help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0098
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lambert, G.
Right arrow Articles by Costet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lambert, G.
Right arrow Articles by Costet, P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
*Substance via MeSH
Medline Plus Health Information
*Diets
*Genetics Home Reference
Endocrinology Vol. 147, No. 10 4985-4995
Copyright © 2006 by The Endocrine Society

Fasting Induces Hyperlipidemia in Mice Overexpressing Proprotein Convertase Subtilisin Kexin Type 9: Lack of Modulation of Very-Low-Density Lipoprotein Hepatic Output by the Low-Density Lipoprotein Receptor

Gilles Lambert, Anne-Laure Jarnoux, Thierry Pineau, Olivier Pape, Maud Chetiveaux, Christian Laboisse, Michel Krempf and Philippe Costet

Université de Nantes (G.L., A.-L.J., O.P., M.C., C.L., M.K., P.C.) , UFR de Médecine; Institut de la Santé et de la Recherche Médicale, Unité 539; Centre Hospitalier Universitaire Hôtel-Dieu, 44093 Nantes, France; and Laboratoire de Pharmacologie et Toxicologie (T.P.), Institut National de la Recherche Agronomique, 31000 Toulouse, France

Address all correspondence and requests for reprints to: Gilles Lambert, Institut National de la Santé et de la Recherche Médicale, Unité 539, Centre Hospitalier Universitaire Hôtel Dieu, 3eme étage Nord, 1 Place Alexis Ricordeau, 44093 Nantes cedex 1, France. E mail: gilles.lambert{at}univ-nantes.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Several proprotein convertase subtilisin kexin type 9 (PCSK9) mutations lead to familial hypercholesterolemia by virtue of its role as a negative modulator of the low-density lipoprotein receptor (LDLr). Here, we uncover that upon dietary challenge, the down-regulation of the LDLr is also a key mechanism by which PCSK9 modulates the hepatic production of apolipoprotein-B-containing lipoproteins. Thus, adenoviral-mediated overexpression of PCSK9 in 24-h fasted mice results in massive hyperlipidemia, due to a striking increase in very-low-density lipoprotein (VLDL) triglycerides and apolipoprotein B100 hepatic output. Similar studies in LDLr (–/–) mice demonstrate that PCSK9-mediated alteration of VLDL output in the fasted state requires the LDLr. This increased production of VLDL was associated with a concomitant reduction of intrahepatic lipid stores as well as a lack of down-regulation of peroxisome proliferator-activated receptor-{alpha} activity and target genes expression. Finally, we show that PCSK9 hepatic expression is inhibited by the hypotriglyceridemic peroxisome proliferator-activated receptor-{alpha} agonist fenofibrate. In summary, the negative modulation of LDLr expression by PCSK9, which decreases plasma LDL clearance, also promotes an overproduction of nascent VLDL in vivo upon fasting.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FAMILIAL HYPERCHOLESTEROLEMIA (FH) is characterized by elevated plasma low-density-lipoprotein (LDL), and deposition of LDL-cholesterol in tendons, skin (xanthomas), and arteries (atheroma), leading to premature cardiovascular events (1, 2). In most cases, FH is an autosomal dominant trait (autosomal dominant hypercholesterolemia) resulting from mutations either in the LDL receptor (LDLr) or in the ligand-binding domain of apolipoprotein (apo) B100 (3). Since 2003, several mutations in proprotein convertase subtilisin kexin type 9 (PCSK9) emerged as the third cause of autosomal dominant hypercholesterolemia (4, 5, 6, 7, 8, 9, 10). PCSK9 is expressed mainly in the liver and intestine and is thought to be involved in liver regeneration as well as neuronal differentiation (11). The first clue for a role for PCSK9 in cholesterol metabolism was a down-regulation of PCSK9 hepatic expression observed in cholesterol-fed mice (12). Conversely, PCSK9 gene expression is up-regulated in mice overexpressing sterol regulatory element-binding protein (SREBP)1a and SREBP2, two transcriptions factors activated by low levels of intracellular cholesterol (13), as well as in cultured hepatocytes depleted in cholesterol upon statin treatment (14).

But definitive evidence for a role for PCSK9 in lipoprotein metabolism has recently been established by a series of studies showing that adenoviral-mediated overexpression of PCSK9 promotes the accumulation of LDL in the plasma of control mice but not in that of LDLr-deficient animals (15, 16, 17). Moreover, hepatic LDLr levels are reduced in mice overexpressing PCSK9 (17). The expression of PCSK9 mutants capable (F216L) or incapable (S127R) of autocatalytic processing also results in decreased LDLr expression and increased plasma LDL (17). Likewise, cell surface LDLr levels and activity are reduced in lymphoblasts of S127R patients and in cultured cells overexpressing PCSK9, whereas they increased in hepatoma cells knocked down for PCSK9 (15, 18, 19). In agreement with these studies, LDL clearance from the plasma of S127R patients is reduced compared with that of control individuals (20). Conversely, PCSK9-deficient mice present with 3-fold increased hepatic LDLr expression and LDL plasma clearance (21), whereas a 40% reduction in LDL-cholesterol is associated with two nonsense mutations of PCSK9 common in African-Americans (~2%) (22). These mutations have been associated with a 10-fold reduced incidence of coronary heart disease over a 15-yr interval in the ARIC (Atherosclerosis Risk in Communities) study (23). Furthermore, new missense variants of PCSK9 (e.g. R46L) have recently been associated with hypocholesterolemia and also appear to reduce the incidence of coronary heart disease and to possibly increase response to statin therapy (23, 24, 25). Together, these studies clearly demonstrate that PCSK9 inhibits LDLr expression and thus LDL hepatic uptake, presumably by accelerating the intracellular degradation of the LDLr (19).

Besides its unequivocal effect on LDL clearance, PCSK9 has also been proposed to modulate the production of apoB-containing lipoproteins (LpB) (9, 20). However, the hepatic production of LpB is similar in mice overexpressing PCSK9 and in controls (15, 16, 17). Furthermore, apoB100 secretion from isolated hepatocytes is not significantly altered in PCSK9-deficient mice (21). Whether PCSK9 modulates the hepatic output of apoB-containing lipoproteins remains therefore to be established.

We recently characterized the PCSK9 promoter and showed that its expression is down-regulated in 24-h fasted mice and up-regulated by insulin via SREBP1c (26). It is well established that fasting causes lipolysis in adipose tissue leading to the release of free fatty acids (FFA) that complex with albumin in the plasma and reach the liver where they are metabolized. In mice, this is associated with hepatic steatosis, a process in which the peroxisome proliferator-activated receptor-{alpha} (PPAR{alpha}) plays a pivotal regulatory role (27, 28, 29, 30). Because the kinetic study showing that VLDL-apoB production rate is sharply increased in PCSK9 S127R patients compared with controls and LDLr heterozygous patients (20) was also performed in fasting conditions, we reasoned that if PCSK9 plays a role in the hepatic production of LpB, this might be uncovered upon dietary challenges such as long-term fasting.

Thus, to gain additional insight into the role of PCSK9 in lipoprotein metabolism, we transiently overexpressed PCSK9 in fed and fasted mice. We show that PCSK9 overexpression promotes hypercholesterolemia and massive hypertriglyceridemia only in 24-h fasted animals due to dramatically increased VLDL hepatic output. We also investigated the subsequent alterations of intrahepatic lipid levels in these animals as well as the role played by the LDLr in that process. Finally, we show that PPAR{alpha} negatively regulates the expression of PCSK9 in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recombinant adenovirus and animal procedures
The adenovirus vector coding for human PCSK9 cDNA as well as a sham control adenovirus (Ad-PCSK9 and Ad-null, respectively) were generated by the Vector Core of the University Hospital of Nantes (31). Controls and LDLr (–/–) mice (Charles River, L’arbresle, France) as well as PPAR{alpha} (–/–) mice (27) on a pure C57BL6/J background (8–12 wk old) were housed in a pathogen-free facility under a standard 12-h light, 12-h dark cycle and fed a standard rodent chow and water ad libitum. Mice were anesthetized with isoflurane (Abbott, Rungis, France) and injected with 5 x 108 pfu via the penis vein. Blood samples were collected between 0900 and 1000 h from the retroorbital plexus and centrifuged at 2500 x g for 20 min at 4 C for plasma isolation. Five days after infusion, 50% of mice were fasted for 24 h. Fasted mice were placed at 0900 h in individual cages with access to water ad libitum for 24 h. Mice were injected either with Tyloxapol (Sigma Chemical Co., St. Louis, MO) (500 µg/g body weight) to measure hepatic VLDL output in the plasma taken from each mouse at 0, 60, and 130 min after injection (32) or with heparin (A.P.P. Inc., Shaumburg, IL) (5 U/g body weight). Fenofibrate (Sigma) was administered by gavage (100 mg/kg body wt·d) dispersed in water containing 3% (wt/vol) gum arabic as vehicle for 7 d. Mice were then euthanized and their livers harvested, frozen in liquid nitrogen, and stored at –80 C.

Plasma chemistry and lipase activity
Plasma total cholesterol (TC) and triglycerides (TG) (Biomerieux, Marcy l’Etoile, France), FFA (Wako Chemicals, Neuss, Germany), as well as aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (Roche, Meylan, France) were measured using commercial kits. Plasma lipoproteins from pooled mouse samples (200 µl) were resolved by fast protein liquid chromatography (FPLC), as previously described (32). Post-heparin plasma lipase activity was measured using a modified TG molecule as substrate (1-trinytrophenyl-amino-dodecanoyl-2pyrenedecanoyl-3–0-hexadecyl-sn-glycerol) in which the pyrene group is quenched by the trinitrophenyl group. Plasma lipases [murine lipoprotein lipase (LPL) at pH 8.2 with 1 M NaCl and hepatic lipase (HL) at pH 8.8 with 5 M NaCl] hydrolyze the quencher and the fluorescence of the pyrene (Excitation 400 nm-Emission 342 nm) is measured (Continuous Fluorometric Lipase Test kit; Progen, Heidelberg, Germany).

VLDL/intermediate-density lipoprotein (IDL) apoB kinetic studies
VLDL/IDL were isolated by ultracentrifugation in KBr (density < 1.019) from 2 ml of plasma from C57BL6 mice infused with Ad-PCSK9 and fasted for 24 h 5 d after adenoviral infusion (33). VLDL/IDL were labeled on their apoB moiety with 125I (34), reisolated by ultracentrifugation, and dialyzed extensively against PBS. The integrity of the particles was ascertained by FPLC and agarose gel electrophoresis. The 125I-labeled apoB VLDL/IDL (106 dpm) were injected into the saphenous vein of mice (n = 5 per experimental group). Mice were bled at different time points, their VLDL/IDL isolated by ultracentrifugation, and their apoB moiety isolated by SDS-PAGE. As described below, the apoB bands were excised and 125I-labeled apoB radioactivity measured (33). The fractional catabolic rates (FCR) were determined from the area under the apoB radioactivity curve using the multiexponential curve-fitting technique in the Win-SAAM program (35). The apoB VLDL/IDL production rates (PR) were calculated as follows: PR = [FCR (d–1)] x [plasma volume (ml)] x [plasma apoB-VLDL/IDL concentration (µg/ml)]/[body weight (g)]. Plasma volume was estimated as 3.16% of body weight, and plasma apoB VLDL/IDL concentrations were measured by ELISA after ultracentrifugation of plasma aliquots, as previously described (33).

Western blots
Liver pieces were homogenized in 1x PBS containing 0.25% Na-deoxycholate, 1% Triton X-100, and a protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany). The supernatant was collected and proteins (80 µg liver protein) were resolved on Nu-PAGE 4–12% Bis-Tris gels in 2-(N-morpholino)ethanesulfonic acid-SDS buffer (Invitrogen, Cergy Pontoise, France) under reducing conditions. To analyze PPAR{alpha} and SREBP2 activity by immunoblot, nuclear proteins from mouse liver pieces (40 mg) were purified with the NE-PER extraction kit (Pierce, Rockford, IL). Proteins were transferred onto a Protran nitrocellulose membrane (Schleicher & Shuell, Dassel, Germany), probed with a polyclonal rabbit IgG directed against the CRSRHLAGASQELQ peptide (Neosystem, Strasbourg, France), an epitope of the C-terminal domain of human and mouse PCSK9, with a polyclonal goat IgG directed against the extracellular domain of the mouse LDLr (R&D Systems, Minneapolis, MN), with a polyclonal rabbit IgG anti-PPAR{alpha} (Cayman Chemicals, Ann Arbor, MI), with a polyclonal IgG anti-SREBP2 (Santa Cruz Biotechnology, Santa Cruz, CA), with the polyclonal IgG anti-cyclophilin A (Upstate, Lake Placid, NY), or with the monoclonal anti-ß-actin AC-15 antibody (Sigma) and resolved using the ECL plus kit (Amersham, Little Chalfont, UK). Mouse apoA-I, apoA-II, and apoB within FPLC fractions (20 µl) were analyzed by Western blot using antibodies against the purified apolipoproteins (Biodesign, Saco, ME), as previously described (15).

Real-time PCR
Liver total RNA was isolated using the RNeasy kit and Qiashredder mini columns as well as RNase-free DNase I (QIAGEN, Courtaboeuf, France). First-strand cDNA was synthesized with random primers using a Superscript II RNase H reverse transcriptase reagent kit (Invitrogen). Real-time PCR analysis was performed on the 7000 Sequence Detection System with SYBR Green PCR Master Mix (Applied Biosystems, Courtaboeuf, France). Oligonucleotides were designed using Primer Express software (Applied Biosystems). All samples were normalized to cyclophilin expression. Sequences were (forward and reverse, respectively) as follows: cyclophilin, TGGCAAATGCTGGACCAAA and GCCATCCAGCCATTCAGTCT; fatty acid synthase (FAS), TCCTGGAACGAGAACACGATCT and GAGACGTGTCACTCCTGGACTTG; SREBP1, GGCACTAAGTGCCCTCAACCT and GCCACATAGATCTCTGCCAGTGT; diacylglycerol acyltransferase (DAGT), GGTTAACCTGGCCACAATCATC and AGGTTGACATCCCGGTAGGAAT; carnitine palmitoyl transferase 1a (CPT1a), TGCCAGGAGGTCATAGACACATC and ACTCGTCCGGCACTTCTTGAT; apoA5, CTGGGACTACTTCAGCCAAAACAG and TGCTCGAAGCTGCCTTTCAG; acyl-CoA dehydrogenase (short-chain DH), TGGTGCAGGCTTGGATTACC and CTGCTGTGCGGATCCAAACT; acyl-CoA dehydrogenase (long-chain DH), GGGAGAAAGCTGGAGAAGTGAGT and GAGTACGCTTGCTCTTCCCAAGT; HMG-CoA reductase GTCGCTGGATAGCTGATCCTTCT and TTCGTCCAGACCCAAGGAAAC; HMG-CoA synthase, TGGTGGATGGGAAGCTGTCT and GAGGGTGAAAGGCTGGTTGTT; thiolase, TCTACATGGGCAATGTCATCCA and GTAAACCTGCGCCCAGTGTT; PPAR{alpha}, CCCTGAACATCGAGTGTCGAAT and AAGCCCTTACAGCCTTCACATG; stearoyl-CoA desaturase 1 (SCD1) GGCGTTCCAGAATGACGTGTA and GTCGGCGTGTGTTTCTGAGAA; LDLr, ACCTGCCGACCTGATGAATTC and GCAGTCATGTTCACGGTCACA; elongase TCGCTGACTCTTGCCGTCTT and TGCTTCAGGCCTTTGGTCAT; CD36, CAGAGTTCGTTATCTAGCCAAGGAA and CCATTGGGCTGTACAAAAGACA; angiopoietin-like 3 (AngpL3) CGACTCGAGCTACAAGACTGGAA and CCAGCAATCTCAGCCACATGT; and SREBP2, GTGCGCTCTCGTTTTACTGAAGT and TACAGGTATAGAAGACGGCCTTCAC.

Histology, hepatic lipids, and microsomal transfer protein (MTP) activity assays
Frozen liver pieces (~75 µg) were homogenized in 1 ml of 10 mM Tris, 150 mM NaCl, 2 mM EDTA buffer containing the protease inhibitor cocktail, and 0.5 ml of the homogenate was centrifuged at 7000 x g for 10 min at 4 C. The supernatant was collected and protein concentration was determined using the BCA kit (Interchim, Montluçon, France). MTP activity was measured using 50 µg of the homogenate and a commercial kit (Roar Biomedical Inc., New York, NY). Lipids were extracted from the remaining 0.5 ml of liver homogenates in 2 ml isopropylether/butanol (6/4, vol/vol) in 4-ml glass vials. The mixture was centrifuged at 3500 x g for 5 min at 4 C and the supernatant (organic phase) transferred to a new vial and evaporated under N2 at 55 C. The dried pellet was suspended in ethanol and assayed for cholesterol and TG. Frozen liver sections in OCT compound were stained with Oil Red O, as previously described (36).

Statistical analysis
Values are expressed as mean ± SEM. Comparisons between groups were made using the Student’s t test for independent samples.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasma lipid profile of C57BL6 mice overexpressing PCSK9 upon fasting conditions
To further evaluate the role of PCSK9 in lipoprotein metabolism, we measured the plasma lipids of C57BL6 mice infused with either Ad-PCSK9 or a control Ad-null vector and fasted for 24 h on d 5 after adenoviral injection or fed ad libitum. Compared with d 0, there was a 2-fold increase in plasma TC levels only in mice overexpressing PCSK9 5 d after adenoviral infusion (Fig. 1AGo) with no change in TG (Fig. 1BGo), as anticipated (15). Then half of the animals were fasted for 24 h, whereas the other half were fed ad libitum. There was an additional 85 mg/dl increase in plasma TC (Fig. 1AGo) with a concomitant 2.5-fold increase in plasma TG levels (Fig. 1BGo) only in the group of mice overexpressing PCSK9 and fasted for 24 h.


Figure 1
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 1. PCSK9 overexpression results in hypercholesterolemia and massive hypertriglyceridemia in fasted mice. A and B, Plasma TC (A) and TG (B) levels in C57BL6 male mice infused with Ad-PCSK9 or Ad-null. Plasma lipids were measured on d 0 (black) and d 5 (white) after adenoviral infusion as well as on d 6 (gray) when half of the mice had been fasted for 24 h or fed a regular chow diet. *, P < 0.01 vs. d 0; #, P < 0.02 vs. both d 5 and d 0 (n = 12 for all).

 
Because adenovirus administration promotes inflammation that may perturb TG metabolism, we assessed the liver function by monitoring AST and ALT plasma activities throughout the study. Adenovirus treatment promoted similar increases in both AST and ALT in each experimental group (not shown), ruling out the possibility that differential perturbations of liver function by Ad-null and Ad-PCSK9 vectors may account for the differences observed in plasma lipids.

We next measured the level of PCSK9 expression by immunoblot in the livers of these animals, collected on d 6 after adenoviral infusion. In Ad-null sham infused mice, the endogenous hepatic expression of PCSK9 was reduced by 50% upon fasting (Fig. 2AGo). Conversely, the Ad-PCSK9 infusion resulted in an approximately 3-fold increase in the levels of hepatic PCSK9 expression in both fed and fasted mice, ruling out the possibility that variability in transgene expression may explain the differences observed in plasma lipids among both experimental groups.


Figure 2
View larger version (48K):
[in this window]
[in a new window]
 
FIG. 2. Fasted mice overexpressing PCSK9 accumulate TG-rich lipoproteins. A, PCSK9 hepatic expression in C57BL6 male mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed normally before being killed (d 6). Two representative immunoblots are displayed for each group (n = 5 per group). Densitometry analysis of PCSK9 expression, normalized to ß-actin, is indicated below. *, P < 0.03 vs. fed Ad-null. B, FPLC analysis of 200 µl of pooled plasma samples of mice (n = 5 per group) infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed normally (d 6). ApoB100, -B48, -A1, and -A2 levels in the eluted fractions corresponding to the top VLDL (V), IDL (I), LDL (L), and HDL (H) peaks (i.e. 15, 18, 22, and 29 ml, respectively) were determined by Western blot. The FPLC fractions of Ad-null-infused (triangles) and Ad-PCSK9-infused (diamonds) mice fed (black symbols) or fasted for 24 h (white symbols) were measured for cholesterol (C) and TG (D) content. E, LDLr hepatic expression in C57BL6 male mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed normally before being killed (d 6). Two representative immunoblots are displayed for each group (n = 4 per group). Densitometry analysis of PCSK9 expression, normalized to cyclophilin, is indicated below. *, P < 0.01 vs. fed Ad-null; **, P < 0.03 vs. all. For negative control, 50 µg of liver protein extract from LDLr (–/–) mice was used.

 
We also assessed the distribution of the major apolipoproteins among the VLDL, IDL, LDL, and high-density lipoproteins (HDL) separated by FPLC in the four experimental groups of mice by Western blot (Fig. 2BGo). As anticipated, there was an increase in LDL-associated apoB100 and B48 in mice injected with Ad-PCSK9 and fed normally. Paralleling plasma TC and TG levels, there was a sharp increase in the apoB100 and apoB48 content of the VLDL, IDL, and LDL of Ad-PCSK9-infused mice fasted for 24 h (Fig. 2BGo). The levels of HDL apoA1 and apoA2 were similar in the four experimental groups. Furthermore, the cholesterol (Fig. 2CGo) and TG (Fig. 2DGo) FPLC profiles showed that C57BL6 mice infused with PCSK9 presented with a dramatic plasma accumulation of TG-rich lipoproteins (i.e. VLDL and IDL) only upon fasting conditions, compared with the other experimental groups of mice. LDL cholesterol increased similarly in both fed and fasted mice infused with Ad-PCSK9 compared with Ad-null-injected controls. HDL cholesterol levels were similar in Ad-PCSK9- and Ad-null-infused mice and increased slightly in both groups upon fasting (Fig. 2CGo).

Finally, we assessed the expression of the LDLr by immunoblot in the livers of these mice (Fig. 2EGo). As expected, the overexpression of PCSK9 decreased the hepatic levels of LDLr in both fed and fasted C57BL mice. Ad-null-infused mice had similar levels of hepatic LDLr protein levels in both fed and fasted states, as published elsewhere (37). To our surprise, there was a much sharper decrease in LDLr expression upon PCSK9 overexpression in fasted mice compared with fed controls (–90% vs. –55%, respectively).

ApoB-containing lipoprotein metabolism in fasted C57BL6 mice overexpressing PCSK9
To elucidate the mechanisms underlying the increased TC and hypertriglyceridemia observed in C57BL6 mice overexpressing PCSK9 and fasted for 24 h, we performed a similar experiment following the same adenoviral/nutritional pattern. On d 6 after adenoviral infusion of mice, their plasma lipases were transiently blocked with tyloxapol injections, and the resulting accumulation of TG in the plasma of the animals, reflecting the hepatic output of VLDL, was measured (Fig. 3AGo). The rate of accumulation of TG was maximal in the plasma of C57BL6 mice overexpressing PCSK9 and fasted for 24 h compared with that of the three other experimental groups. Furthermore, the hepatic output of apoB100 (Fig. 3BGo) but not of apoB48 (not shown), was approximately 3-fold increased in C57BL mice overexpressing PCSK9 fasted for 24 h compared with the three other groups. Mice infused with either Ad-PCSK9 or Ad-null and fed ad libitum displayed similar levels of TG and apoB hepatic output, as previously reported (15).


Figure 3
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 3. Increased hepatic output of VLDL TG and apoB in fasted mice overexpressing PCSK9. A, Hepatic VLDL-TG production in C57BL6 mice (n = 5 per group) infused with Ad-null (triangles) or Ad-PCSK9 (diamonds) fed (black symbols) or fasted for 24 h (white symbols) after transient inhibition of plasma lipases by tyloxapol injection. B, Hepatic apoB100 output in the four experimental groups (n = 5 per group) measured by immunoblot and densitometric analysis. *, P < 0.01 vs. both fasted Ad-null and Fed Ad-PCSK9. Inset, Representative immunoblot of apoB100 levels in the plasma of fed Ad-null, fed Ad-PCSK9, fasted Ad-null, and fasted Ad-PCSK9 before (T0) and 1 h (1H) after tyloxapol injection. C, Post-heparin lipase activities in Ad-null-infused (black) and Ad-PCSK9-infused (white) mice fasted for 24 h before heparin injection (n = 6 per group). D, Kinetics of [125I]apoB VLDL/IDL in the plasma of C57BL6 mice (n = 5 per group) infused with Ad-null (white symbols) or Ad-PCSK9 (black symbols) and fed (triangles) or fasted for 24 h (squares).

 
Next, we repeated a similar experiment following the same adenoviral/nutritionnal pattern and injected heparin on d 6 after adenoviral infusion. We measured the post-heparin LPL and hepatic lipase activities in the plasma of C57BL6 mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h before heparin injection. There was no significant difference in plasma lipolytic activities between both groups (Fig. 3CGo). Similar lipase activities were also measured in fed animals overexpressing PCSK9 or not (data not shown), as previously reported (15). We also measured the activity of the microsomal transfer protein in liver extracts of fed Ad-null, fed Ad-PCSK9, fasted Ad-null, and fasted Ad-PCSK9. Compared with fed Ad-null controls, the three other experimental groups had 20–25% reduced MTP activity levels (106 ± 6, 85 ± 6, 82 ± 5 and 81 ± 6 pmol TG/h, respectively; P = 0.03 for the latter three values vs. fed Ad-null; n = 5 for all), ruling out increased MTP activity to account for increased VLDL production in fasted C57BL6 mice overexpressing PCSK9. To definitively establish that the hepatic production of apoB is increased in fasted mice overexpressing PCSK9, we performed a series of VLDL/IDL kinetic studies in our four experimental groups (Fig. 3DGo). The catabolism of VLDL/IDL apoB (B100+B48) was maximal in fed Ad-null and fasted Ad-null controls, reduced in fed Ad-PCSK9, and minimal in fasted Ad-PCSK9 mice (FCR = 15.1 ± 3.7, 14.6 ± 3.9, 9.4 ± 2.1, and 7.1 ± 1.9 d–1, respectively; P < 0.02 for the last two values vs. Ad-null; n = 5 for all). We measured the levels of total apoB in the VLDL/IDL fractions isolated by ultracentrifugation from the mouse plasma samples collected just before infusion of the tracer [VLDL/IDL apoB concentration = 2.1 ± 0.7, 2.0 ± 0.9, 4.9 ± 2.1, and 12.1 ± 2.8 (P < 0.04 vs. all other groups) mg/dl, respectively], and the VLDL/IDL apoB PR were calculated [PR = 3.17 ± 0.56, 3.50 ± 0.72, 4.61 ± 0.65 and 8.59 ± 1.09 (P < 0.04 vs. all other groups) µg/g·d, respectively].These results indicate that the PR of VLDL/IDL apoB is dramatically increased only in the group of mice overexpressing PCSK9 and fasted for 24 h.

Plasma lipids, lipoproteins, and hepatic VLDL output of LDLr (–/–) mice overexpressing PCSK9 upon fasting conditions
Because PCSK9 dramatically decreased the expression of the LDLr in fasted mice (Fig. 2EGo) and because the LDLr has been proposed to be involved in the secretion and/or recapture of nascent apoB100-containing lipoproteins by the liver (38, 39), we reasoned that the virtual disappearance of the LDLr upon PCSK9 overexpression may explain the hyperlipidemia observed in C57BL6 mice fasted for 24 h. Thus, we performed a similar series of experiments following the same adenoviral/nutritional pattern in LDLr (–/–) male mice on the same genetic C57BL6 background. LDLr (–/–) mice had plasma TC levels of approximately 400 mg/dl on d 5 after Ad-PCSK9 or Ad-null infusion. Half of the animals were then fasted for 24 h and the other half fed ad libitum. Both Ad-PCSK9- and Ad-null-infused mice plasma TC levels increased by 100 mg/dl upon fasting but remained steady in fed animals (Fig. 4AGo). Likewise, LDLr (–/–) mice had similar plasma TG levels on d 5 after Ad-PCSK9 or Ad-null infusion, and both groups had dramatically increased plasma TG levels by 260 mg/dl upon fasting but not fed condition (Fig. 4BGo). The FPLC TG profile of the four experimental groups indicates that LDLr (–/–) mice overexpressing or not PCSK9 presented with a massive accumulation of VLDL in their plasma upon fasting (Fig. 4CGo). The levels of apoB100 in the VLDL peak followed accordingly (not shown).


Figure 4
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 4. The hepatic production of VLDL in fasted LDLr (–/–) mice is not affected by PCSK9. A and B, Plasma TC (A) and TG (B) levels in LDLr (–/–) mice infused with Ad-PCSK9 or Ad-null. Plasma lipids were measured on d 0 (black) and d 5 (white) after adenoviral infusion as well as on d 6 (gray) when half of the mice had been fasted for 24 h or fed a regular chow diet. *, P < 0.01 vs. both d 5 and d 0 (n = 5 for all). C, Triglyceride FPLC profile of 200 µl of pooled plasma samples of LDLr (–/–) mice (n = 5 per group) infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed normally (d 6). D, Hepatic VLDL-TG production in LDLr (–/–) mice (n = 5 per group) infused with Ad-null (triangles) or Ad-PCSK9 (diamonds) fed (black symbols) or fasted for 24 h (white symbols) after transient inhibition of plasma lipases by tyloxapol injection. Inset, Hepatic apoB100 output (see Fig. 3BGo legend).

 
We next performed tyloxapol injection in mice infused with Ad-null or Ad-PCSK9 and fasted for 24 h or fed normally, to measure the hepatic output of VLDL, as described above. The rate of accumulation of TG was increased by 60% in the plasma of LDLr (–/–) mice infused with either Ad-PCSK9 or Ad-null and fasted for 24 h compared with fed animals (Fig. 4DGo). There was a trend (P = 0.075) toward a 25% increased rate of apoB100 output from the livers of fasted LDLr (–/–) mice infused with Ad-null or Ad-PCSK9 compared with the fed animals (Fig. 4DGo, inset). The rates of apoB48 hepatic output were similar in the four experimental groups (data not shown). No significant difference in hepatic TG or apoB100 output was observed between Ad-PCSK9- and sham-infused LDLr (–/–) mice upon both dietary conditions.

Concomitantly, a set of C57BL6 mice underwent the same series of experiments. Plasma lipids, FPLC profiles, and tyloxapol data were identical to those presented above (Figs. 1Go, 2DGo, and 3AGo). The rate of accumulation of TG was increased by 100% in Ad-PCSK9-infused C57BL6 mice fasted for 24 h compared with the three other experimental groups. Noteworthy, the rate of VLDL-TG output was 3-fold faster in C57BL6 mice overexpressing PCSK9 than in LDLr (–/–) mice, upon fasting conditions (i.e. 12.9 vs. 4.1 mg TG/g liver·h, respectively).

Hepatic lipids and plasma FFA levels in LDLr (–/–) and C57BL6 mice infused with Ad-null or Ad-PCSK9
To determine the origin of liver-derived VLDL-TG, we performed histological analysis of liver sections from C57BL6 mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed ad libitum before organ harvesting. There was an accumulation of Oil-Red-O-stained neutral lipids, i.e. steatosis, in the livers of fasted mice. The extent of fat accumulation was lower in the liver of fasted mice infused with Ad-PCSK9 compared with Ad-null (Fig. 5AGo). Fed animals did not display any hepatic steatosis, irrespective of the adenoviral infusion status. We measured the cholesterol and TG contents of the livers of C57BL6 mice infused either with Ad-null or Ad-PCSK9 and fed or fasted 24 h before being killed. Fasting promoted massive accumulation of cholesterol and TG in the livers of mice irrespective of the adenoviral infusion status. However, the hepatic accumulation of TG upon fasting was lower in PCSK9-overexpressing mice compared with Ad-null controls, in agreement with our histological observations (Fig. 5BGo). In these mice, there was an inverse relationship between the hepatic TG content and the level of VLDL-TG output. In the LDLr (–/–) background, fasting also promoted an increase in the levels of hepatic lipids accumulation, but no significant difference could be observed between Ad-PCSK9- and Ad-null-infused animals (data not shown).


Figure 5
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 5. The increase in hepatic production of VLDL in fasted mice overexpressing PCSK9 is permitted by the mobilization of intrahepatic lipids. A, Histological analysis of Oil-Red-O-stained liver sections from Ad-null- and Ad-PCSK9-infused C57BL6 male mice fed or fasted for 24 h before organ harvesting. B, Cholesterol (black bars) and TG (white bars) content in the livers of Ad-null- and Ad-PCSK9-infused C57BL mice fed or fasted for 24 h before organ harvesting. *, P < 0.03 vs. Ad-null. C, Plasma FFA levels in LDLr (–/–) (black bars) and C57BL6 (white bars) mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed a regular chow diet. *, P < 0.03 vs. Ad-null (n = 4 for all).

 
We next measured the FFA levels in the plasma of LDLr (–/–) as well as C57BL6 mice infused with either Ad-null or Ad-PCSK9 and fed or fasted for 24 h (Fig. 5CGo). As expected, fasting increased plasma FFA levels in both LDLr (–/–) and C57BL6 mice. No significant difference could be observed between Ad-PCSK9- and Ad-null-infused LDLr (–/–) mice. However, plasma FFA were reduced by 0.3 mmol/liter in fed mice overexpressing PCSK9 but increased by 0.5 mmol/liter in fasted mice overexpressing PCSK9 compared with respective Ad-null-infused controls (Fig. 5CGo). Noteworthy, we did not detect by quantitative PCR any significant amounts of either mouse PCSK9 or the human PCSK9 transgene in the abdominal adipose tissue of these animals (<0.1% of liver values). The levels of mRNA expression of LPL and hormone-sensitive lipase (HSL), the enzymes responsible for FFA uptake or release by the adipocyte, were also similar among groups (data not shown).

Expression levels of genes involved in hepatic lipid metabolism in C57BL6 mice infused with Ad-null or Ad-PCSK9 and fasted or fed
To understand the molecular mechanisms underlying or associated with the modulation of VLDL output and hepatic lipid content upon PCSK9 expression in fasted C57BL6 mice, we performed quantitative RT-PCR analysis of a series of genes presumably involved in hepatic complex lipids as well as fatty acid metabolism. Fasting reduced the expression levels of key lipogenic genes such as FAS, SREBP1, stearoyl-CoA desaturase, and elongase as well as that of the steroidogenic rate-limiting enzyme HMG-CoA reductase, and to a lower extent of the LDLr, irrespective of the adenoviral infusion status (Fig. 6AGo). There was a trend (P = 0.08) toward a decreased expression of SREBP2 only in fasted mice overexpressing PCSK9 (Fig. 6AGo).


Figure 6
View larger version (31K):
[in this window]
[in a new window]
 
FIG. 6. Lack of down-regulation of PPAR{alpha} in fasted mice overexpressing PCSK9. A, SREBP1, fatty acid synthase, SCD1, HMG-CoA reductase, LDLr, and SREBP2; B, CPT1a, HMG-CoA synthase, thiolase, PPAR{alpha}, CD36, AngpL3, ApoA5, diacylglycerol acyltransferase, long- and short-chain DH gene expression in the livers of fed Ad-null (left gray bars), fed Ad-PCSK9 (white bars), fasted Ad-null (black bars), and fasted Ad-PCSK9 (right gray bars) mice. Values are normalized to cyclophilin and expressed as mean ± SEM relative to fed Ad-null, arbitrarily set at 100. *, P < 0.02 vs. Ad-null (n = 5 for all). C, SREBP2 and PPAR{alpha} nuclear expression in the livers of C57BL6 male mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed normally before being killed (d 6). Three representative immunoblots are displayed for each group (n = 4 per group). Densitometry analysis of nuclear SREBP2 and PPAR{alpha} is indicated below. *, P < 0.01 vs. Ad-null.

 
Conversely, fasting increased the expression levels of key genes involved in fatty acid oxidation such as the carnitine-palmytoyl acyltransferase I (CPTI), the long and short chain acyl-CoA dehydrogenases, and thiolase (mitochondrial trifunctional enzyme) as well as ketogenesis such as HMG-CoA synthase. Fasting also increased the expression of genes involved in hepatic TG synthesis and catabolism, i.e. diacylglycerol acyltransferase, and apoA5, but not that of angiopoietin-like 3, irrespective of the adenoviral infusion status (Fig. 6BGo). The expression of the oxidized LDLr CD36 was also increased upon fasting (Fig. 6BGo).

A significant difference between Ad-PCSK9- and Ad-null-infused animals was observed only in fed animals with a 50% reduction in CPTI and HMG-CoA synthase gene expression. Because the expression of both genes is regulated by PPAR{alpha} (40, 41), we also measured the expression level of PPAR{alpha} in the livers of the four experimental groups. To our surprise, the pattern of PPAR{alpha} expression was also reduced by 50% in fed mice overexpressing PCSK9 compared with Ad-null controls and increased upon fasting in both Ad-PCSK9- and Ad-null-infused animals (Fig. 6BGo). To evaluate the physiological relevance of the variations in SREBP2 and PPAR{alpha} levels observed by RT-PCR among groups, we performed the immunoblot analysis of these factors in nuclear extracts isolated from mouse liver pieces from each experimental group (Fig. 6CGo), because nuclear levels of transcription factors parallel their activity. In fed mice, the overexpression of PCSK9 resulted in sharply decreased nuclear SREBP2 and PPAR{alpha} levels, whereas in fasted mice, the overexpression of PCSK9 had no significant effect on SREBP2 and PPAR{alpha} nuclear expression (P = 0.92 and 0.55, respectively).

PCSK9 hepatic expression in C57BL6 and PPAR (–/–) mice
We have shown that PPAR{alpha} hepatic expression is decreased in fed but not in fasted mice overexpressing PCSK9. Because PPAR{alpha} plays a central role in the setting of hepatic steatosis observed upon long-term fasting (27, 28, 29, 30), and because this phenomenon is altered in the liver of fasted Ad-PCSK9 (compared with fasted Ad-null) mice, we hypothesized that PPAR{alpha} may also regulate the expression of PCSK9 in vivo. Thus we assessed the endogenous mRNA expression of PCSK9 in the livers of C57BL6 and PPAR{alpha} (–/–) mice previously treated with the PPAR{alpha} agonist fenofibrate or with a sham vehicle solution for 7 d (Fig. 7AGo). The expression of a positive PPAR{alpha} target gene, Cyp4a10, was induced as anticipated by fenofibrate and abolished in PPAR{alpha} (–/–) mice. Conversely, the expression of PCSK9 was reduced by 68% in the liver of C57BL6 mice after fenofibrate treatment compared with vehicle-treated controls. Fenofibrate treatment failed to down-regulate PCSK9 expression in the liver of PPAR{alpha} (–/–) mice (Fig. 7AGo). The PCSK9 protein expression levels assessed by Western blot followed accordingly, with a 58% reduction in PCSK9 expression in C57BL6 mice after fenofibrate treatment and a lack of effect of fenofibrate on PCSK9 protein expression in PPAR{alpha} (–/–) mice (Fig. 7BGo). A similar 61% decrease in PCSK9 protein hepatic content was observed upon fenofibrate treatment using C57BL6 male mice instead of females (data not shown).


Figure 7
View larger version (36K):
[in this window]
[in a new window]
 
FIG. 7. The PPAR{alpha} agonist fenofibrate down-regulates the expression of PCSK9. A, Cyp4A10 and PCSK9 gene expression in the livers of C57BL6 controls and PPAR{alpha} (–/–) female mice treated with fenofibrate (Fen.) or vehicle (Veh.) for 7 d. Values are normalized to cyclophilin and expressed as mean ± SEM (n = 4 for all). B, Immunoblot analysis of PCSK9 expression in the livers of C57BL6 controls and PPAR{alpha} (–/–) mice treated with fenofibrate or vehicle. Densitometry analysis of PCSK9 expression, normalized to ß-actin, is indicated below. *, P < 0.03 vs. vehicle-treated controls (n = 4 for all).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present report, we investigated the role played by PCSK9 in lipoprotein metabolism. We showed that the adenoviral mediated overexpression of PCSK9 in C57BL6 mice results in hypercholesterolemia as well as massive hypertriglyceridemia after a 24-h fasting period. This increase in plasma lipids that parallels a virtual disappearance of LDLr hepatic expression in fasted mice overexpressing PCSK9 results from the overproduction of VLDL by the liver of these animals and not from the modulation of plasma TG lipase activity. Next, we showed that in absence of the LDLr, fasting promotes an increased production of hepatic VLDL and thus of plasma lipids in both Ad-PCSK9- and Ad-null-infused mice, indicating that the modulation of LDLr expression by PCSK9 is a key molecular mechanism by which VLDL hepatic output is regulated upon fasting in vivo. We also showed that the increased hepatic output of TG in fasted C57BL6 mice overexpressing PCSK9 is associated with the mobilization of intrahepatic lipid stores and with a lack of down-regulation of PPAR{alpha} activity. Furthermore, PCSK9 expression itself is down-regulated by the PPAR{alpha} agonist fenofibrate.

First we showed that mice overexpressing PCSK9 and fasted for 24 h present with hyperlipidemia characterized by a massive accumulation of plasma TG-rich apoB100-containing lipoproteins (VLDL and IDL), whereas PCSK9 overexpression has no effect on the plasma levels of TG-rich lipoproteins in fed animals, as previously reported (15, 16, 17). We also showed using both the tyloxapol technique as well as apoB VLDL/IDL kinetic studies that this increase in plasma lipids results from increased hepatic VLDL apoB as well as TG output but not from altered plasma lipase activity. In agreement with these findings, PCSK9 S127R patients present with elevated VLDL-apoB100 production under fasting conditions (20), and it has been suggested by in vitro studies that the severe hypercholesterolemia observed in PCSK9 D374Y patients was associated with increased apoB100 secretion (7, 9). VLDL formation in the hepatocytes occurs in two steps. The first step involves the MTP-mediated lipidation of apoB100 during its translation (42). In our experiments, changes in hepatic MTP activity could not account for the plasma lipid increases observed. The second step in which the major amount of TG is added to the nascent VLDL particle, in coatomer protein complex vesicles, is less well characterized (43). Recently, it has been shown in rat hepatocytes that coatomer protein complex II vesicles contain a large amount of intracellular PCSK9 (44). Whether PCSK9 modulates VLDL formation at this subcellular level remains to be studied.

Next we showed that the hepatic expression of the LDLr is decreased by half in fed mice and virtually abolished in fasted mice overexpressing PCSK9. Furthermore, in LDLr (–/–) mice, fasting also promotes hyperlipidemia characterized by a massive accumulation of VLDL-TG and apoB, whether PCSK9 is overexpressed or not. We also showed that the net output of VLDL-TG is increased in fasted LDLr (–/–) mice infused with either Ad-PCSK9 or Ad-null compared with fed animals. Taken together, these data indicate that the negative modulation of LDLr expression by PCSK9 in C57BL6 mice is a key molecular mechanism allowing increased VLDL hepatic output upon fasting. The LDLr has been shown to play a pivotal role in apoB-containing lipoprotein secretion, because primary hepatocytes from LDLr (–/–) mice secrete more apoB than controls as a result of reduced intracellular presecretory degradation of apoB as well as a lack of recapture of nascent VLDL (39). Kinetic studies in FH patients (38, 45) are often contradictory on that matter, but it appears that the condition for an alteration of apoB production is a virtual absence of LDLr expression. Thus, the dramatic decrease in LDLr expression observed in fasted mice overexpressing PCSK9 and the subsequent decrease in intracellular apoB degradation seems to be the key mechanism by which VLDL hepatic output is increased in our model. Because upon fasting conditions, the absolute hepatic VLDL output is faster in C57BL6 mice overexpressing PCSK9 compared with LDLr (–/–) animals, we cannot rule out that under physiological circumstances unraveled by long-term fasting, PCSK9 may also act via LDLr-independent pathways to modulate VLDL secretion (dotted line in Fig 8Go). The cell biology studies mentioned above (42, 43, 44) indicate that PCSK9 is localized in organelles in which lipids are added to nascent VLDL particles. Much work is needed to establish whether PCSK9 may directly modulate apoB-containing lipoprotein anabolism via a LDLr-independent pathway.


Figure 8
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 8. PCSK9 overexpression in fasted mice promotes dramatically decreased LDLr expression and subsequent hyperlipidemia. PCSK9 inhibits the expression of the LDLr, leading to increased plasma LDL-C levels. Fasting alters the expression of PCSK9 but not that of the LDLr, suggesting the existence of an antagonist action exerted on the unknown PCSK9 targets denoted by a question mark. In our overexpression model, PCSK9 levels remain elevated irrespective of the nutritional status. Thus, upon fasting, the regulatory mechanisms between PCSK9, its target (?), and the LDLr are unbalanced and result in a dramatic overproduction of VLDL. The mechanisms governing VLDL hepatic output clearly involve the LDLr and putatively a direct effect of PCSK9 (denoted by a dashed arrow).

 
Next we showed that there was an inverse relationship between hepatic TG levels and the net output of VLDL in fasted mice, suggesting a mobilization of intrahepatic lipids for VLDL production in these animals. We also measured an increase in plasma FFA levels in fasted mice overexpressing PCSK9 compared with Ad-null controls. When measured in LDLr (–/–) mice, plasma FFA was increased in both Ad-null- and Ad-PCSK9-infused animals upon fasting. Plasma FFA is a major source for VLDL-TG (46), so we first reasoned that increased VLDL output could be fueled by an increased flux of FFA from the adipose tissue in fasted mice overexpressing PCSK9. We therefore measured in the abdominal fat of our mice the levels of PCSK9 (endogenous and transgene), LPL, and HSL, the key lipolytic enzymes expressed in that tissue, and found no difference among groups. This suggests that the increase in plasma FFA observed in fasted mice overexpressing PCSK9 is probably an indirect consequence of the hepatic perturbations rather than a central mechanism fueling VLDL production. In addition, we cannot rule out that the increased concentration of VLDL in the plasma of these animals may result in more TG hydrolysis and in turn more plasma FFA. Nevertheless, because the overproduction of VLDL-TG and apoB100 is a hallmark of insulin resistance and type 2 diabetes in humans, and is often associated with hepatic steatosis (47), it is legitimate to speculate that PCSK9 function may be altered in the metabolic syndrome and/or diabetes. We recently demonstrated that PCSK9 expression is down-regulated in fasted mice and that PCSK9 gene expression is positively regulated by insulin via SREBP1c (26). Whether PCSK9 modulates the secretion of hepatic VLDL in metabolic diseases such as those mentioned above clearly remains to be established.

Finally, we measured the expression of a series of genes in the livers of the four experimental groups to determine the mechanisms responsible or associated with increased VLDL output in mice overexpressing PCSK9 and fasted for 24 h. Among the genes tested, none were differentially expressed in fasted mice overexpressing PCSK9 compared with fasted controls. There was only a trend toward a decrease in SREBP2 mRNA expression in the livers of the Ad-PCSK9 fasted group but there was no difference in SREBP2 activity, measured by immunoblot analysis of nuclear extracts, among these two sets of mice. However, similar measurements performed in fed mice indicate that PCSK9 overexpression results in decreased SREBP2 activity. Because the LDLr level is further decreased when PCSK9 is overexpressed upon fasting, it seems very unlikely that PCSK9 might modulate LDLr protein levels via an SREBP2-dependent mechanism. In addition, the mRNA expression of the LDLr and that of HMG-CoA reductase, two targets of SREBP2, are not modulated upon PCSK9 overexpression in both fasted and fed animals (Fig. 6AGo), suggesting that the mRNA expression of both genes are probably regulated by other factor(s) antagonizing SREBP2 activity, at least in the fed state. In this panel of genes, the only significant differences between Ad-PCSK9- and Ad-null-infused animals was observed in fed animals with 50% reduced expression levels of CPTI and HMG-CoA synthase. Because both genes are known PPAR{alpha} targets (40, 41), we also measured the expression levels of PPAR{alpha} and found a similar 50% decrease in fed animals overexpressing PCSK9. Upon fasting, there was an apparent lack of down-regulation in PPAR{alpha}, CPTI, and HMG-CoA synthase gene expression in mice infused with Ad-PCSK9 compared with Ad-null. Likewise, we found a significant 56% decrease in PPAR{alpha} activity in the livers of Ad-PCSK9 fed mice compared with Ad-null in the fed state but not in the fasted state. PPAR{alpha} is known to play a critical role in the transcriptional regulatory responses to fasting and subsequent steatosis (27, 28, 29, 30). Fibrates are established PPAR{alpha} ligands widely used in humans to decrease plasma TG (48), but the exact role played by PPAR{alpha} on the net VLDL hepatic output remains elusive (49). Because PPAR{alpha} expression and activity is altered in fed mice overexpressing PCSK9, a phenomenon abolished upon fasting, we hypothesized that PPAR{alpha} may also regulate PCSK9 expression. Thus, PCSK9 gene and protein expression were sharply reduced in C57BL6 but not in PPAR{alpha} (–/–) mice after administration of fenofibrate. Unlike Cyp4a10, PCSK9 mRNA levels were similar in control and PPAR{alpha} (–/–) mice, suggesting that PPAR{alpha} does not constitutively regulate PCSK9 gene expression. We are currently investigating the mechanisms of this repression.

Upon fasting, the endogenous expression of PCSK9 is decreased in mouse liver, but this does not result in increased LDLr hepatic levels, as we previously reported (26). Conversely, upon overexpression of PCSK9 using adenoviral vectors, we surprisingly observed a dramatic decrease in LDLr protein levels compared with the fed state, and this was associated with an increased rate of VLDL production. Under these experimental conditions, the regulatory mechanisms between PCSK9 and the LDLr are clearly unbalanced and result in an abnormal overproduction of VLDL (Fig. 8Go). Among the factors potentially responsible for the sharp decrease in LDLr expression and subsequent VLDL overproduction, we found a lack of down-regulation of PPAR{alpha} activity. This finding does not seem sufficient to fully explain the phenotype of our mice. To discover the precise mechanisms leading to the phenotype observed in this study, the targets acted upon by PCSK9 (Fig. 8Go) and responsible for decreased LDLr must be identified. In summary, our study demonstrates that fasting leads to massive hypertriglyceridemia in mice overexpressing PCSK9 because of the lack of modulation of hepatic VLDL output mostly by the LDLr, and this is associated with the mobilization of intrahepatic lipid stores and a lack of negative regulation of PCSK9 expression by PPAR{alpha}.


    Acknowledgments
 
We thank the staff from the UTE animal facility as well as D. Aubert, E. Mougenot, K. Renaudin, D. Drui, and C. Boyer for technical assistance. We thank M. Amar and B. Cariou for careful review of the manuscript.


    Footnotes
 
This work was supported by Laboratoires Pierre Fabre, the Fondation de France, and the Centre de Recherche en Nutrition Humaine de Nantes.

Disclosure information: G.L., A.-L.J., T.P., M.C., C.L., M.K., and P.C. have nothing to declare. O.P. is a recipient of the Allocation Annee de Recherche Clinique (Hopitaux/Leem/FHF).

First Published Online June 22, 2006

Abbreviations: ALT, Alanine aminotransferase; apo, apolipoprotein; AST, aspartate aminotransferase; CPTI, carnitine-palmytoyl acyltransferase I; FCR, fractional catabolic rates; FFA, free fatty acids; FH, familial hypercholesterolemia; HDL, high-density lipoprotein; HSL, hormone-sensitive lipoprotein; IDL, intermediate-density lipoprotein; LDL, low-density lipoprotein; LDLr, LDL receptor; LpB, apoB-containing lipoproteins; LPL, lipoprotein lipase; MTP, microsomal transfer protein; PCSK9, proprotein convertase subtilisin kexin type 9; PPAR{alpha}, peroxisome proliferator-activated receptor-{alpha}; PR, production rate; SREBP, sterol regulatory element-binding protein; TC, total cholesterol; TG, triglycerides.

Received January 24, 2006.

Accepted for publication June 15, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Austin MA, Hutter CM, Zimmern RL, Humphries SE 2004 Genetic causes of monogenic heterozygous familial hypercholesterolemia: a HuGE prevalence review. Am J Epidemiol 160:407–420[Abstract/Free Full Text]
  2. Rader DJ, Cohen J, Hobbs HH 2003 Monogenic hypercholesterolemia: new insights in pathogenesis and treatment. J Clin Invest 111:1795–1803[CrossRef][Medline]
  3. Dedoussis GV, Schmidt H, Genschel J 2004 LDL-receptor mutations in Europe. Hum Mutat 24:443–459[CrossRef][Medline]
  4. Abifadel M, Varret M, Rabes JP, Allard D, Ouguerram K, Devillers M, Cruaud C, Benjannet S, Wickham L, Erlich D, Derre A, Villeger L, Farnier M, Beucler I, Bruckert E, Chambaz J, Chanu B, Lecerf JM, Luc G, Moulin P, Weissenbach J, Prat A, Krempf M, Junien C, Seidah NG, Boileau C 2003 Mutations in PCSK9 cause autosomal dominant hypercholesterolemia. Nat Genet 34:154–156[CrossRef][Medline]
  5. Allard D, Amsellem S, Abifadel M, Trillard M, Devillers M, Luc G, Krempf M, Reznik Y, Girardet JP, Fredenrich A, Junien C, Varret M, Boileau C, Benlian P, Rabes JP 2005 Novel mutations of the PCSK9 gene cause variable phenotype of autosomal dominant hypercholesterolemia. Hum Mutat 26:497[CrossRef][Medline]
  6. Leren TP 2004 Mutations in the PCSK9 gene in Norwegian subjects with autosomal dominant hypercholesterolemia. Clin Genet 65:419–422[CrossRef][Medline]
  7. Naoumova RP, Tosi I, Patel D, Neuwirth C, Horswell SD, Marais AD, van HC, Soutar AK 2005 Severe hypercholesterolemia in four British families with the D374Y mutation in the PCSK9 gene: long-term follow-up and treatment response. Arterioscler Thromb Vasc Biol 25:2654–2660[Abstract/Free Full Text]
  8. Pisciotta L, Oliva CP, Cefalu AB, Noto D, Bellocchio A, Fresa R, Cantafora A, Patel D, Averna M, Tarugi P, Calandra S, Bertolini S 2005 Additive effect of mutations in LDLR and PCSK9 genes on the phenotype of familial hypercholesterolemia. Atherosclerosis 186:433–440[Medline]
  9. Sun XM, Eden ER, Tosi I, Neuwirth CK, Wile D, Naoumova RP, Soutar AK 2005 Evidence for effect of mutant PCSK9 on apolipoprotein B secretion as the cause of unusually severe dominant hypercholesterolaemia. Hum Mol Genet 14:1161–1169[Abstract/Free Full Text]
  10. Timms KM, Wagner S, Samuels ME, Forbey K, Goldfine H, Jammulapati S, Skolnick MH, Hopkins PN, Hunt SC, Shattuck DM 2004 A mutation in PCSK9 causing autosomal-dominant hypercholesterolemia in a Utah pedigree. Hum Genet 114:349–353[CrossRef][Medline]
  11. Seidah NG, Benjannet S, Wickham L, Marcinkiewicz J, Jasmin SB, Stifani S, Basak A, Prat A, Chretien M 2003 The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc Natl Acad Sci USA 100:928–933[Abstract/Free Full Text]
  12. Maxwell KN, Soccio RE, Duncan EM, Sehayek E, Breslow JL 2003 Novel putative SREBP and LXR target genes identified by microarray analysis in liver of cholesterol-fed mice. J Lipid Res 44:2109–2119[Abstract/Free Full Text]
  13. Horton JD, Shah NA, Warrington JA, Anderson NN, Park SW, Brown MS, Goldstein JL 2003 Combined analysis of oligonucleotide microarray data from transgenic and knockout mice identifies direct SREBP target genes. Proc Natl Acad Sci USA 100:12027–12032[Abstract/Free Full Text]
  14. Dubuc G, Chamberland A, Wassef H, Davignon J, Seidah NG, Bernier L, Prat A 2004 Statins upregulate PCSK9, the gene encoding the proprotein convertase neural apoptosis-regulated convertase-1 implicated in familial hypercholesterolemia. Arterioscler Thromb Vasc Biol 24:1454–1459[Abstract/Free Full Text]
  15. Lalanne F, Lambert G, Amar MJ, Chetiveaux M, Zair Y, Jarnoux AL, Ouguerram K, Friburg J, Seidah NG, Brewer Jr HB, Krempf M, Costet P 2005 Wild-type PCSK9 inhibits LDL clearance but does not affect apoB-containing lipoprotein production in mouse and cultured cells. J Lipid Res 46:1312–1319[Abstract/Free Full Text]
  16. Maxwell KN, Breslow JL 2004 Adenoviral-mediated expression of Pcsk9 in mice results in a low-density lipoprotein receptor knockout phenotype. Proc Natl Acad Sci USA 101:7100–7105[Abstract/Free Full Text]
  17. Park SW, Moon YA, Horton JD 2004 Post-transcriptional regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin/kexin type 9a in mouse liver. J Biol Chem 279:50630–50638[Abstract/Free Full Text]
  18. Benjannet S, Rhainds D, Essalmani R, Mayne J, Wickham L, Jin W, Asselin MC, Hamelin J, Varret M, Allard D, Trillard M, Abifadel M, Tebon A, Attie AD, Rader DJ, Boileau C, Brissette L, Chretien M, Prat A, Seidah NG 2004 NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol. J Biol Chem 279:48865–48875[Abstract/Free Full Text]
  19. Maxwell KN, Fisher EA, Breslow JL 2005 Overexpression of PCSK9 accelerates the degradation of the LDLR in a post-endoplasmic reticulum compartment. Proc Natl Acad Sci USA 102:2069–2074[Abstract/Free Full Text]
  20. Ouguerram K, Chetiveaux M, Zair Y, Costet P, Abifadel M, Varret M, Boileau C, Magot T, Krempf M 2004 Apolipoprotein B100 metabolism in autosomal-dominant hypercholesterolemia related to mutations in PCSK9. Arterioscler Thromb Vasc Biol 24:1448–1453[Abstract/Free Full Text]
  21. Rashid S, Curtis DE, Garuti R, Anderson NN, Bashmakov Y, Ho YK, Hammer RE, Moon YA, Horton JD 2005 Decreased plasma cholesterol and hypersensitivity to statins in mice lacking Pcsk9. Proc Natl Acad Sci USA 102:5374–5379[Abstract/Free Full Text]
  22. Cohen J, Pertsemlidis A, Kotowski IK, Graham R, Garcia CK, Hobbs HH 2005 Low LDL cholesterol in individuals of African descent resulting from frequent nonsense mutations in PCSK9. Nat Genet 37:161–165[CrossRef][Medline]
  23. Cohen JC, Boerwinkle E, Mosley Jr TH, Hobbs HH 2006 Sequence variations in PCSK9, low LDL, and protection against coronary heart disease. N Engl J Med 354:1264–1272[Abstract/Free Full Text]
  24. Berge KE, Ose L, Leren TP 2006 Missense mutations in the PCSK9 gene are associated with hypocholesterolemia and possibly increased response to statin therapy. Arterioscler Thromb Vasc Biol 26:1094–1100[Abstract/Free Full Text]
  25. Kotowski IK, Pertsemlidis A, Luke A, Cooper RS, Vega GL, Cohen JC, Hobbs HH 2006 A spectrum of PCSK9 alleles contributes to plasma levels of low-density lipoprotein cholesterol. Am J Hum Genet 78:410–422[CrossRef][Medline]
  26. Costet P, Cariou B, Lambert G, Lalanne F, Lardeux B, Jarnoux AL, Grefhorst A, Staels B, Krempf M 2006 Hepatic PCSK9 expression is regulated by nutritional status via insulin and sterol regulatory element-binding protein 1c. J Biol Chem 281:6211–6218[Abstract/Free Full Text]
  27. Costet P, Legendre C, More J, Edgar A, Galtier P, Pineau T 1998 Peroxisome proliferator-activated receptor {alpha}-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis. J Biol Chem 273:29577–29585[Abstract/Free Full Text]
  28. Hashimoto T, Cook WS, Qi C, Yeldandi AV, Reddy JK, Rao MS 2000 Defect in peroxisome proliferator-activated receptor {alpha}-inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting. J Biol Chem 275:28918–28928[Abstract/Free Full Text]
  29. Kroetz DL, Yook P, Costet P, Bianchi P, Pineau T 1998 Peroxisome proliferator-activated receptor {alpha} controls the hepatic CYP4A induction adaptive response to starvation and diabetes. J Biol Chem 273:31581–31589[Abstract/Free Full Text]
  30. Leone TC, Weinheimer CJ, Kelly DP 1999 A critical role for the peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) in the cellular fasting response: the PPAR{alpha}-null mouse as a model of fatty acid oxidation disorders. Proc Natl Acad Sci USA 96:7473–7478[Abstract/Free Full Text]
  31. Fromes Y, Salmon A, Wang X, Collin H, Rouche A, Hagege A, Schwartz K, Fiszman MY 1999 Gene delivery to the myocardium by intrapericardial injection. Gene Ther 6:683–688[CrossRef][Medline]
  32. Lambert G, Amar MJ, Guo G, Brewer Jr HB, Gonzalez FJ, Sinal CJ 2003 The farnesoid X-receptor is an essential regulator of cholesterol homeostasis. J Biol Chem 278:2563–2570[Abstract/Free Full Text]
  33. Gonzalez-Navarro H, Nong Z, Amar MJ, Shamburek RD, Najib-Fruchart J, Paigen BJ, Brewer Jr HB, Santamarina-Fojo S 2004 The ligand-binding function of hepatic lipase modulates the development of atherosclerosis in transgenic mice. J Biol Chem 279:45312–45321[Abstract/Free Full Text]
  34. McFarlane AS 1958 Efficient trace-labelling of proteins with iodine. Nature 182:53[Medline]
  35. Greif P, Wastney M, Linares O, Boston R 1998 Balancing needs, efficiency, and functionality in the provision of modeling software: a perspective of the NIH WinSAAM Project. Adv Exp Med Biol 445:3–20[Medline]
  36. Matsusue K, Gavrilova O, Lambert G, Brewer Jr HB, Ward JM, Inoue Y, LeRoith D, Gonzalez FJ 2004 Hepatic CCAAT/enhancer binding protein {alpha} mediates induction of lipogenesis and regulation of glucose homeostasis in leptin-deficient mice. Mol Endocrinol 18:2751–2764[Abstract/Free Full Text]
  37. Kraemer FB, Laane C, Park B, Sztalryd C 1994 Low-density lipoprotein receptors in rat adipocytes: regulation with fasting. Am J Physiol 266:E26–E32
  38. Millar JS, Maugeais C, Ikewaki K, Kolansky DM, Barrett PH, Budreck EC, Boston RC, Tada N, Mochizuki S, Defesche JC, Wilson JM, Rader DJ 2005 Complete deficiency of the low-density lipoprotein receptor is associated with increased apolipoprotein B-100 production. Arterioscler Thromb Vasc Biol 25:560–565[Abstract/Free Full Text]
  39. Twisk J, Gillian-Daniel DL, Tebon A, Wang L, Barrett PH, Attie AD 2000 The role of the LDL receptor in apolipoprotein B secretion. J Clin Invest 105:521–532[Medline]
  40. Chakrabarti R, Vikramadithyan RK, Misra P, Hiriyan J, Raichur S, Damarla RK, Gershome C, Suresh J, Rajagopalan R 2003 Ragaglitazar: a novel PPAR{alpha} PPAR{gamma} agonist with potent lipid-lowering and insulin-sensitizing efficacy in animal models. Br J Pharmacol 140:527–537[CrossRef]
  41. Glosli H, Gudbrandsen OA, Mullen AJ, Halvorsen B, Rost TH, Wergedahl H, Prydz H, Aukrust P, Berge RK 2005 Down-regulated expression of PPAR{alpha} target genes, reduced fatty acid oxidation and altered fatty acid composition in the liver of mice transgenic for hTNF{alpha}. Biochim Biophys Acta 1734:235–246[Medline]
  42. Olofsson SO, Stillemark-Billton P, Asp L 2000 Intracellular assembly of VLDL: two major steps in separate cell compartments. Trends Cardiovasc Med 10:338–345[CrossRef][Medline]
  43. Asp L, Magnusson B, Rutberg M, Li L, Boren J, Olofsson SO 2005 Role of ADP ribosylation factor 1 in the assembly and secretion of ApoB-100-containing lipoproteins. Arterioscler Thromb Vasc Biol 25:566–570[Abstract/Free Full Text]
  44. Grozdanov PN, Petkov PM, Karagyozov LK, Dabeva MD 2006 Expression and localization of PCSK9 in rat hepatic cells. Biochem Cell Biol 84:80–92[CrossRef][Medline]
  45. Tremblay AJ, Lamarche B, Ruel IL, Hogue JC, Bergeron J, Gagne C, Couture P 2004 Increased production of VLDL apoB-100 in subjects with familial hypercholesterolemia carrying the same null LDL receptor gene mutation. J Lipid Res 45:866–872[Abstract/Free Full Text]
  46. Barter PJ, Nestel PJ 1973 Precursors of plasma triglyceride fatty acids in obesity. Metabolism 22:779–783[CrossRef][Medline]
  47. Ginsberg HN, Zhang YL, Hernandez-Ono A 2005 Regulation of plasma triglycerides in insulin resistance and diabetes. Arch Med Res 36:232–240[CrossRef][Medline]
  48. Evans RM, Barish GD, Wang YX 2004 PPARs and the complex journey to obesity. Nat Med 10:355–361[CrossRef][Medline]
  49. Ameen C, Edvardsson U, Ljungberg A, Asp L, Akerblad P, Tuneld A, Olofsson SO, Linden D, Oscarsson J 2005 Activation of peroxisome proliferator-activated receptor {alpha} increases the expression and activity of microsomal triglyceride transfer protein in the liver. J Biol Chem 280:1224–1229[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
F. Leblond, N. G. Seidah, L.-P. Precourt, E. Delvin, M. Dominguez, and E. Levy
Regulation of the proprotein convertase subtilisin/kexin type 9 in intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G805 - G815.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
M Abifadel, L Bernier, G Dubuc, G Nuel, J-P Rabes, J Bonneau, A Marques, M Marduel, M Devillers, A Munnich, et al.
A PCSK9 variant and familial combined hyperlipidaemia
J. Med. Genet., December 1, 2008; 45(12): 780 - 786.
[Abstract] [Full Text] [PDF]


Home page
Clin. Chem.Home page
G. Lambert, N. Ancellin, F. Charlton, D. Comas, J. Pilot, A. Keech, S. Patel, D. R. Sullivan, J. S. Cohn, K.-A. Rye, et al.
Plasma PCSK9 Concentrations Correlate with LDL and Total Cholesterol in Diabetic Patients and Are Decreased by Fenofibrate Treatment
Clin. Chem., June 1, 2008; 54(6): 1038 - 1045.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kourimate, C. Le May, C. Langhi, A. L. Jarnoux, K. Ouguerram, Y. Zair, P. Nguyen, M. Krempf, B. Cariou, and P. Costet
Dual Mechanisms for the Fibrate-mediated Repression of Proprotein Convertase Subtilisin/Kexin Type 9
J. Biol. Chem., April 11, 2008; 283(15): 9666 - 9673.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lambert, G.
Right arrow Articles by Costet, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lambert, G.
Right arrow Articles by Costet, P.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*OMIM
*UniGene
*Substance via MeSH
Medline Plus Health Information
*Diets
*Genetics Home Reference


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals