help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2006-0609
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morvan Dubois, G.
Right arrow Articles by Demeneix, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morvan Dubois, G.
Right arrow Articles by Demeneix, B. A.
Endocrinology Vol. 147, No. 10 4941-4949
Copyright © 2006 by The Endocrine Society

Deiodinase Activity Is Present in Xenopus laevis during Early Embryogenesis

Ghislaine Morvan Dubois, Anthony Sebillot, George G. J. M. Kuiper, Carla H. J. Verhoelst, Veerle M. Darras, Theo J. Visser and Barbara A. Demeneix

Department of Regulations, Development, and Molecular Diversity (G.M.D., A.S., B.A.D.), Muséum National d’Histoire Naturelle, 75231 Paris, France; Department of Internal Medicine (G.G.J.M.K., T.J.V.), Erasmus Medical Center, 3015 GE Rotterdam, The Netherlands; Laboratory of Comparative Endocrinology (C.H.J.V., V.M.D.), Katholieke Universiteit Leuven, B-3000 Leuven, Belgium; and Watchfrog SAS (A.S.), c/o Muséum National d’Histoire Naturelle, 75321 Paris, France

Address all correspondence and requests for reprints to: Professor Barbara Demeneix, Unité Mixte de Recherche Centre National de la Recherche Scientifique 5166, Evolution des Régulations Endocriniennes, Department of Regulations, Development, and Molecular Diversity, Museum National d’Histoire Naturelle, 7 Rue Cuvier, 75231 Paris Cedex 05, France. E-mail: demeneix{at}mnhn.fr.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thyroid hormones orchestrate amphibian metamorphosis. The type 2 and type 3 deiodinases make vital contributions to this process by controlling levels of the thyroid hormones T4 and T3 available to different tissues. Because the tadpole thyroid gland is not functional until stage NF44, it has been widely assumed that thyroid signaling is absent during amphibian early development, thyroid hormone only becoming a major regulator during premetamorphic stages. Similarly, in mammals, thyroid function is known to be essential to neuronal development, especially during the perinatal stages, but again little is known about early stages of development. Here we demonstrate that key elements of thyroid hormone signaling are present during early development of Xenopus. In particular, we find functional thyroid hormone-activating deiodinases and significant levels of their substrates, T4 and T3, during early embryogenesis. Furthermore, we have further characterized a recently identified deiodinase in amphibians, homologous to mammalian type 1 deiodinase (D1). This enzyme is expressed in marked, spatially defined patterns during embryogenesis. The patterns of expression of type 1 deiodinase are distinct from those of type 2 and type 3 deiodinases. Deiodinase expression is found in neurogenic areas from stage NF30 onward, both in the central and peripheral nervous systems. We conclude that both activating and inactivating deiodinases show dynamic patterns of expression during early embryogenesis in amphibians, particularly in neurogenic areas. These findings suggest that thyroid hormone signaling is a key component of early neuronal development in vertebrates.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THYROID HORMONES (TH) are essential actors in many aspects of vertebrate physiology, being particularly important for the development and maintenance of metabolic homeostasis in the mature animal. The role of TH during development is particularly important for brain maturation in mammals and metamorphosis in amphibians (1). Amphibian metamorphosis is a complex morphogenic event that is entirely orchestrated by TH, with peaks of plasma levels of TH coinciding with metamorphic climax (see Ref. 2 for review).

The major circulating form of TH is T4, which is converted into T3 by deiodinases. TH availability in peripheral tissues is tightly regulated by deiodinases. Deiodinases are selenoproteins that catalyze the deiodination of TH. Three deiodinases have been characterized in different vertebrates. Type 2 deiodinase (D2) converts the prohormone T4 into the receptor-active form T3 via the outer ring or 5' deiodination (ORD). Expression of D2 in Xenopus has been shown to correlate with the beginning of metamorphosis when it is expressed in developing limb buds (3). Type 3 deiodinase (D3) converts, via inner ring or 5 deiodination (IRD), T4 and T3 into the inactive forms, reverse T3 (rT3) and 3,3'-diiodothyronine, respectively. D3 has also been characterized and its expression studied in amphibians. Overexpression of D3 in Xenopus laevis protects tissues from induced metamorphosis and blocks natural metamorphosis of certain tissues such as the tail (4). The type 1 deiodinase (D1) has been identified in mammals and birds (5, 6) and more recently in fish (7, 8). D1 carries out both ORD and IRD reactions and thus can be seen as either an activating or inactivating deiodinase. In mammals and birds, D1 is sensitive to inhibition by propylthiouracil (PTU) (9). However, in amphibians PTU treatment is without effect on deiodinase activity (9). Such findings led to the assumption that D1 does not exist in amphibians (10), whereas PTU-insensitive D1s were characterized in teleosts (7). However as successive versions of the X. tropicalis genome have been released, it has become possible to independently assess the presence or absence of D1 in Xenopus. The first report of the functional characterization of a new deiodinase in amphibians, orthologous to mammalian D1, was that of Kuiper et al. (11), who identified an amino acid substitution responsible for the insensitivity of Xenopus D1 to PTU.

Most research on thyroid action during vertebrate development has concentrated on either amphibian metamorphosis (see Ref. 12) or neuronal development in the maturing mammalian brain (see Ref. 13). In both cases the developmental phase considered correlates with a period of high TH availability from an active thyroid gland functioning within a hypothalamo-pituitary-thyroid axis that is not yet subject to full feedback control. Indeed, in the postnatal mouse (14) and rat (15, 16), circulating levels of TH rise over the first 2 postnatal weeks to levels beyond those of adults before equilibrating around 3 wk at adult levels. In the Xenopus tadpole, thyroid gland organogenesis begins around stage NF40 and iodine uptake is detectable by stage NF46 (see Materials and Methods for animal staging) (2), coincident with histological signs of secretory activity. Measurable levels of T4 and T3 are found in the plasma of stage NF52 animals (17, 18). From this and the apparent insensitivity to T3 treatment of the embryos before stage 50, it was generally assumed that TH signaling during amphibian development becomes relevant only in premetamorphic stages (NF50-NF57).

After having identified the D1 sequence in Xenopus (11), we first looked for D1 mRNA expression in brains of stage NF35 embryos and premetamorphic and metamorphic tadpoles (stages NF52 and NF60). These developmental stages were chosen because NF35 is the earliest stage for which the D2 expression pattern had been observed (3). No evidence was available for any activating deiodinase before this stage. To our surprise, we also found strong D1 mRNA expression in the embryos. We thus investigated in more detail expression of the D1, D2, and D3 mRNAs in early Xenopus development (from the egg to stage NF40) using both quantitative real-time PCR (QPCR) and in situ hybridization. Because the encoding D1 and D2 mRNA (activating deiodinases) were expressed in embryos from early embryonic stages (NF12.5), we investigated whether they were translated and processed into active deiodinases. To this end, we assayed D1 and D2 enzymatic activity at stage NF35. We then addressed the question of their ligand availability by measuring TH levels in eggs and NF35-NF37 embryos. Taken together, the dynamic expression patterns of each deiodinase during embryogenesis, the presence of correctly translated/processed deiodinases, the amount of maternally provided TH, and the in vivo conversion of T4 to T3 at early embryonic stages led us to propose that TH signaling contributes to early amphibian development. This is contrary to the previously held hypothesis that TH signaling in amphibians becomes biologically relevant only from the premetamorphic stages onward (2).


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals
X. laevis embryos and tadpoles used for RNA extractions experiments and in situ hybridization experiments were raised in the Xenopus facility at Muséum National d’Histoire Naturelle, Paris. Staging was determined by following the Nieuwkoop and Faber developmental tables (19). The laboratory has the official approval of the Institutional Animal Care and Use Committee of the Animal Protection and Health, Veterinary Services Direction, Paris (France) for breeding and raising Xenopus. All aspects of animal care and experimentation performed in this study were in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.

Xenopus D1 identification
D1 sequence was characterized by carrying out a basic local alignment search tool (BLAST) search on the X. tropicalis genome, with the mouse D1, D2, and D3 cDNA sequences. Because the X. tropicalis genome is not yet fully assembled, the exact chromosomic localization cannot be given. However, this assembly is composed of overlapping genomic sequences, which are assembled into scaffolds, covering the major part of the genome. The best tBlastn (translated BLAST) for each murine deiodinase on X. tropicalis V4 assembly (http://genome.jgi-psf.org/Xentr4/Xentr4.home.html) is given in Results. Contig numbers are those provided in JGI Assembly V4. (http://genome.jgi-psf.org/Xentr4/Xentr4.home.html).

Phylogenetic analysis
Phylogenetic analysis was performed using PAUP 4 (phylogenetic analysis using Parsimony, version 3.1.1; Sinauer Associates, Sunderland, MA). Amino acid sequences of the vertebrate deiodinases were aligned with the newly characterized X. tropicalis and X. laevis D1. Phylogenetic analysis was performed on manually corrected alignments. The data set was treated by distance analysis using both the neighbor joining method and the Parsimony method. All D2 primary sequences were used as a monophyletic outgroup. One thousand bootstrap replicates were carried out to assess the robustness of the tree.

Real-time PCR quantification
Tadpoles were killed by decapitation, frozen in liquid nitrogen, and stored at –80 C. Embryos were killed in liquid nitrogen and stored at –80 C. RNA extraction was performed using RNable reagent (Eurobio, les Ulis, France), according to the manufacturer’s guidelines. RNA was treated with 2 U/ml DNase and precipitated in ethanol. After resuspension, the amount and purity of the total RNA was determined by spectrophotometer. Two micrograms of total RNA were used in each 20-µl RT-PCR, which was carried out at 42 C with 100 U Superscript II (Invitrogen, Cerfy-Pontoise, France) per microgram of RNA and 12.5 ng/µl oligodT primers (final concentration). After RT-PCR, real-time PCRs were performed using an MX3000, with Brilliant SYBR Green reagent (Stratagene, Amsterdam, The Netherlands) using 6 ng for each specific primer. Using MX3000P software (Stratagene), the amount of mRNA was normalized against an endogenous control mRNA for each independent RT-PCR: ornithine decarboxylase (ODC) mRNA for eggs to stages NF40 and ribosomal protein light chain 8 (RPL8) mRNA for stage 52 tadpoles. The diagrams of the calculated relative amounts of mRNA were prepared with Excel (Microsoft, Redmond, CA). Primers used were: D1 forward, GAAATCATGTGGATGCGGCTA and reverse, ATGCCCATTCATCTGCTGCA; D2 forward, AGGCTGAGTGTGGACTTGCT and reverse, CCATTGACTCTGGCTGGATT; D3 forward, AGGCAACGGGACACAATAAC and reverse, GTCGTTTGGTCGCACTTTTT; and ODC forward, GATGCCTTTTATGTTGCTGATTT and reverse, TGAAAACATGGGTGCCTACA.

In situ hybridization
Sense and antisense probes were prepared by performing RT-PCR on a pool of RNA extracted from embryos and tadpoles ranging from stage NF20 to stage NF58. The PCR fragments (D1: 538 bp, forward, CAAACGATTAAGCTGATGCT, and reverse, AGCCGATCCTGGAGACTTC; D2: 586 bp, forward, AATGCTCTGTGCTCTCCAG and reverse, TTCTTCCTGCCAAGTTTGC; D3: 523 bp, forward, AGGCAACGGGACACAATAAC and reverse, CTGACGGGTGCGCTTCTTC) were cloned using the TOPO TA cloning kit dual promoter (Invitrogen) and sequenced to check orientation. Probes were synthesized using the digoxigenin (DIG) labeling kit (Roche, Meylan, France). In situ hybridization was performed on whole embryos. Embryos were rapidly dissected and fixed overnight in 4% paraformaldehyde in PBST (PBS, 0.1% Tween 20) at 4 C, rinsed in PBST, progressively dehydrated through methanol series, and stored for at least 2 h in 100% methanol at –20 C. After rehydration in PBST, the embryos were treated with 15 mg/ml proteinase K (Fluka; sold by Sigma, St Quentin Fallavier, France) for 10 min (NF24-NF30) or 15 min (NF31-NF40) at room temperature, washed in PBST, and postfixed in 4% paraformaldehyde in PSBT for 15 min. Embryos were then prehybridized for 2 h at 65 C in 50% formamide, 5x saline sodium citrate (SSC), 1% sodium dodecyl sulfate, 50 µg/ml heparin, and 50 µg/ml yeast RNA. DIG-labeled RNA probe was added (1.5 µg/ml) to the prehybridization buffer and hybridization carried out overnight at 65 C. Embryos were washed twice in 50% formamide/2x SSCT for 30 min each time at 65 C and then in 2x SSCT for 20 min and twice in 0.2x SSCT (SSC plus 0.1% Tween 20) for 30 min. Samples were preblocked with 10% decomplemented goat serum (Sigma) for 60–120 min and incubated overnight at 4 C with alkaline phosphatase-conjugated antidigoxigenin antibody (Roche) diluted 1:5000. The enzyme activity was detected by addition of 5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium chloride (Roche). Embryos were then postfixed and pigments were bleached in 0.01% formamide, 5 mM NaCl, 3% H2O2. Embryos were cleared in glycerol and photographed with a MZ12.5 stereomicroscope (Leica, Rueil Malmaison, France).

Iodothyronine deiodinase activity assays
Iodothyronine deiodinase activities were assayed essentially as previously described (20, 21). Tissues were homogenized in 10 volumes of 0.1 M phosphate (pH 7.2), 2 mM EDTA, and 1 mM dithiothreitol and immediately analyzed for deiodinase activities. ORD activities were assayed by isolation of the radioiodide released from outer ring-labeled T4 on Sephadex LH-20 as well as analysis by HPLC of the formation of radioactive T3 and iodide. IRD activity was assayed by HPLC analysis of the formation of radioactive rT3 and 3,3'-3,3'-diiodothyronine from outer ring-labeled T4 and T3, respectively. Incubation mixtures usually contained 1 nM [3',5'125I]T4 or [3'-125I]T3 and approximately 0.5 mg/ml homogenate protein in 0.1 M phosphate (pH 7.2), 2 mM EDTA, and 10 mM dithiothreitol and were incubated for 1 h at 37 C. Parallel incubations were carried out with lysates of HEK293 cells transfected with wild-type xlD1, a construction allowing the overexpression of X. laevis (xl) D1 (11). If required, incubations were carried out in the presence of various concentrations of unlabeled T4, rT3, T3, or goldthioglucose (GTG). Deiodination in the presence of either tissue or cell protein extract was corrected for the small amount of product detected after incubation without protein.

In vivo regulation of the expression of deiodinases by TH
NF52 tadpoles were first treated with 1 g/liter perchlorate for at least 1 month to block TH production and deplete tadpoles of endogenous TH. Then tadpoles were either untreated (no T3) or placed in similar aquaria containing 10–7 M T3 or 10–9 M T3 for 24 h. Tadpoles were anesthetized on ice and then frozen in liquid nitrogen. Total RNA was extracted and real-time PCR was performed with the D1, D2, and D3 primers described above, except that RPL8 was used as an endogenous control (primers: forward, TGGCAATGTACTCCCTGTTG and reverse, TTGCTGGAGGTGGTCGTATT). Statistical analysis was performed using Instat2 (GraphPad, San Diego, CA) to apply unpaired Student’s t test.

Measurement of TH in eggs and embryos
The method for T3 and T4 extraction was described in detail previously (22) and was based on a method developed by Escobar et al. (23). A known number of eggs or embryos (25, 50, 75, or 100 for a total weight ranging between 140 and 600 mg) was homogenized in a volume of methanol at least 3 times the weight of the tissue. Then 1500 cpm of outer ring-labeled [131I] T3 and [125I] T4 were added as internal recovery tracers. After adding chloroform (2x volume of methanol) mixing and centrifugation, the pellet was reextracted in a mixture of chloroform-methanol (2:1). Backextraction into an aqueous phase (0.05% CaCl2) was followed by reextraction with a mixture of chloroform/methanol/0.05%CaCl2 (3:49:48), and TH in this phase was further purified on AG 1-X2 resin columns (Bio-Rad, Marnes La Coquette, France). The TH were eluted with 70% acetic acid, evaporated to dryness, and taken up in RIA buffer (24). The recovery for the extractions normally ranges from 50 to 75% for T3 and 40 to 60% for T4. T3 and T4 in the extracts were measured by RIA as described previously (24). These results were used to calculate the average amount of T3 and T4 present per individual egg or embryo for each batch. Statistical analysis was performed using Instat2 to apply unpaired Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Characterization of X. tropicalis and X. laevis D1 deiodinases
Briefly, mouse cDNAs encoding the three deiodinases (D1, D2, and D3) were used as input sequences to BLAST the X. tropicalis genome (see Materials and Methods). Each mouse deiodinase cDNA gave a match in scaffolds 1, 416, and 222. No scaffold other than 1, 416, and 222 presented satisfactory matches. However, each murine deiodinase had a higher score for only one scaffold in the X. tropicalis genome. These scaffolds were distinct for each deiodinase. We can thus assume that the isolated Xenopus coding sequences (CDSs) are each orthologous to a corresponding mouse deiodinase cDNA.

The three CDS matching deiodinases were isolated and their percent identity, at the nucleotidic level, with the three murine deiodinases calculated. The overall percentage of nucleotide identity between the mouse cDNA sequences and homologous CDSs on the different scaffolds of the X. tropicalis V4 assembly was more than 40%.

Table 1Go provides data on the homologies and amino acid identities of deiodinases currently identified in different amphibians. Note that there is more than 90% amino acid identity for each deiodinase between the two Xenopus species. Establishment of a phylogenetic tree (Fig. 1Go) shows that Xenopus D1 forms a monophyletic group with fish and mammalian D1. Clustering patterns show that each deiodinase (D1, D2, D3) forms a monophyletic group, supported by high bootstrap scores. Note also that the neighbor-joining method shows the D2 branches to be shorter than those for D1 and D3, reflecting greater conservation of this enzyme. The same tree topology was obtained both with the neighbor-joining and Parsimony methods (data not shown).


View this table:
[in this window]
[in a new window]
  		TABLE 1. Summary of identity observed between the currently characterized amphibian deiodinase amino acid sequences

 

Figure 1
View larger version (29K):
[in this window]
[in a new window]
  		FIG. 1. Neighbor-joining phylogenetic tree for vertebrate deiodinases. Phylogenetic analysis on vertebrate D1, D2, and D3 amino acid sequences was performed using the neighbor-joining method. Bootstrap values from 1000 replicates are indicated for each node. Note that each deiodinase family is monophyletic and that using the neighbor-joining method, the D2 branches are shorter than those of D1 and D3, showing greater conservation. The same topology is obtained with the maximum Parsimony method.

 
D1, D2, and D3 mRNA are expressed during embryogenesis
To determine the expression patterns of each deiodinase gene during embryogenesis, we used QPCR and in situ hybridization. In all cases the deiodinase mRNA level was normalized against that of ODC. As shown in Fig. 2Go, QPCR of X. laevis eggs and whole embryos up to stage NF40 (early larval stages) demonstrated that each deiodinase gene shows a distinct profile of expression. We found maternally expressed D1 mRNA in the eggs and then that D1 mRNA also increases throughout embryogenesis and into early larval stages. Most noticeably, D1 mRNA levels peaked around late embryonic stages NF35 and NF37, reaching levels 10-fold higher than those in early embryogenesis (NF14). D2 mRNA levels showed a distinct and dynamic pattern of expression, with changes of more than 10-fold during the period examined. No maternal mRNA encoding D2 was found in the egg. During embryogenesis two major waves of D2 mRNA expression were discerned, the first around stages NF12 and NF14 (neurula) and then again at stages NF31-NF37 (late embryogenesis). There was no D3 expression in eggs, whereas D3 mRNA levels in embryos appeared fairly constant throughout early embryogenesis, peaking only at stage NF37, during which D3 mRNA showed a 3-fold increase.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
  		FIG. 2. D1, D2, and D3 genes are expressed in X. laevis embryos from early stages of development. D1, D2, and D3 mRNAs from three pools of 10 eggs and embryos through to stage NF40 were quantified by QPCR and normalized against ODC mRNA. A, D1 gene expression shows maternal expression and a peak at stage NF37. B, D2 gene expression shows two marked periods of expression before and after stage NF24. C, D3 gene expression rises abruptly at stage NF37. The experiment was repeated three times from three distinct series of extractions, providing similar results for each run. Representative profiles are shown. Stage NF35 deiodinase gene expression is taken as the reference level.

 
We next used in situ hybridization to determine the embryonic tissue distribution for each deiodinase mRNA, in particular comparing the pattern of D1 mRNA with that of D2 and D3. We used depigmented embryos (see Materials and Methods) to avoid confusion of melanin and melanophores with the in situ signals, which were detected with 5-bromo-4-chloro-3-indolyl-phosphate/nitro blue tetrazolium chloride (see Materials and Methods) giving a dark blue signal. As shown in Fig. 3Go, A and B, strong expression of each deiodinase mRNA was found in the head region and axial structures of stage NF30 and NF35 X. laevis embryos. Note that NF stage 35 was chosen because this stage was used for the deiodination assay shown in this paper. Also the levels of expression of D1, D2, and D3 mRNAs were almost as strong as the maximum levels seen at stage 37. However, the different deiodinase gene expression patterns did not fully overlap. Examination of the whole mount staining (Fig. 3AGo) showed that D1 gene expression was strong in the notochord and branchial arches and lower around the eye and in the brain (Fig. 3AGo, a). Expression of D2 (Fig. 3AGo, b) was observed around the eye and in the neural tube but was absent from the notochord. The D3 mRNA level was particularly strong around the branchial arch areas and around the eye but was also present in the neural tube (Fig. 3AGo, c). Lateral views (Fig. 3AGo, d and e) of a NF35 embryo showed strong expression of D1 round the eye, branchial arches, and dorsal fin. Examination of sections (Fig. 3BGo) confirmed these distributions and showed marked expression of deiodinase genes in the cerebral ventricular zone, known to be neurogenic areas (3). The absence of labeling with the D3 sense probe in this region of a stage NF35 embryo is also shown (Fig. 3BGo, far right panel).


Figure 3
View larger version (78K):
[in this window]
[in a new window]
  		FIG. 3. mRNAs encoding D1, D2, and D3 are expressed in the head region and axis of stage NF30 and NF35 X. laevis embryos. A, upper panels (a–f), In situ hybridization on whole-mount embryos was performed with specific probes for each deiodinase. a and e, D1; b and f, D2; c and g, D3; d and h, sense control for D3. a–e, Stage NF 30; f–h, stage NF 35. a, Eye position is shown by a white dotted line. Nt, Notochord; sp, spinal chord; v, ventricular zone. Bar, 50 µM. B, Serial cryostat sections along the anterio (A)-posterior (P) axis (through the head to trunk region) of stage NF35 embryos. In situ hybridization was performed on whole-mount embryos before cryosection. Sections are all oriented following the dorso (D)-ventral (V) axis. Images a, e, and i show sections hybridized with a D1 antisense probe. Pictures b, f, and j with a D2 antisense probe and pictures and c, g, and k with a D3 antisense probe. Images d, h, and l show sections through the head to trunk region of a stage NF35 embryo hybridized with a D1 sense probe. V, Ventricular zone. Bar, 20 µm.

 
D1 expression patterns change during development
Because this gene was recently identified, we next examined the expression patterns of the D1 gene during late embryogenesis. Stages NF35 (Fig. 4AGo), NF37 (Fig. 4BGo), and NF40 (Fig. 4CGo) (stages around the peak of expression) showed distinct expression patterns on whole mounts (Fig. 4Go). Most notable in the dorsal views was the strong expression around the brain ventricle at stage NF35. Expression decreased slightly in this area at stage NF37 and more markedly at stage NF40. At all stages expression was maintained in the eye area.


Figure 4
View larger version (62K):
[in this window]
[in a new window]
  		FIG. 4. D1 gene expression is concentrated in the eye region and the ventricular zone of the developing X. laevis brain. Whole-mount in situ hybridization with the antisense D1 probe at different stages of development shows marked expression in neurogenic areas at stages NF35 (A), NF37 (B), and NF40 (C). V, Ventricular zone. Bars, 50 µm.

 
Deiodination occurs in early Xenopus embryos
Having shown that mRNA for each deiodinase was measurable by real-time PCR in embryos at most stages of embryonic development examined and that their expression patterns are distinct and dynamic, we next addressed the question of whether activating deiodinase activities (D1 and D2) could be detected in Xenopus embryos. To this end, we used stage NF35 embryos and assayed D1 and D2 activities in the head and trunk regions. The hypothesis was tested that head structures of stage NF35 Xenopus embryos express D1 activity, as characterized for the recombinant enzyme in Kuiper et al. (11). Figure 5AGo shows that stage NF35 embryo heads contain significantly higher T4 ORD activity than the trunk region and lower levels (around 25%) than the deiodination of T4 detected in cells transfected with xlD1. At this stage, the embryonic Xenopus tissues had predominantly ORD activity, as indicated by the roughly equivalent generation of radioactive T3 and iodide from [3',5'-125I] T4 (Fig. 5BGo). Most of the T4 ORD activity observed in the embryonic Xenopus tissues represent predominantly D2 activity because it was saturated at much lower T4 concentrations than those required to saturate the recombinant xlD1 (11) (Fig. 5Go, B and C). Furthermore, the apparent Michaelis constant (Km) value of T4 for the global deiodinase activity was approximately 10 nM, whereas the Km of T4 for the recombinant xlD1 was estimated to be 0.3 µM. The deiodination of T4 by the native enzyme was almost completely inhibited by 1 µM rT3 but was little affected by up to 1 µM T3 (Fig. 5BGo). In contrast to the potent inhibition of recombinant xlD1 by GTG, with an IC50 value of approximately 10 nM, approximately 100-fold higher concentrations of the GTG were needed to inhibit the native deiodinase activity (Fig. 5DGo), suggesting a minor contribution of deiodination by D1. These findings strongly support a major role of D2 in the ORD of T4 by stage NF35 Xenopus embryo tissues.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
  		FIG. 5. Functional T4 deiodination occurs in early X. laevis embryos (NF35) and implicates both D1 and D2 enzymes. A, Release of radioiodide during incubation of 1 nM [125I]T4 for 1 h at 37 C with homogenates of embryonic Xenopus tissues or HEK293 cells transfected with wild-type xlD1. B, Generation of radioactive iodide and T3 during incubation of 1 nM [125I]T4 for 1 h at 37 C with embryonic Xenopus head homogenate in the absence or presence of 0.1 or 1 µM unlabeled T4, T3, or rT3. C, Effects of increasing T4 concentrations on the ORD of [125I]T4 during incubation for 1 h at 37 C with deiodinase activity in embryonic Xenopus head or recombinant xlD1 in HEK293 cells. D, Effects of increasing GTG concentrations on the ORD of 1 nM [125I]T4 during incubation for 1 h at 37 C with deiodinase activity in embryonic Xenopus head or recombinant xlD1 in HEK293 cells. C, Figures indicate percentage of substrate deiodinated. D, Figures indicate percentage of substrate deiodination in the absence of inhibitor (control deiodination, 100%).

 
D1, D2, and D3 gene expressions are differentially regulated by T3
To examine whether the deiodinase genes were subject to control by TH, we studied perchlorate-treated tadpoles (stage NF52), devoid of endogenous TH. Tadpoles were exposed to two concentrations of T3 (10–7 and 10–9 M) for 24 h. QPCR was performed on RNA extracted from whole tadpoles, and normalization was performed with RPL8 mRNA. Figure 6Go shows that D2 and D3 but not D1 mRNA are regulated by T3 in a dose-dependent manner. An extremely significant (P < 0.001) difference of D2 mRNA expression is observed between the 10–7 M T3-treated group and the untreated group. A very significant (P < 0.01) difference of D3 mRNA expression is observed between the untreated and 10–9 M T3-treated groups. An extremely significant (P < 0.001) difference of D3 mRNA expression in observed between the untreated and 10–7 M T3-treated group. The mRNAs encoding both D2 and D3 were induced by increasing concentrations of T3, inductions being 9.5-fold at 10–7 M T3 for D2 and 4- and 21-fold at, respectively, 10–9 M T3 and 10–7 M T3 for D3. In contrast, T3 treatment did not modify expression of D1 mRNA at either concentration tested because no significant differences can be observed in D1 mRNA expression between the T3-treated and untreated groups.


Figure 6
View larger version (11K):
[in this window]
[in a new window]
  		FIG. 6. Xenopus deiodinase mRNAs are differentially regulated by T3 in premetamorphic tadpoles. QPCR was performed on mRNA extracted from perchlorated tadpoles blocked at stage NF52 and exposed for 24 h to 10–9 M T3 or 10–7 M T3. mRNA was extracted from whole tadpoles and used for real-time PCR analysis. Mean fold increases ± maximum and minimum fold increases (asymmetrical) are given; n = 4 amplifications per point carried out on six individual samples. Differences were analyzed by Student’s t test (see Materials and Methods). **, P < 0.01; ***, P < 0.001.

 
THs are present in eggs of X. laevis
Given that functional deiodinases were found in embryos and early larval stages, before thyroid organogenesis, we used RIA to investigate whether their substrates, T3 and T4, were found in X. laevis eggs. This question needed to be addressed because TH cannot be provided by food before stage 45, when the tadpoles begin to feed. First, we tested whether T4 and T3 were found in the egg envelope (referred to here as the chorion). Measurements on chorionated and dechorionated eggs from the same females showed no significant difference between T3 and T4 per individuals in the two conditions (data not shown). Up to 3-fold differences in mean levels were found among different females, but multiple measurements for eggs from the same female were consistent.

T3 is produced during embryogenesis of X. laevis
Figure 7Go shows the mean values for T3 and T4 in X. laevis eggs and stage NF35–37 embryos (from the same batches as the eggs) laid by five different females. Measurable amounts, in the femtomole range, of both hormones were found in eggs and embryos. There were no significant variations in T4 levels between eggs and embryos. In contrast, a significant difference (P < 0.05) was observed between the mean of T3 measured in eggs and NF 35–37 embryos. T3 was increased (3-fold) at stage 35–37, compared with the level observed in eggs.


Figure 7
View larger version (13K):
[in this window]
[in a new window]
  		FIG. 7. T3 levels increase during Xenopus embryogenesis. RIA measurements of T3 and T4 in extracts from five different batches of eggs and five corresponding batches of embryos. Total amounts of TH were normalized by the number of eggs/embryos in each sample. The weighted means of the different measures for the same batch of eggs (i.e. same female, same condition) was considered as one sample. Differences were analyzed by Student’s t test (see Materials and Methods). *, P < 0.05.

 
Calculated on the basis of egg volume, the concentration of T4 in eggs is approximately 3–30 nM and that of T3, 0.4–0.7 nM.


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
These results and those presented in our earlier paper (11) identify and characterize cDNAs encoding a deiodinase, new in X. tropicalis and X. laevis, having the functional characteristics of a D1 enzyme. The present report also characterizes the spatiotemporal patterns of expression of this novel deiodinase in X. laevis embryos, compares its patterns of expression with those of D2 and D3 during the same developmental stages, and measures the actual deiodinase activity in embryos. The two major findings are first, that there is marked and differential expression of mRNAs encoding deiodinases during early development and second, that the main localization of their enzymatic activity is in the head area.

Having identified a new deiodinase gene, D1, in Xenopus, a first analysis was the in silico comparison of the three different deiodinase genes and their homologies with other vertebrate deiodinase genes. The phylogenetic tree shows that the newly characterized X. tropicalis and X. laevis D1 clearly cluster with mammalian D1. This finding supports the hypothesis that the homologies observed between Xenopus D1 and other vertebrate D1s, in particular in the catalytic site (see Ref. 11), are due to orthology and not convergence. We found more than 90% amino acid identity between each deiodinase gene in both Xenopus species. In particular, values are similar (around 92%) for both D1 and D3 between the two species. This result can be interpreted as showing that evolutionary constraints have been similar for both enzymes and that D1 is not simply a pseudogene, which would have been less subject to evolutionary constraints. D3 is known to be vital to metamorphosis in amphibians (4). The fact that D3 and D1 are equally conserved between the two Xenopus species suggests that D1 is also functional. Phylogenetic analysis supports the hypothesis that D1 enzymes form a monophyletic group in vertebrates and that the X. laevis and X. tropicalis D1 enzymes are members of this group, not resultant from duplications of either of the other deiodinase genes.

Most of the previous work on the role of deiodinases in amphibians has concentrated on the metamorphic period because metamorphosis is a totally T3-dependent process. Two main amphibian species have been studied in this light: X. laevis (3, 25, 26) and Rana catesbeiana (27, 28). In Xenopus, D2 and D3 activities have been shown to have major roles in determining the timing of tissue changes and controlling cellular responses. In particular, D2 has been shown to be involved in setting up the negative feedback loop exerted by TH on pituitary function (1, 3), with a delay in expression until the high circulating levels of TH are reached during metamorphic climax (3). Moreover, D2 expression is concomitant with the major tissue changes occurring during metamorphosis (including tail resorption, intestine and brain remodeling, and limb development) (2). In turn, D3 activity is differentially regulated during metamorphosis in certain cases, such as in the tail, being down-regulated as D2 is up-regulated (3). Moreover, D3 determines differential availability of active TH in the retina. Higher, constitutive, expression of D3 in the dorsal ciliary margin limits T3 availability, resulting in asymmetric replication of the ventral retina (26). Furthermore, overexpression of D3 in germinally transgenic tadpoles inhibits certain metamorphic changes such as tail resorption (4). These studies clearly demonstrate the vital and specific roles of deiodinases in controlling tissue availability of the receptor-active TH, T3, during metamorphosis.

However, few data are available on the expression patterns, and possible roles, of any of the three deiodinases in the early stages of development, and obviously there are no previous reports of D1 expression and function during these developmental stages in amphibians. However, mRNA encoding D2 and D3, as well as T3 signaling, has been shown to be present in embryonic mouse brain at embryonic d 15.5 (29). But in this situation, as opposed to amphibians, T3 could be provided maternally. Here we show that mRNAs encoding each of the deiodinases are expressed in distinct spatiotemporal patterns in early embryos (at stage NF35).

Most interestingly, we find that all the deiodinase mRNAs are expressed most abundantly in the head region. Expression in the trunk is localized to the notochord and dorsal fin from stage NF24 (data not shown) to NF35.

Functional and biochemical studies confirmed that deiodinase activity was present in embryos and that the activity was concentrated in the head region. The different experiments showed that the activity was mainly ORD when T4 was used as the substrate. The biochemical data indicate that D2 activity is the main ORD activity present, although we cannot exclude the contribution of D1 to this activity. Indeed, other authors have been unsuccessful in their attempts to demonstrate D1 activity in amphibians (2), but again these findings are no proof of D1 absence because one cannot exclude that homogenization of D1-expressing together with nonexpressing cells will reduce a highly localized enzyme activity to generally undetectable levels.

We also looked at T3-dependent regulatory effects on the mRNAs encoding each deiodinase. These regulations are probably direct because T3 treatment was limited to 24 h. Interestingly, the D3 gene was most sensitive to T3 treatment, being up-regulated between 10- and 20-fold in response to, respectively, 10–9 M T3 and 10–7 M T3. D2 mRNA levels were also up-regulated in response to T3, whereas D1 mRNA levels were unchanged. These results are consistent with previous results on deiodinase gene regulation by TH because amphibian D3 was reported to be much more sensitive than D2 to T3 induction (9). In most cases in which mammalian tissues were studied, the effect of T3 on D1 activity rather than mRNA levels was considered (see for review Ref. 2, 9). These studies led to the idea that mammalian D1 is positively regulated by T3, whereas our results show no regulation at the level of the whole organism level in X. laevis. This could be explained by distinct regulatory thresholds at the transcriptional and translational levels or distinct interspecies regulations.

Our discovery of D1, D2, and D3 gene expressions in early and late embryogenesis and the demonstration of an ORD activity at stage NF 35 raised the question of whether the substrates, T4 and T3 were present in the egg and early embryo. RIA applied to extracts of each showed amounts of both T4 and T3 to be in the femtomole range per egg and embryo. Calculating the concentrations on the basis of egg volume gave values for T4 in the 25–75 nM range, corresponding to the Km of D1 (200–400 nM; see Ref. 11) and above the Km of D2, which is in the low nanomolar range (9). These concentrations are physiologically relevant because circulating levels of TH are in the nanomolar range during amphibian metamorphosis (17, 30). Furthermore, the demonstration that T3 concentrations are higher in embryos than the eggs points to the functional role of activating deiodinases during early development. The fact that this increase in T3 was not accompanied by a significant decrease in the T4 pool can be accounted for by the high interindividual variability of the T4 concentrations in eggs, a variability that could mask subtle decreases during development.

Thus, both deiodinases and their substrates are present in early embryos, bolstering the idea that TH signaling is involved in early embryogenesis. However, to be borne out, such a hypothesis requires that TH receptors (TRs) also are present in the relevant tissues. Ongoing work on TRß in one of our laboratories (Havis, E., S. Le Mevel, G. Morvan Dubois, D.-L. Shi, T. S. Scanlan, B. A. Demeneix, and L. M. Sachs, submitted for publication) as well as the demonstration of an early expression of TR{alpha} (31) provides such demonstrations. Thus, taken together, these results show that the three main sets of key players in TH signaling, namely the TH, deiodinases, and TR, are present in early embryos. These findings are entirely novel and necessitate investigation of the actual role of TRs and TH signaling in early development.

Indeed, one important line of investigation would be to determine whether the presence of TH is sufficient to activate target genes. Liganded vs. nonliganded TRs respectively activate or repress TH target genes in metamorphosing tadpoles (32, 33). Thus, it is logical to predict that the interplay between the activating and inactivating deiodinases present in early embryos, producing spatiotemporal variations in availability of ligand, will also lead to complex patterns of TH target gene activation and repression in early development. We find most marked expression of the deiodinases in the developing brain, a tissue that is known to be highly sensitive to TH at key stages of development in all vertebrates (34, 35). In mammals, the most TH-sensitive period of brain development is the perinatal period when brain growth is maximal (34). However, in the adult, a specific set of cells, the neural stem cells in the subventricular zone, also displays T3 sensitivity, T3 being required for neural stem cell cycling (36). Interestingly, in the early Xenopus embryo, deiodinase gene expression is also most marked in the neurogenic area around the ventricles, suggesting a role for TH signaling in early neurogenesis, as also proposed in mammals (37) and birds (38).

A final point is that recent findings on localization of TR, deiodinases, and TH transporters in specific cell types within given tissues (34, 39, 40, 41) are reinforcing the concept of distinct tissue and cellular specificities in TH action. Future studies on the role of TH in early embryogenesis and neurogenesis will have to integrate each of these components and place them in the context of specific cellular constraints and responses.


   Acknowledgments
 
We thank B. Querat for help in evolutionary analyses of sequences, G. Lemkine and L. M. Sachs for critical discussions and input, Samantha Richardson for careful reading of the manuscript, and J. P. Chaumeil and G. Benisti for animal care.


   Footnotes
 
This work was supported by the Association Française contre les Myopathies, European Union (Contract No. LSHM-CT-2005-018652; www.crescendoip.org), and Institut National de la Santé et de la Recherche Médicale (Action Thématique Concertée Vieillissement and Les Actions Concertées Incitatives Cellules souches Adultes). G.M.D. was a postdoctoral fellow from the Ligue contre le Cancer.

First Published Online July 6, 2006

Abbreviations: CDS, Coding sequence; D1, type 1 deiodinase; D2, type 2 deiodinase; D3, type 3 deiodinase; DIG, digoxygenin; GTG, goldthioglucose; IRD, inner ring or 5 deiodination; Km, Michaelis constant; ODC, ornithine decarboxylase; ORD, outer ring or 5' deiodination; PBST, PBS plus 0.1% Tween 20; PTU, propylthiouracil; QPCR, real-time quantitative PCR; RPL8, ribosomal protein light chain 8; rT3, reverse T3; SSC, saline sodium citrate; TH, thyroid hormone; TR, TH receptor.

Received May 5, 2006.

Accepted for publication June 23, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Huang H, Cai L, Remo BF, Brown DD 2001 Timing of metamorphosis and the onset of the negative feedback loop between the thyroid gland and the pituitary is controlled by type II iodothyronine deiodinase in X. laevis. Proc Natl Acad Sci USA 98:7348–7353[Abstract/Free Full Text]
  2. Brown DD 2005 The role of deiodinases in amphibian metamorphosis. Thyroid 15:815–821[CrossRef][Medline]
  3. Cai L, Brown DD 2004 Expression of type II iodothyronine deiodinase marks the time that a tissue responds to thyroid hormone-induced metamorphosis in X. laevis. Dev Biol 266:87–95[CrossRef][Medline]
  4. Huang H, Marsh-Armstrong N, Brown DD 1999 Metamorphosis is inhibited in transgenic X. laevis tadpoles that overexpress type III deiodinase. Proc Natl Acad Sci USA 96:962–967[Abstract/Free Full Text]
  5. Berry MJ, Larsen PR 1993 Molecular cloning of the selenocysteine-containing enzyme type I iodothyronine deiodinase. Am J Clin Nutr 57:249S–255S
  6. Van der Geyten S, Sanders JP, Kaptein E, Darras VM, Kuhn ER, Leonard JL, Visser TJ 1997 Expression of chicken hepatic type I and type III iodothyronine deiodinases during embryonic development. Endocrinology 138:5144–5152[Abstract/Free Full Text]
  7. Sanders JP, Van der Geyten S, Kaptein E, Darras VM, Kuhn ER, Leonard JL, Visser TJ 1997 Characterization of a propylthiouracil-insensitive type I iodothyronine deiodinase. Endocrinology 138:5153–5160[Abstract/Free Full Text]
  8. Orozco A, Villalobos P, Jeziorski MC, Valverde RC 2003 The liver of Fundulus heteroclitus expresses deiodinase type 1 mRNA. Gen Comp Endocrinol 130:84–91[CrossRef][Medline]
  9. Galton VA 2005 The roles of the iodothyronine deiodinases in mammalian development. Thyroid 15:823–834[CrossRef][Medline]
  10. St. Germain DL, Hernandez A, Schneider MJ, Galton VA 2005 Insights into the role of deiodinases from studies of genetically modified animals. Thyroid 15:905–916[CrossRef][Medline]
  11. Kuiper GG, Klootwijk W, Morvan Dubois G, Destree O, Darras VM, Van der Geyten S, Demeneix B, Visser TJ 2006 Characterization of recombinant X. laevis type I iodothyronine deiodinase: substitution of a proline residue in the catalytic center by serine (Pro132Ser) restores sensitivity to 6-propyl-2-thiouracil. Endocrinology 147:3519–3529[Abstract/Free Full Text]
  12. Shi YB 1999 Amphibian metamorphosis. New York: John Wiley & Sons
  13. Bernal J 2002 Action of thyroid hormone in brain. J Endocrinol Invest 25:268–288[Medline]
  14. Hadj-Sahraoui N, Seugnet I, Ghorbel MT, Demeneix B 2000 Hypothyroidism prolongs mitotic activity in the post-natal mouse brain. Neurosci Lett 280:79–82[CrossRef][Medline]
  15. Dussault JH, Labrie F 1975 Development of the hypothalamic-pituitary-thyroid axis in the neonatal rat. Endocrinology 97:1321–1324[Abstract/Free Full Text]
  16. Escobar-Morreale HF, del Rey FE, Obregon MJ, de Escobar GM 1996 Only the combined treatment with thyroxine and triiodothyronine ensures euthyroidism in all tissues of the thyroidectomized rat. Endocrinology 137:2490–2502[Abstract]
  17. Leloup JBM 1977 La triiodothyronine: hormone de la métamorphose des amphibiens [in French]. C R Acad Sci 284:2261–2263
  18. Regard E, Taurog A, Nakashima T 1978 Plasma thyroxine and triiodothyronine levels in spontaneously metamorphosing Rana catesbeiana tadpoles and in adult anuran amphibia. Endocrinology 102:674–684[Abstract/Free Full Text]
  19. Nieuwkoop PD 1955 Independent and dependent development in the formation of the central nervous system in amphibians: a review of experimental analysis. Exp Cell Res:262–273
  20. Kester MH, Martinez de Mena R, Obregon MJ, Marinkovic D, Howatson A, Visser TJ, Hume R, Morreale de Escobar G 2004 Iodothyronine levels in the human developing brain: major regulatory roles of iodothyronine deiodinases in different areas. J Clin Endocrinol Metab 89:3117–3128[Abstract/Free Full Text]
  21. Richard K, Hume R, Kaptein E, Sanders JP, van Toor H, De Herder WW, den Hollander JC, Krenning EP, Visser TJ 1998 Ontogeny of iodothyronine deiodinases in human liver. J Clin Endocrinol Metab 83:2868–2874[Abstract/Free Full Text]
  22. Reyns GE, Janssens KA, Buyse J, Kuhn ER, Darras VM 2002 Changes in thyroid hormone levels in chicken liver during fasting and refeeding. Comp Biochem Physiol B Biochem Mol Biol 132:239–245[CrossRef][Medline]
  23. Morreale de Escobar G, Calvo R, Escobar del Rey F, Obregon MJ1994 Thyroid hormones in tissues from fetal and adult rats. Endocrinology 134:2410–2415
  24. Van der Geyten S, Toguyeni A, Baroiller JF, Fauconneau B, Fostier A, Sanders JP, Visser TJ, Kuhn ER, Darras VM 2001 Hypothyroidism induces type I iodothyronine deiodinase expression in tilapia liver. Gen Comp Endocrinol 124:333–342[CrossRef][Medline]
  25. Marsh-Armstrong N, Cai L, Brown DD 2004 Thyroid hormone controls the development of connections between the spinal cord and limbs during X. laevis metamorphosis. Proc Natl Acad Sci USA 101:165–170[Abstract/Free Full Text]
  26. Marsh-Armstrong N, Huang H, Remo BF, Liu TT, Brown DD 1999 Asymmetric growth and development of the X. laevis retina during metamorphosis is controlled by type III deiodinase. Neuron 24:871–878[CrossRef][Medline]
  27. Davey JC, Schneider MJ, Galton VA 1994 Cloning of a thyroid hormone-responsive Rana catesbeiana c-erbA-beta gene. Dev Genet 15:339–346[CrossRef][Medline]
  28. Becker KB, Stephens KC, Davey JC, Schneider MJ, Galton VA 1997 The type 2 and type 3 iodothyronine deiodinases play important roles in coordinating development in Rana catesbeiana tadpoles. Endocrinology 138:2989–2997[Abstract/Free Full Text]
  29. Quignodon L, Legrand C, Allioli N, Guadano-Ferraz A, Bernal J, Samarut J, Flamant F 2004 Thyroid hormone signaling is highly heterogeneous during pre- and postnatal brain development. J Mol Endocrinol 33:467–476[Abstract/Free Full Text]
  30. Regard E 1978 Cytophysiology of the amphibian thyroid gland through larval development and metamorphosis. Int Rev Cytol 52:81–118[Medline]
  31. Banker DE, Bigler J, Eisenman RN 1991 The thyroid hormone receptor gene (c-erbA{alpha}) is expressed in advance of thyroid gland maturation during the early embryonic development of X. laevis. Mol Cell Biol 11:5079–5089[Abstract/Free Full Text]
  32. Sachs LM, Damjanovski S, Jones PL, Li Q, Amano T, Ueda S, Shi YB, Ishizuya-Oka A 2000 Dual functions of thyroid hormone receptors during Xenopus development. Comp Biochem Physiol B Biochem Mol Biol 126:199–211[CrossRef][Medline]
  33. Havis E, Sachs LM, Demeneix BA 2003 Metamorphic T3-response genes have specific co-regulator requirements. EMBO Rep 4:883–888[CrossRef][Medline]
  34. Bernal J 2005 Thyroid hormones and brain development. Vitam Horm 71:95–122[CrossRef][Medline]
  35. Bernal J, Guadano-Ferraz A, Morte B 2003 Perspectives in the study of thyroid hormone action on brain development and function. Thyroid 13:1005–1012[CrossRef][Medline]
  36. Lemkine GF, Raj A, Alfama G, Turque N, Hassani Z, Alegria-Prevot O, Samarut J, Levi G, Demeneix BA 2005 Adult neural stem cell cycling in vivo requires thyroid hormone and its {alpha} receptor. FASEB J 19:863–865[Abstract/Free Full Text]
  37. de Escobar GM, Obregon MJ, del Rey FE 2004 Maternal thyroid hormones early in pregnancy and fetal brain development. Best Pract Res Clin Endocrinol Metab 18:225–248[CrossRef][Medline]
  38. Flamant F, Samarut J 1998 Involvement of thyroid hormone and its {alpha} receptor in avian neurulation. Dev Biol 197:1–11[CrossRef][Medline]
  39. Friesema EC, Ganguly S, Abdalla A, Manning Fox JE, Halestrap AP, Visser TJ 2003 Identification of monocarboxylate transporter 8 as a specific thyroid hormone transporter. J Biol Chem 278:40128–40135[Abstract/Free Full Text]
  40. Friesema EC, Jansen J, Milici C, Visser TJ 2005 Thyroid hormone transporters. Vitam Horm 70:137–167[CrossRef][Medline]
  41. Jansen J, Friesema EC, Milici C, Visser TJ 2005 Thyroid hormone transporters in health and disease. Thyroid 15:757–768[CrossRef][Medline]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
C. N. Walpita, A. D. Crawford, E. D. R. Janssens, S. Van der Geyten, and V. M. Darras
Type 2 Iodothyronine Deiodinase Is Essential for Thyroid Hormone-Dependent Embryonic Development and Pigmentation in Zebrafish
Endocrinology, January 1, 2009; 150(1): 530 - 539.
[Abstract] [Full Text] [PDF]

Home page
 Endocr. Rev.Home page
B. Gereben, A. M. Zavacki, S. Ribich, B. W. Kim, S. A. Huang, W. S. Simonides, A. Zeold, and A. C. Bianco
Cellular and Molecular Basis of Deiodinase-Regulated Thyroid Hormone Signaling
Endocr. Rev., December 1, 2008; 29(7): 898 - 938.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Morvan Dubois, G.
Right arrow Articles by Demeneix, B. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Morvan Dubois, G.
Right arrow Articles by Demeneix, B. A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals