, CA) following the manufacturers protocol, and 50 ng used in a one-step 25-µl quantitative reverse RT-PCR. As a control for genomic contamination, parallel reactions were set up without RT. Osteostat mRNA quantitation was conducted with the comparative
cycle threshold method using an 18S rRNA as the endogenous reference, as described in Gibson et al. (26) and in the ABI user bulletin no. 2. Osteostat cDNA amplification primers and probe were generated using Primer Express Software (ABI) anticipated to give a theoretical PCR efficiency of one. The 18S rRNA primers and probes were obtained from ABI. Probes were labeled at the 5' end with the reporter dye 6-carboxyfluorescein and on the 3' end with the quencher dye 5-(and 6)-carboxytetramethylrhodamine (BioSource International, Camarillo, CA). Reactions were conducted at 48 C for 30 min, 95 C for 10 min, followed by 40 cycles of denaturation and annealing/extension at 95 C for 15 sec and 60 C for 1 min, respectively. The sequences for primers and probe were as follows: 5'-GGCTCCCAATGCAAACTACAAT-3'; 5'-TGTTAGAGTTTGTATCATGTCTTTGTTTTT-3'; 5'-TACAGCCGCACCTCAAAAGGAGCTACT-3'.
Expression of membrane-bound Osteostat
The full-length Osteostat open reading frame (TNFSF18; GenBank accession no. AF125303) was PCR amplified using the following oligonucleotide primers: 5'-CAGACTGGATCCGCCACCATGTGTTTGAG-CCACTTGG-3' and 5'-CAGACTGGTACCGTATCTCTCTGCAGATCC-AACC-3'. The upper primer introduced a Kozak consensus sequence before the initiating methionine and tailed the amplicon with a 5' BamHI site. The lower primer annealed to the 3' untranslated region of the Osteostat cDNA and introduced a 3' Asp718 site. The PCR amplicon was digested with BamHI and Asp718 and ligated to like digested pC4, a mammalian expression vector (27). The pC4:Osteostat vector was transiently transfected into HEK293T cells using lipofectamine (Invitrogen, Carlsbad, CA), and 48 h after transfection cells were collected for further analysis. As a control, pC4 vector alone was transfected in parallel.
Osteostat gene expression array analysis
cDNA array filters were constructed comprising PCR amplicons from approximately 6000 independent genes selected from the Human Genome Sciences database (28). The genes selected (including Osteostat) were arrayed in duplicate. The array filters were hybridized to over 300 human normal/patient RNA samples isolated from a wide range of cell, tissue, and organ types procured from the Cooperative Human Tissue Network, the National Disease Research Interchange, and from a single commercial site (Clontech, Palo Alto, CA). Hybridization probes from individual RNA samples were generated using 33P-labeled first strand cDNA synthesized from 3 µg total RNA. After overnight hybridization, the filters were washed under stringent conditions and hybridization signal detected after 4 d using a Fuji BAS 2500 phosphorimaging system (FujiFilm, Burbank, CA). Signals from duplicate spots including Osteostat were captured using ImaGene 4.0 software (BioDiscovery, El Segundo, CA). After linear signal normalization, the average and coefficient of variation for each duplicate pair of Osteostat DNA spots hybridized to each RNA sample was stored for further analysis.
Western blot analysis
Soluble fractions of cell lysates (equivalent of 2 x 106 cells per lane) were loaded on a 420% Tris-glycine gel (Invitrogen). Resolved proteins were transferred onto polyvinylidene difluoride membranes, and membranes immunoblotted with 0.4 µg/ml of goat polyclonal antihuman GITRL or antihuman RANK antibody. A rabbit antigoat IgG-HRP conjugated antibody (Chemicon International, Temecula, CA) was used for detection. The results were developed by ECL+plus immunoblotting detection system (Amersham Biosciences, Piscataway, NJ). For loading controls, either nonspecific bands were used or membranes were stripped and then reprobed with a monoclonal anti-actin antibody (Sigma-Aldrich).
Immunohistochemistry
Five-micrometer sections of formalin-fixed paraffin-embedded tissues were deparaffinized and hydrated, blocked for endogenous peroxidase, and processed for heat-induced antigen retrieval in 0.01 M citrate buffer with 0.01% Nonidet P-40 (Sigma-Aldrich), pH 6. In addition, sections were serially incubated with goat serum, avidin, and biotin (Vector Laboratories, Burlingame, CA) to block nonspecific epitopes and avidin or biotin binding sites. The primary rabbit-anti-Osteostat polyclonal antibody at 3 µg/ml was incubated in the absence or presence of 15 µg/ml Osteostat before application to tissue sections. The ABC/peroxidase method of detection (Vector), with a diaminobenzidine chromogen (DAB kit; Sigma-Aldrich) were used to visualize specific binding.
Expression and purification of recombinant Osteostat
Osteostat nucleotide sequence corresponding to the predicted extracellular amino acids of Osteostat (T53-S177) based on hydrophobicity profiling were PCR amplified from the full-length Osteostat cDNA (24) using a 5' primer (GGATATCATATGACCGCTAAAGAACCGTGTATGGCTAAGT) and a 3' primer (GACAGTGGTACCTTACTAGGAGATGAATTGGGGAT) that tailed the amplicon with NdeI and Asp718 restriction sites and introduced an initiating methionine. The resulting amplicon was digested with NdeI/Asp718 and subcloned into like digested pHE4 and expressed in the Escherichia coli W3110 strain. Inclusion bodies were solubilized in 1.5 M guanidine hydrochloride, followed by refolding. The protein was purified using exchange columns (Poros QS-50 and CM-20) and eluted out from the last column using a salt and a pH gradient. The protein had a trimeric configuration in solution similarly to other TNF-like ligands.
Osteoclast formation
Human monocytes were cultured for 57 d in phenol red-free
-MEM containing 10% fetal bovine serum in 24-well tissue culture plates (Corning, Corning, NY) at 1 x 106 cells/ml in the presence of 50100 ng/ml human RANKL and 25 ng/ml human M-CSF. In several experiments, monocytes were cocultured with Osteostat-transfected cells following the conditions specified above.
Tartrate-resistant acid phosphatase (TRAP) staining and resorption assay
Cells were fixed in 3% formaldehyde for 10 min at room temperature, rinsed with water, and stained with Fast Garnet in the presence of 100 nM sodium tartrate using TRAP assay kit from Sigma-Aldrich. TRAP-positive cells containing three or more nuclei were counted as osteoclasts by light microscopy. To determine the resorption activity of generated osteoclasts, human monocytes were cultured in 24-well plates on Osteologic disks (BD BioCoat Osteologic Bone Cell Culture System; Becton Dickinson, Bedford, MA) in
-MEM, as described above. After osteoclast formation was observed, the disks were recovered, cells were lysed in a solution of 3% bleach and 2.5% sodium hydroxide, and disks were rinsed in water and air dried. The resorption areas were screened and analyzed by Microst Automated Image Analyzer (Millenium Biologix Inc., Kingston, Ontario, Canada).
Viability assay
The assay was conducted as in Magan et al. (29). Briefly, monocytes were cultured in polypropylene tubes in DMEM containing 25 mM glucose, 20 mM L-glutamine, 25 mM HEPES buffer (pH 7.3), and 50 µg/ml gentamicin. After 48 h of incubation in the absence or presence of stimulants, apoptotic cells were detected by using an Annexin-FITC apoptosis kit according to the manufacturers instructions (BD Pharmingen, Mountain View, CA). Flow cytometric data (FACScan; Becton Dickinson) were collected from 10,000 cells and reported as the percentage of positive apoptotic cells. Three independent experiments were done.
Surface plasmon resonance studies
Binding analysis was performed using a BIAcore 3000 biosensor (BIAcore AB, Uppsala, Sweden), following the manufacturers recommendations, along with BIAevaluation software version 3.2. TNF-like receptors RANK, DR4, or TNFRSF18 were immobilized onto a CM5 sensor chip via amine groups, using N-ethyl-N'-(dimethylaminopropyl) carbodiimide/N-hydroxysuccinimide chemistry, to a density of approximately 400 relative response units. Unoccupied sites were blocked with ethanolamine. The chip was thoroughly primed with HBS-EP buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, 3.4 mM EDTA, 0.005% surfactant P20). Serial dilutions of Osteostat or RANKL (range 0.15610 µg/ml) in HBS-EP buffer were injected at a flow rate of 15 µl/min at 25 C for a total time of 1.6 min. The off rate was determined by washing unbound RANKL or Osteostat in the presence of HBS-EP buffer and measuring the net relative response units remaining during a period of 3.0 min. After each cycle, the surface was regenerated using 10 mM glycine-HCl, pH 1.5. The resonance signal measured on the control flow cells was subtracted from the signal measured on the experimental flow cell. Each sample set was repeated three times for a total of 24 sample injections. All values are reported as the mean ± SD.
 |
Results
|
|---|
Genes displaying EC-enriched expression were identified by hybridizing approximately 300 individual RNA samples isolated from a range of human cell and tissue types, including normal or diseased, resting or activated on a cDNA array comprising approximately 6000 individual human genes encoding predominantly secreted and membrane-bound proteins. The gene expression profiles of the 20 genes of the 6000 analyzed that demonstrated the most enriched expression in EC relative to the other genes analyzed are presented in Fig. 1
. Within this group are genes previously demonstrated to be expressed in EC or EC-enriched tissues, including SERPINE (30), the seven transmembrane receptor ETL (31), and the cysteine-rich angiogenesis inducers, CYR61 and CTGF (32). Genes of complete unknown function (e.g. NM_025107) were also identified. One of the genes that demonstrated a clear enriched expression in EC types was the TNF-like molecule TNFSF18, also called AITRL/TL6 or GITRL (24, 25), which we have named in this study as Osteostat. To determine the levels of Osteostat in EC or other cell types, quantitative PCR analysis was used. Substantial levels of Osteostat mRNA were found only in EC types, such as primary HMVEC and human umbilical vein endothelial cell. Examining cells from seven donors, Osteostat mRNA displayed a mean expression ratio relative to 18S rRNA of 1.2 x 103 (±0.23 x 103) in HMVEC, whereas the transcript was close to the background level (2 x 109) in PBMC. Furthermore, the presence of Osteostat protein in primary HMVEC was detectable by Western blot using goat polyclonal antibodies anti-Osteostat (Fig. 2A
). A specific band of approximately 22 kDa corresponding to the full-length protein, as found in cells transfected with the Osteostat gene, was visible in the blots from lysates of normal HMVEC from the majority of the donors tested (five of seven). In contrast, the protein level was usually too low to be detectable by Western blot in the EC obtained from large blood vessels, such as human umbilical vein endothelial cell and aortic EC (data not shown). No protein expression was detectable by Western blot in other cell types, such as monocytes (data not shown). These results are in agreement with Kwon et al. (24), reporting that no Osteostat message was detectable in T, B, and monocytic cell lines and PBMC by RT-PCR.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 1. Array analysis of Osteostat mRNA expression in human cells and tissues. The expression profile of Osteostat mRNA across a range of human cell and tissue types was determined using a cDNA array approach. The level of expression of Osteostat relative to the average expression of all other 5700 genes arrayed and hybridized is presented in pseudocolor (green represents relatively high expression).
|
|

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2. Expression and regulation of Osteostat in HMVEC. A, Expression of Osteostat protein and its up-regulation in HMVEC was analyzed by Western blot after 2-d treatment with class I IFNs (100 ng/ml). Cell lysates from 293T cells transfected with Osteostat full-length gene were run as positive control. B, Quantitative PCR analysis of Osteostat expression in HMVEC-d or HMVEC of lung origin (HMVEC-l). Cells were treated for 1 d with factors and lysed, and after RNA extraction, PCR analysis was then conducted. The mRNA level of Osteostat in each sample, determined in triplicate, is expressed as the mean level (±SD) relative to the 18S rRNA level (endogenous reference).
|
|
To test whether Osteostat expression could be modulated, HMVEC cells were treated with several factors or cytokines. Although proinflammatory cytokines, LPS, or hormones did not significantly modulate the protein expression (data not shown), type I IFNs (IFN-
and IFN-ß) strongly increased the protein level in all the donors tested (n = 5). A representative donor is shown in Fig. 2A
. To examine whether the increased protein levels were caused by increased levels of steady-state mRNA, real-time PCR analyses were performed with mRNA obtained from HMVEC of dermal (HMVEC-d) or lung origins cultured in absence or in presence of type I IFN or other factors. A total of five donors were tested, and the results obtained with representative donors are shown in Fig. 2B
. Treatment with type II IFN, CD40 ligand, or vascular endothelial growth factor did not change significantly Osteostat mRNA level in HMVEC-d; in contrast, as shown in a different donor, the transcript basal expression level was increased 2-fold by IFN-
and 3-fold by IFN-ß. HMVEC obtained from lungs of an additional donor showed a similar response to IFN treatment. In these cells, IFN-
and IFN-ß produced, respectively, more than 4- and 7-fold increase of Osteostat mRNA level. Collectively, these experiments demonstrated that Osteostat is constitutively expressed in HMVEC, and its expression is significantly up-regulated by type I IFN.
Subsequent experiments demonstrated that Osteostat is present in vivo in the EC layers surrounding human blood vessels (Fig. 3
). Staining of sections of human skin with Osteostat-specific rabbit polyclonal antibodies clearly demonstrated the presence of the protein on the vascular EC (Fig. 3A
). A dense circumferential band of positive EC was observed in the tunica intima of the vessels with variable staining of the smooth muscle layer (tunica media). In the tunica adventitia, prominent staining of the microvessels supplying larger vessels was often observed. Incubation with rabbit IgG did not result in vessel staining (Fig. 3B
). The reactivity was specific because it was completely abrogated by competition with recombinant Osteostat (Fig. 3C
), whereas competition with an unrelated protein, BLyS, was ineffective (Fig. 3D
). The same pattern of reactivity was observed in vascular EC of human lungs (data not shown).

View larger version (167K):
[in this window]
[in a new window]
|
FIG. 3. Presence of Osteostat in human blood microvessels. Immunohistochemical staining for Osteostat in the deep dermal vessels of human skin. A, Staining with rabbit anti-Osteostat antibody: a continuous line of positive staining of endothelium is present, with scattered individual positive cells in the tunica media, tunica adventitia, and capillaries in the surrounding stroma. B, Staining with isotype control: no positive reactivity is observed. C, Staining of a serial section with rabbit anti-Osteostat antibody preincubated with recombinant Osteostat: the protein inhibits the reactivity of the serum demonstrating the specific staining of the polyclonal antibody on human endothelium. D, Preincubation with a control protein, BLyS, does not inhibit endothelium staining by the Osteostat-specific polyclonal antibody.
|
|
Considering the key role the TNF superfamily plays in modulating a host of cellular responses, we were intrigued to characterize the biological activity of Osteostat. We conducted studies to determine whether the restricted expression of Osteostat in HMVEC was related to osteoclastogenesis, in light of the known contribution of the vascular endothelium in bone remodeling. To this end, 293T cells were transiently transfected with the full-length Osteostat gene and the expression of the protein was assessed by Western blot (Fig. 2A
). The cells were then used in a standard in vitro system of osteoclast generation, based on the effect of RANKL and M-CSF to induce the differentiation of monocytes into osteoclasts (11, 33, 34). In this experimental system, human monocytes in culture for 57 d with the two osteotropic cytokines fuse and differentiate into osteoclasts, which are multinucleated cells characterized by high TRAP activity. Addition of the 293T-Osteostat cells to the monocytes caused a strong suppression of osteoclastogenesis (Fig. 4A
). Fifty thousand Osteostat-transfectants per well completely inhibited the formation of TRAP+ multinucleated cells, whereas vector-transfectants were ineffective. Interestingly, in contrast to the Osteostat-transfected cells, conditioned medium from 293T-Osteostat did not block the differentiation of monocytes to osteoclasts (data not shown). These data, together with the observation that the amino acid sequence of Osteostat lacks putative signal peptide and known protease-sensitive motifs (24, 35, 36), suggest that the protein might be produced mainly in a membrane-bound form. To further assess the effect of Osteostat on osteoclastogenesis, a recombinant soluble protein, comprising the extracellular domain of the full-length protein, was expressed and purified in E. coli. Addition of the recombinant protein to the osteoclastogenesis assay suppressed the formation of multinucleated TRAP+ cells (Fig. 4B
). At concentrations above 100 ng/ml, Osteostat caused complete inhibition of osteoclast formation. Identical concentrations of BLyS recombinant protein were used as control and did not inhibit the generation of TRAP+ cells. The protein showed a level of potency comparable to a recombinant OPG-Fc (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 4. Suppression of osteoclast differentiation by Osteostat. A, Activity of Osteostat-transfected cells. Monocytes were cocultured with increasing concentrations of 293T cells transiently transfected with Osteostat full-length or the expression vector. Osteoclast formation was assessed by TRAP staining at d +6. One representative experiment is shown. B, Activity of recombinant Osteostat. Human peripheral blood monocytes were incubated for 5 d in the presence of RANKL/M-CSF. Increasing concentrations of Osteostat or BLyS were added at the beginning of the culture. Osteoclast formation was assessed by TRAP staining.
|
|
In the next series of experiments (Fig. 5
), we used the resorption assay to further validate the functional effect of Osteostat. Monocytes were differentiated to osteoclasts on disks coated with a synthetic bone-matrix of calcium phosphate. In presence of osteotropic factors, monocytes fused to form the multinucleated TRAP+ cells, which degraded the bone-matrix creating lacunae on the surface of the disks. Addition of Osteostat completely suppressed the formation of osteoclasts and, consequently, of the lacunae. In the resorption assay, concentrations above 100 ng/ml of recombinant protein caused a complete inhibition of degradation of the calcium phosphate matrix, whereas other ligands of the TNF superfamily (BLyS, APRIL, or LIGHT) were completely ineffective (data not shown).

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 5. Osteostat inhibits lacunae formation on bone-matrix. Monocytes were cultured on tissue culture wells or on disks coated with a synthetic bone-matrix in presence of RANKL/M-CSF or RANKL/M-CSF plus Osteostat. Formation of osteoclasts (maroon cells) was visualized by TRAP+ staining (left panels). Cells cultured on the osteologic disks were removed, and the presence of resorption areas (lacunae) on the disk surfaces was observed by light microscopy (right panels). One representative experiment is shown (one of six).
|
|
In kinetics studies, addition of Osteostat at the beginning of the culture (d 0 or +1) was highly effective in inhibiting the generation of osteoclasts and, consequently, the degradation of the bone-matrix. In contrast, a delayed addition of Osteostat had no significant effect (Fig. 6
). These findings demonstrated that the suppressive effect of the protein occurred during the first 2 d of culture, suggesting that Osteostat inhibits the early phase of the osteoclast differentiation from their precursors.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 6. Osteostat inhibits the early phase of osteoclastogenesis. Monocytes were cultured for 5 d in presence of RANKL/M-CSF. Osteostat (100 ng/ml) was added to the cultures at the time points indicated. The number of formed osteoclasts in the cultures was assessed by TRAP staining. The percentage of resorption measured as the total area of the lacunae on the osteologic disks was quantified using an image analyzer. The results are representative of three independent experiments.
|
|
To evaluate whether Osteostat has a direct effect on osteoclast progenitor cell survival, monocytes cultured in the presence of Osteostat were evaluated for apoptosis. As shown in Table 1
, the level of monocyte apoptosis decreased in the presence of Osteostat, demonstrating that Osteostat mediates a survival signal to monocytes under the experimental conditions used. This direct effect mediated by Osteostat on monocytes is supported with our observation that Osteostat can bind directly to monocytes (data not shown). As the known cognate receptor for Osteostat is not believed to be expressed on monocytes as evidenced by its absence of expression in PBMC (24), we were prompted to determine whether Osteostat can associate with RANK, a TNF receptor superfamily member expressed in monocytes and a mediator of osteclastogenesis. However, BIAcore analysis failed to demonstrate any specific binding between Osteostat and RANK (Table 2
). In contrast and in agreement with earlier reports (24, 25), Osteostat demonstrates binding to TNFRSF18 with an affinity of approximately 20 nM, and RANKL demonstrates an affinity of approximately 1 nM to RANK.
The induction of RANK expression is the crucial step regulating cell differentiation in the early stage of osteoclastogenesis (15). Therefore, we tested the effect of Osteostat on RANK expression in the myeloid precursor cells. Human monocytes were treated with M-CSF in absence or presence of Osteostat for 2 d, and the cell lysates were analyzed by Western blots using a polyclonal Ab specific for RANK. As shown in Fig. 7A
, Osteostat treatment suppressed RANK expression, endogenous or M-CSF induced. The inhibition was detectable also at the level of RANK mRNA (Fig. 7B
), as measured by quantitative PCR analysis. Osteostat did not cause a general suppression of M-CSF activation of monocytes, because the induction of other genes by M-CSF, such as TNFR1, was not altered following Osteostat treatment as measured by quantitative PCR (data not shown). Osteostat effect seems to be specific for the signaling pathway regulating osteoclast differentiation because the protein did not affect LPS-induced increase of RANK protein levels in monocytes or in dendritic cells. In addition, it did not inhibit RANK expression in T cells after activation (Fig. 7C
). In summary, these results indicate that Osteostat specifically inhibits M-CSF-induced RANK expression in monocytes.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 7. Inhibition by Osteostat of M-CSF-induced RANK expression. A, Western blot analysis of cell lysates from monocytes untreated or treated for 2 d with: Osteostat, M-CSF, or Osteostat + M-CSF. Goat anti-RANK polyclonal antibodies were used to detect the presence of the receptor on the blots. B, Quantitative PCR analysis of RANK transcript was conducted with monocytes treated as above for 1 d. C, Osteostat does not inhibit RANK expression in monocytes or dendritic cells activated by LPS, or in T cells activated by phorbol-12-myristate-13-acetate/ionomycin/IL-2. Analysis of RANK expression was conducted by Western blot after 2-d treatment. The results are representative of at least three independent experiments.
|
|
 |
Discussion
|
|---|
In this study, we have identified Osteostat as a novel potent inhibitor of osteoclastogenesis that is expressed selectively in EC. Although the human Osteostat gene was cloned several years ago, its biological activity has remained ill-defined. It was reported that Osteostat induced NF-
B activation in cells cotransfected with the ligand and the receptor AITR (24), and that it rescued Jurkat cells transfected with human GITR from activation-induced cell death (25). Using a well-defined in vitro system, we have demonstrated that Osteostat blocks the differentiation of myeloid precursor cells into osteoclasts via the inhibition of RANK expression in the precursor cells.
Osteoclast precursors are derived from the pluripotential hematopoietic stem cell and are present in circulation in the monocytic fraction (37, 38). Although several cytokines influence the differentiation process, it was demonstrated that M-CSF and RANKL are the two essential factors controlling it (11, 33, 39). Arai et al. (15) have identified an early and a late stage in osteoclast development. In the early stage, the presence of M-CSF in the microenvironment is critical because it induces RANK expression in the precursor cells. Mice lacking functional M-CSF have, indeed, very few osteoclasts and are osteopetropic (40). Subsequently in the late stage, RANKL becomes the indispensable factor driving the final differentiation into osteoclasts. Without RANKL-RANK interaction and in presence of M-CSF, the precursor monocytic cells differentiated into tissue macrophages by default. In this model, Osteostat, by inhibiting the M-CSF-induced up-regulation of RANK in the early stage of osteoclastogenesis, blocks RANKL signaling and, consequently, osteoclast formation. It is possible that other molecular events are initiated by Osteostat in the precursor cells and they warrant further research. However, it is evident from our experiments that the effect of Osteostat is restricted to the early stage of osteoclast development, because delayed addition of the protein did not affect differentiation. The described mechanism of activity differentiates Osteostat from other cytokines known to suppress osteoclast generation, such as IFN-
that inhibits RANK signaling through degradation of TRAF-6 (41), or IL-4 that blocks RANKL-dependent activation of NF-
B and MAP kinase signaling (42).
cDNA array analysis of approximately 6000 cDNAs encoding membrane-bound or secreted proteins identified approximately 1520 genes including Osteostat that demonstrated selective transcriptional up-regulation in EC. Clearly understanding the biological roles of these proteins in the vascular system will be of great interest. More detailed analysis of Osteostat expression revealed that its mRNA is expressed in normal EC, and Osteostat protein is readily detectable in the tissue microvascular endothelium. Both Osteostat mRNA and protein expression are strongly up-regulated by class I IFNs, although not significantly changed by other stimuli. It is of interest that IFN-ß was reported to be a potent inhibitor of osteoclast formation by interfering with RANKL-induced expression of c-Fos (43). The restricted expression in the microvascular endothelium could suggest a potential physiological role for the protein. Osteoclast precursor cells belonging to the monocytic lineage reach through the circulation the areas of the peripheral skeleton where active bone remodeling or formation takes place, called basic multicellular unit (BMU) (44). The cells cross by diapedesis the endothelial layer of the blood vessel situated at the center of each BMU, and migrate toward the edge of the unit where they differentiate into osteoclasts after the interaction with osteoblasts and stroma. Although the total production of monocytes in humans is approximately 5 x 108 cells per hour, only a very small fraction of the cells becomes osteoclasts. Osteoclastogenesis takes place exclusively in bones despite the fact that M-CSF and RANKL proteins are found in soft tissues (20, 45). It has been proposed that the preosteoclasts leave the circulation only when they reach a BMU in response to a unique combination of chemotactic signals and adhesion molecules. It is intriguing to speculate that the presence of Osteostat in the microvascular endothelium might constitute part of a negative signaling system that does not allow the monocytic cells extravasating outside the BMU to become osteoclasts. Specifically inhibiting the up-regulation of RANK, Osteostat could contribute to drive the monocytes toward the macrophage differentiation pathway.
At present, it is unclear which receptor is used by Osteostat to deliver the anti-osteoclastogenic signal to the monocytic cells. A receptor, TNFRSF18, also called AITR or human GITR, was identified in humans (23, 24). A murine GITR was recently cloned (46). The murine receptor has two major differences compared with human GITR, being characteristically induced by dexamethasone and presenting a mismatch in the first cysteine-rich pseudorepeat; so that it was proposed that the two receptors might serve distinct functions (24). In the murine system, blocking of GITR signaling caused an enhancement of T cell regulatory function (47, 48). It is possible that Osteostat uses an unknown high-affinity receptor on the preosteoclasts. This hypothesis is supported by the findings that TNFRSF18 mRNA is not detectable or is expressed at very low levels in human monocytes, although it is highly expressed on activated T cells (Refs.24 and 25 and our unpublished data). It is also unclear whether Osteostat is the functional human counterpart of the recently cloned murine GITRL (49, 50). This membrane protein is 51% identical to Osteostat and is highly expressed in mouse dendritic cells (50) and in macrophages (51). From the published reports it is evident that murine GITRL is the ligand for murine GITR, and this pair may be involved in the regulation of immune responses presumably by interaction of dendritic cells and CD25+CD4+ suppressor/regulatory T cells.
In conclusion, we have characterized a new powerful and specific effect of a member of the TNF superfamily. This study adds an additional player in the complex network that regulates bone physiology and potentially opens the way to the generation of a new drug for the treatment of bone diseases.
 |
Acknowledgments
|
|---|
We greatly appreciate the technical support and advice provided by Drs. Reiner Gentz, Shashi Kaithamana, Yanggu Shi, Henrik Olsen, and David LaFleur.
 |
Footnotes
|
|---|
First Published Online September 22, 2005
Abbreviations: AITR, Activation-inducible TNF receptor; AITRL, AITR ligand; BMU, basic multicellular unit; EC, endothelial cell; GITR, glucocorticoid-induced TNF-related; GITRL, GITR ligand; GM-CSF, granulocyte M-CSF; HMVEC, human microvascular endothelial cell; HMVEC-d, HMVEC of dermal origin; LPS, lipopolysaccharide; M-CSF, macrophage colony-stimulating factor; OPG, osteoprotegerin; PBMC, peripheral blood mononuclear cell; RANK, receptor activator of NF-
B; RANKL, RANK ligand; TNFSF18, TNF superfamily 18; TRAP, tartrate-resistant acid phosphatase.
Received May 2, 2005.
Accepted for publication September 13, 2005.
 |
References
|
|---|
- Bax BE, Alam ASMT, Banerji B, Bax CMR, Bevis PJR, Stevens CR, Moonga BS, Blake DR, Zaidi M 1992 Stimulation of osteoclastic bone resorption by hydrogen peroxide (H2O2). Biochem Biophys Res Commun 183:11531158[CrossRef][Medline]
- Alam ASMT, Gallanger A, Shankar VS, Ghaeti MA, Datta HK, Huang CL-H, Moonga BS, Chambers TJ, Bloom SR, Zaidi M 1992 Endothelin inhibits osteoclastic bone resorption by a direct effect on cell motility: implications for the vascular control of bone resorption. Endocrinology 130:36173624[Abstract/Free Full Text]
- MacIntyre I, Zaidi M, Alam ASMT, Datta HK, Moonga BS, Lidbury PS, Hecker M, Vane JR 1991 Osteoclastic inhibitor: An action of nitric oxide not mediated by cyclic GMP. Proc Natl Acad Sci USA 88:29362940[Abstract/Free Full Text]
- Raisz LG 1982 Prostaglandins and skeletal metabolism. In: Lee JB, ed. Prostaglandins. New York: Elsevier; 351372
- Hofbauer LC, Lacey DL, Dunstan CR, Spelsberg TC, Riggs BL, Khosla S 1999 Interleukin-1ß and tumor necrosis factor-
, but not interleukin-6, stimulate osteoprotegerin ligand gene expression in human osteoblastic cells. Bone 25:255259[Medline] - Azuma Y, Kaji K, Katogi R, Takeshita S, Kudo A 2000 Tumor necrosis factor-
induces differentiation of and bone resorption by osteoclasts. J Biol Chem 275:48584864[Abstract/Free Full Text] - Lee SE, Chung WJ, Kwack HB, Chung CH, Kwack KB, Lee ZH, Kim HH 2001 Tumor necrosis factor-
supports the survival of osteoclasts through the activation of Akt and ERK. J Biol Chem 276:4934349349[Abstract/Free Full Text] - Zhang Y-H, Heulsmann A, Tondravi MM, Mekherjee A, Abu-Amer Y 2001 Tumor necrosis factor-
(TNF) stimulates RANKL-induced osteoclastogenesis via coupling of TNF type I receptor and RANK signaling pathways. J Biol Chem 276:563568[Abstract/Free Full Text] - Fuller K, Murphy C, Kirstein B, Fox SW, Chambers TJ 2002 TNF-
potently activates osteoclasts, through a direct action independent of and strongly synergistic with RANKL. Endocrinology 143:11081118[Abstract/Free Full Text] - Collin-Osdoby P, Rothe L, Anderson, F, Nelson M, Maloney W, Osdoby P 2001 Receptor activator of NF-
B and osteoprotegerin expression by microvascular endothelial cells, regulation by inflammatory cytokines and role in human osteoclastogenesis. J Biol Chem 276:2065920672[Abstract/Free Full Text] - Lacey DL, Timms E, Tan H-L, Kelley MJ, Dunstan CR, Burgess T, Elliott R, Colombero A, Elliott G, Scully S, Hsu H, Sullivan J, Hawkins N, Davy E, Capparelli C, Eli A, Qian YX, Kaufman S, Sarosi I, Shalhoub V, Senaldi G, Guo J, Delaney J, Boyle WJ 1998 Osteoprotegerin (OPG) ligand is a cytokine that regulates osteoclast differentiation and activation. Cell 93:165176[CrossRef][Medline]
- Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuchi S-I 1998 Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis-inhibitory factor and is identical to TRANCE/RANKL. Proc Natl Acad Sci USA 95:35973602[Abstract/Free Full Text]
- Wong BR, Rho J, Robinson E, Orlinick J, Chao M, Kalachikov S, Cayani E, Bartlett 3rd FS, Frankel WN, Lee Sy, Choi Y 1997 TRANCE is a novel ligand of the tumor necrosis factor receptor family that activates c-jun N-terminal kinase in T cells. J Biol Chem 272:2519025194[Abstract/Free Full Text]
- Anderson DM, Maraskovsky E, Billingsley WL, Dougall WC, Tometsko ME, Roux ER, Teepe MC, DuBose RF, Cosman D, Galibert L 1997 A homologue of the TNF receptor and its ligand enhance T-cell growth and dendritic-cell function. Nature 390:175179[CrossRef][Medline]
- Arai F, Miyamoto T, Ohneda O, Inada T, Sudo T, Brasel K, Miyata T, Anderson DM, Suda T 1999 Commitment and differentiation of osteoclast precursor cells by the sequential expression of c-Fms and the receptor activator of nuclear factor
B (RANK) receptors. J Exp Med 190:17411754[Abstract/Free Full Text] - Jimi E, Akiyama S, Tsurukai T, Okahashi N, Kobayashi K, Udagawa N, Nishihara T, Takahashi N, Suda T 1999 Osteoclast differentiation factor (ODF) acts as a multifunctional regulator in murine osteoclast differentiation and function. J Immunol 163:434442[Abstract/Free Full Text]
- Kong Y-Y, Yoshida H, Sarosi I, Tan H-L, Timms E, Capparelli C, Morony S, Oliveira-dos-Santos AJ, Van G, Itie A, Khoo W, Wakeham A, Dunstan CR, Lacey DL, Mak TW, Boyle WJ, Penninger JM 1999 OPGL is a key regulator of osteoclastogenesis, lymphocyte development and lymph-node organogenesis. Nature 397:315323[CrossRef][Medline]
- Komuro H, Olee T, Kuhn K, Quach J, Brinson DC, Shikhman A, Valbracht J, Creighton-Avhermann L, Lotz M 2001 The osteoprotegerin/receptor activator of nuclear factor
B/receptor activator of nuclear factor
B ligand system in cartilage. Arthritis Rheum 44:27682776[CrossRef][Medline] - Fata JE, Kong Y-Y, Li J, Sasaki T, Irie-Sasaki J, Moorehead RA, Elliott R, Scully S, Voura EB, Lacey DL, Boyle WJ, Khokha R, Penninger JM 2000 The osteoclast differentiation factor osteoprotegerin-ligand is essential for mammary gland development. Cell 103:4150[CrossRef][Medline]
- Kartsogiannis V, Zhou H, Horwood NJ, Thomas RJ, Hards DK, Quinn JM, Niforas P, Ng KW, Martin TJ, Gillespie MT 1999 Localization of RANKL (receptor activator of NF-
B ligand) mRNA and protein in skeletal and extraskeletal tissues. Bone 25:525534[Medline] - Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Boyle WJ 1997 Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Cell 89:309319[CrossRef][Medline]
- Tsuda E, Goto M, Mochizuki S, Yano K, Kobayashi F, Morinaga T, Higashio K 1997 Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis. Biochem Biophys Res Commun 234:137142[CrossRef][Medline]
- Kwon BS, Wang S, Udagawa N, Haridas V, Lee ZH, Kim KK, Greene J, Li Y, Su J, Gentz R, Aggarwal BB, Ni J 1998 TR1, a new member of the tumor necrosis factor receptor superfamily, induces fibroblast proliferation and inhibits osteoclastogenesis and bone resorption. FASEB J 12:845854[Abstract/Free Full Text]
- Kwon B, Yu K-Y, Ni J, Yu G-L, Jang I-K, Kim Y-J, Xing L, Liu D, Wang S-X, Kwon BS 1999 Identification of a novel activation-inducible protein of the tumor necrosis factor receptor superfamily and its ligand. J Biol Chem 274:60566061[Abstract/Free Full Text]
- Gurney AL, Marsters SA, Huang A, Pitti RM, Mark M, Baldwin DT, Gray AM, Dowd P, Brush J, Heldens S, Schow P, Goddard AD, Wood WI, Baker KP, Godowski PJ, Askenazi A 1999 Identification of a new member of the tumor necrosis factor family and its receptor, a human ortolog of mouse GITR. Curr Biol 9:215218[CrossRef][Medline]
- Gibson UE, Heid CA, Williams PM 1996 A novel method for real time quantitative RT-PCR. Genome Res 6:9951001[Abstract/Free Full Text]
- LaFleur DW, Nardelli B, Tsareva T, Mather D, Feng P, Semenuk M, Taylor K, Buergin M, Chincilla D, Roschke V, Chen G, Ruben SM, Pitha PM, Coleman TA, Moore P 2001 Interferon-
, a novel type I IFN expressed in human keratinocytes. J Biol Chem 276:3976539771[Abstract/Free Full Text] - Chen C, Grzegorzewski KJ, Barash S, Zhao Q, Scneider H, Wang Q, Singh M, Pukac L, Bell AC, Duan R, Coleman T, Duttaroy A, Cheng S, Hirsch J, Zhang L, Lazard Y, Fischer C, Barber MC, Ma ZD, Zhang YQ, Reavey P, Zhong L, Teng B, Sanyal I, Ruben SM, Blondel O, Birse CE 2003 An integrated functional genomics screening program reveals a role for BMP-9 in glucose homeostasis. Nat Biotechnol 21:294301[CrossRef][Medline]
- Mangan DF, Robertson B, Wahl SM 1992 IL-4 enhances programmed cell death (apoptosis) in stimulated human monocytes. J Immunol 148:18121816[Abstract]
- Pannekoek H, Veerman H, Lambers H, Diergaarde P, Verweij CL, van Zonneveld AJ, van Mourik JA 1986 Endothelial plasminogen activator inhibitor (PAI): a new member of the Serpin family. EMBO J 5:25392544[Medline]
- Nechiporuk T, Urness LD, Keating MT 2001 ETL, a novel seven-transmembrane receptor that is developmentally regulated in the heart. ETL is a member of the secretin familiy and belongs to the epidermal growth factor-seven-transmembrane subfamily. J Biol Chem 276:41504157[Abstract/Free Full Text]
- Brigstock DR 2002 Regulation of endothelial cell function by connective tissue growth factor (CTGF) and cysteine-rich 61 (CYR61). Angiogenesis 5:153165[CrossRef][Medline]
- Quinn JMW, Elliott J, Gillespie MT, Martin TJ 1998 A combination of osteoclast differentiation factor and macrophage-colony stimulating factor is sufficient for both human and mouse osteoclast formation in vitro. Endocrinology 139:44244427[Abstract/Free Full Text]
- Nicholson GC, Malakellis M, Collier FM, Cameron PU, Holloway WR, Gough TJ, Gregorio-King C, Kirkland MA, Myers DE 2000 Induction of osteoclasts from CD14-positive human peripheral blood mononuclear cells receptor activator of nuclear factor-
B ligand (RANKL). Clin Sci 99:133140[Medline] - Black RA, Rauch CT, Kozlosky CJ, Peschon JJ, Slack JL, Wolfson MF, Castner BJ, Stocking KL, Reddy P, Srinivasan S, Nelson N, Boiani N, Schooley KA, Gerhart M, Davis R, Fitzner JN, Johnson RS, Paxton RJ, March CJ, Cerretti DP 1997 A metalloproteinase disintegrin that releases tumor necrosis factor-
from cells. Nature 385:729733[CrossRef][Medline] - Schneider P, MacKay F, Steiner V, Hofman K, Bodmer J-L, Holler N, Ambros C, Lawton P, Bixler S, Acha-Orbea H, Valmori D, Romero P, Werner-Favre C, Zubler RH, Browning JL, and Tschopp J 1999 BAFF, a novel ligand of the tumor necrosis factor family stimulates B cell growth. J Exp Med 189:17471756[Abstract/Free Full Text]
- Udagawa N, Takahashi N, Akutsu T, Tanaka H, Sasaki T, Nishihara T, Koga T, Martin TJ, Suda T 1990 Origin of osteoclasts: mature monocytes and macrophages are capable of differentiating into osteoclasts under a suitable microenvironment prepared by bone marrow derived stromal cells. Proc Natl Acad Sci USA 87:72607264[Abstract/Free Full Text]
- Takahashi N, Udagawa N, Tanaka S, Murakami H, Owan I, Tamura T, Suda T 1994 Postmitotic osteoclast precursors are mononuclear cells which express macrophage-associated phenotypes. Dev Biol 163:212221[CrossRef][Medline]
- Kodama H, Nose M, Niida S, Yamasaki A 1991 Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells. J Exp Med 173:12911294[Abstract/Free Full Text]
- Yoshida H, Hayashi S, Kunisada T, Ogawa M, Nishikawa S, Okamura H, Sudo T, Shultz LD, Nishikawa S 1990 The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene. Nature 345:442444[CrossRef][Medline]
- Takayanagi H, Ogasawara K, Hida S, Chiba T, Murata S, Sato K, Takaoka A, Yokochi T, Oda H, Tanaka K, Nakamura K, Taniguchi T 2000 T-cell-mediated regulation of osteoclastogenesis by signaling cross-talk between RANKL and IFN-
. Nature 408:600605[CrossRef][Medline] - Wei S, Wang WH, Teitelbaum SL, and Ross FP 2002 Interleukin-4 reversibly inhibits osteoclastogenesis via inhibition of NF-
B and mitogen-activated protein kinase signaling. J Biol Chem 277:66226630[Abstract/Free Full Text] - Takayanagi H, Kim S, Matsuo K, Suzuki H, Suzuki T, Sato K, Yokochi T, Oda H, Nakamura K, Ida N, Wagner EF, Taniguchi T 2002 RANKL maintains bone homeostasis through c-Fos-dependent induction of interferon-ß. Nature 416:744749[CrossRef][Medline]
- Parfitt AM 1998 Osteoclast precursors as leucocytes: importance of the area code. Bone 23:491494[Medline]
- Stanley ER 1994 Colony stimulating factor-1 (macrophage colony stimulating factor). In: Thompson A, ed. The cytokine handbook. San Diego: Academic Press; 387418
- Nocentini G, Giunchi L, Ronchetti S, Krausz LT, Bartoli A, Moraca R, Migliorati G, Riccardi C 1997 A new member of the tumor necrosis factor/nerve growth factor receptor family inhibits T cell receptor-induced apoptosis. Proc Natl Acad Sci USA 94:62166221[Abstract/Free Full Text]
- McHugh RS, Whitters MJ, Piccirillo CA, Young DA, Shevach EM, Collins M, Byrne MC 2002 CD4+CD25+ immunoregulatory T cells: gene expression analysis reveals a functional role for the glucocorticoid-induced TNF receptor. Immunity 16:311323[CrossRef][Medline]
- Shimizu J, Yamazaki S, Takahashi T, Ishida Y, Sakagushi S 2002 Stimulation of CD25+CD4+ regulatory T cells through GITR breaks immunological self-tolerance. Nat Immunol 3:135142[CrossRef][Medline]
- Yu K-Y, Kim HS, Song SY, Min S-S, Jeong JJ, Youn B-S 2003 Identification of a ligand for glucocorticoid-induced tumor necrosis factor receptor constitutively expressed in dendritic cells. Biochem Biophys Res Commun 310:433438[CrossRef][Medline]
- Kim JD, Choi BK, Bae JS, Lee UH, Han IS, Lee HW, Youn BS, Vinay DS, Kwon BS 2003 Cloning and characterization of GITR ligand. Genes Immun 4:564569[CrossRef][Medline]
- Shin H-H, Lee M-H, Kim S-G, Kwon BS, Choi H-S 2002 Recombinant glucocorticoid induced tumor necrosis factor receptor (rGITR) induces NOS in murine macrophages. FEBS Lett 514:275280[Medline]