| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Université de Nantes (G.L., A.-L.J., O.P., M.C., C.L., M.K., P.C.) , UFR de Médecine; Institut de la Santé et de la Recherche Médicale, Unité 539; Centre Hospitalier Universitaire Hôtel-Dieu, 44093 Nantes, France; and Laboratoire de Pharmacologie et Toxicologie (T.P.), Institut National de la Recherche Agronomique, 31000 Toulouse, France
Address all correspondence and requests for reprints to: Gilles Lambert, Institut National de la Santé et de la Recherche Médicale, Unité 539, Centre Hospitalier Universitaire Hôtel Dieu, 3eme étage Nord, 1 Place Alexis Ricordeau, 44093 Nantes cedex 1, France. E mail: gilles.lambert{at}univ-nantes.fr.
| Abstract |
|---|
|
|
|---|
activity and target genes expression. Finally, we show that PCSK9 hepatic expression is inhibited by the hypotriglyceridemic peroxisome proliferator-activated receptor-
agonist fenofibrate. In summary, the negative modulation of LDLr expression by PCSK9, which decreases plasma LDL clearance, also promotes an overproduction of nascent VLDL in vivo upon fasting. | Introduction |
|---|
|
|
|---|
But definitive evidence for a role for PCSK9 in lipoprotein metabolism has recently been established by a series of studies showing that adenoviral-mediated overexpression of PCSK9 promotes the accumulation of LDL in the plasma of control mice but not in that of LDLr-deficient animals (15, 16, 17). Moreover, hepatic LDLr levels are reduced in mice overexpressing PCSK9 (17). The expression of PCSK9 mutants capable (F216L) or incapable (S127R) of autocatalytic processing also results in decreased LDLr expression and increased plasma LDL (17). Likewise, cell surface LDLr levels and activity are reduced in lymphoblasts of S127R patients and in cultured cells overexpressing PCSK9, whereas they increased in hepatoma cells knocked down for PCSK9 (15, 18, 19). In agreement with these studies, LDL clearance from the plasma of S127R patients is reduced compared with that of control individuals (20). Conversely, PCSK9-deficient mice present with 3-fold increased hepatic LDLr expression and LDL plasma clearance (21), whereas a 40% reduction in LDL-cholesterol is associated with two nonsense mutations of PCSK9 common in African-Americans (
2%) (22). These mutations have been associated with a 10-fold reduced incidence of coronary heart disease over a 15-yr interval in the ARIC (Atherosclerosis Risk in Communities) study (23). Furthermore, new missense variants of PCSK9 (e.g. R46L) have recently been associated with hypocholesterolemia and also appear to reduce the incidence of coronary heart disease and to possibly increase response to statin therapy (23, 24, 25). Together, these studies clearly demonstrate that PCSK9 inhibits LDLr expression and thus LDL hepatic uptake, presumably by accelerating the intracellular degradation of the LDLr (19).
Besides its unequivocal effect on LDL clearance, PCSK9 has also been proposed to modulate the production of apoB-containing lipoproteins (LpB) (9, 20). However, the hepatic production of LpB is similar in mice overexpressing PCSK9 and in controls (15, 16, 17). Furthermore, apoB100 secretion from isolated hepatocytes is not significantly altered in PCSK9-deficient mice (21). Whether PCSK9 modulates the hepatic output of apoB-containing lipoproteins remains therefore to be established.
We recently characterized the PCSK9 promoter and showed that its expression is down-regulated in 24-h fasted mice and up-regulated by insulin via SREBP1c (26). It is well established that fasting causes lipolysis in adipose tissue leading to the release of free fatty acids (FFA) that complex with albumin in the plasma and reach the liver where they are metabolized. In mice, this is associated with hepatic steatosis, a process in which the peroxisome proliferator-activated receptor-
(PPAR
) plays a pivotal regulatory role (27, 28, 29, 30). Because the kinetic study showing that VLDL-apoB production rate is sharply increased in PCSK9 S127R patients compared with controls and LDLr heterozygous patients (20) was also performed in fasting conditions, we reasoned that if PCSK9 plays a role in the hepatic production of LpB, this might be uncovered upon dietary challenges such as long-term fasting.
Thus, to gain additional insight into the role of PCSK9 in lipoprotein metabolism, we transiently overexpressed PCSK9 in fed and fasted mice. We show that PCSK9 overexpression promotes hypercholesterolemia and massive hypertriglyceridemia only in 24-h fasted animals due to dramatically increased VLDL hepatic output. We also investigated the subsequent alterations of intrahepatic lipid levels in these animals as well as the role played by the LDLr in that process. Finally, we show that PPAR
negatively regulates the expression of PCSK9 in vivo.
| Materials and Methods |
|---|
|
|
|---|
(/) mice (27) on a pure C57BL6/J background (812 wk old) were housed in a pathogen-free facility under a standard 12-h light, 12-h dark cycle and fed a standard rodent chow and water ad libitum. Mice were anesthetized with isoflurane (Abbott, Rungis, France) and injected with 5 x 108 pfu via the penis vein. Blood samples were collected between 0900 and 1000 h from the retroorbital plexus and centrifuged at 2500 x g for 20 min at 4 C for plasma isolation. Five days after infusion, 50% of mice were fasted for 24 h. Fasted mice were placed at 0900 h in individual cages with access to water ad libitum for 24 h. Mice were injected either with Tyloxapol (Sigma Chemical Co., St. Louis, MO) (500 µg/g body weight) to measure hepatic VLDL output in the plasma taken from each mouse at 0, 60, and 130 min after injection (32) or with heparin (A.P.P. Inc., Shaumburg, IL) (5 U/g body weight). Fenofibrate (Sigma) was administered by gavage (100 mg/kg body wt·d) dispersed in water containing 3% (wt/vol) gum arabic as vehicle for 7 d. Mice were then euthanized and their livers harvested, frozen in liquid nitrogen, and stored at 80 C.
Plasma chemistry and lipase activity
Plasma total cholesterol (TC) and triglycerides (TG) (Biomerieux, Marcy lEtoile, France), FFA (Wako Chemicals, Neuss, Germany), as well as aspartate aminotransferase (AST) and alanine aminotransferase (ALT) (Roche, Meylan, France) were measured using commercial kits. Plasma lipoproteins from pooled mouse samples (200 µl) were resolved by fast protein liquid chromatography (FPLC), as previously described (32). Post-heparin plasma lipase activity was measured using a modified TG molecule as substrate (1-trinytrophenyl-amino-dodecanoyl-2pyrenedecanoyl-30-hexadecyl-sn-glycerol) in which the pyrene group is quenched by the trinitrophenyl group. Plasma lipases [murine lipoprotein lipase (LPL) at pH 8.2 with 1 M NaCl and hepatic lipase (HL) at pH 8.8 with 5 M NaCl] hydrolyze the quencher and the fluorescence of the pyrene (Excitation 400 nm-Emission 342 nm) is measured (Continuous Fluorometric Lipase Test kit; Progen, Heidelberg, Germany).
VLDL/intermediate-density lipoprotein (IDL) apoB kinetic studies
VLDL/IDL were isolated by ultracentrifugation in KBr (density < 1.019) from 2 ml of plasma from C57BL6 mice infused with Ad-PCSK9 and fasted for 24 h 5 d after adenoviral infusion (33). VLDL/IDL were labeled on their apoB moiety with 125I (34), reisolated by ultracentrifugation, and dialyzed extensively against PBS. The integrity of the particles was ascertained by FPLC and agarose gel electrophoresis. The 125I-labeled apoB VLDL/IDL (106 dpm) were injected into the saphenous vein of mice (n = 5 per experimental group). Mice were bled at different time points, their VLDL/IDL isolated by ultracentrifugation, and their apoB moiety isolated by SDS-PAGE. As described below, the apoB bands were excised and 125I-labeled apoB radioactivity measured (33). The fractional catabolic rates (FCR) were determined from the area under the apoB radioactivity curve using the multiexponential curve-fitting technique in the Win-SAAM program (35). The apoB VLDL/IDL production rates (PR) were calculated as follows: PR = [FCR (d1)] x [plasma volume (ml)] x [plasma apoB-VLDL/IDL concentration (µg/ml)]/[body weight (g)]. Plasma volume was estimated as 3.16% of body weight, and plasma apoB VLDL/IDL concentrations were measured by ELISA after ultracentrifugation of plasma aliquots, as previously described (33).
Western blots
Liver pieces were homogenized in 1x PBS containing 0.25% Na-deoxycholate, 1% Triton X-100, and a protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany). The supernatant was collected and proteins (80 µg liver protein) were resolved on Nu-PAGE 412% Bis-Tris gels in 2-(N-morpholino)ethanesulfonic acid-SDS buffer (Invitrogen, Cergy Pontoise, France) under reducing conditions. To analyze PPAR
and SREBP2 activity by immunoblot, nuclear proteins from mouse liver pieces (40 mg) were purified with the NE-PER extraction kit (Pierce, Rockford, IL). Proteins were transferred onto a Protran nitrocellulose membrane (Schleicher & Shuell, Dassel, Germany), probed with a polyclonal rabbit IgG directed against the CRSRHLAGASQELQ peptide (Neosystem, Strasbourg, France), an epitope of the C-terminal domain of human and mouse PCSK9, with a polyclonal goat IgG directed against the extracellular domain of the mouse LDLr (R&D Systems, Minneapolis, MN), with a polyclonal rabbit IgG anti-PPAR
(Cayman Chemicals, Ann Arbor, MI), with a polyclonal IgG anti-SREBP2 (Santa Cruz Biotechnology, Santa Cruz, CA), with the polyclonal IgG anti-cyclophilin A (Upstate, Lake Placid, NY), or with the monoclonal anti-ß-actin AC-15 antibody (Sigma) and resolved using the ECL plus kit (Amersham, Little Chalfont, UK). Mouse apoA-I, apoA-II, and apoB within FPLC fractions (20 µl) were analyzed by Western blot using antibodies against the purified apolipoproteins (Biodesign, Saco, ME), as previously described (15).
Real-time PCR
Liver total RNA was isolated using the RNeasy kit and Qiashredder mini columns as well as RNase-free DNase I (QIAGEN, Courtaboeuf, France). First-strand cDNA was synthesized with random primers using a Superscript II RNase H reverse transcriptase reagent kit (Invitrogen). Real-time PCR analysis was performed on the 7000 Sequence Detection System with SYBR Green PCR Master Mix (Applied Biosystems, Courtaboeuf, France). Oligonucleotides were designed using Primer Express software (Applied Biosystems). All samples were normalized to cyclophilin expression. Sequences were (forward and reverse, respectively) as follows: cyclophilin, TGGCAAATGCTGGACCAAA and GCCATCCAGCCATTCAGTCT; fatty acid synthase (FAS), TCCTGGAACGAGAACACGATCT and GAGACGTGTCACTCCTGGACTTG; SREBP1, GGCACTAAGTGCCCTCAACCT and GCCACATAGATCTCTGCCAGTGT; diacylglycerol acyltransferase (DAGT), GGTTAACCTGGCCACAATCATC and AGGTTGACATCCCGGTAGGAAT; carnitine palmitoyl transferase 1a (CPT1a), TGCCAGGAGGTCATAGACACATC and ACTCGTCCGGCACTTCTTGAT; apoA5, CTGGGACTACTTCAGCCAAAACAG and TGCTCGAAGCTGCCTTTCAG; acyl-CoA dehydrogenase (short-chain DH), TGGTGCAGGCTTGGATTACC and CTGCTGTGCGGATCCAAACT; acyl-CoA dehydrogenase (long-chain DH), GGGAGAAAGCTGGAGAAGTGAGT and GAGTACGCTTGCTCTTCCCAAGT; HMG-CoA reductase GTCGCTGGATAGCTGATCCTTCT and TTCGTCCAGACCCAAGGAAAC; HMG-CoA synthase, TGGTGGATGGGAAGCTGTCT and GAGGGTGAAAGGCTGGTTGTT; thiolase, TCTACATGGGCAATGTCATCCA and GTAAACCTGCGCCCAGTGTT; PPAR
, CCCTGAACATCGAGTGTCGAAT and AAGCCCTTACAGCCTTCACATG; stearoyl-CoA desaturase 1 (SCD1) GGCGTTCCAGAATGACGTGTA and GTCGGCGTGTGTTTCTGAGAA; LDLr, ACCTGCCGACCTGATGAATTC and GCAGTCATGTTCACGGTCACA; elongase TCGCTGACTCTTGCCGTCTT and TGCTTCAGGCCTTTGGTCAT; CD36, CAGAGTTCGTTATCTAGCCAAGGAA and CCATTGGGCTGTACAAAAGACA; angiopoietin-like 3 (AngpL3) CGACTCGAGCTACAAGACTGGAA and CCAGCAATCTCAGCCACATGT; and SREBP2, GTGCGCTCTCGTTTTACTGAAGT and TACAGGTATAGAAGACGGCCTTCAC.
Histology, hepatic lipids, and microsomal transfer protein (MTP) activity assays
Frozen liver pieces (
75 µg) were homogenized in 1 ml of 10 mM Tris, 150 mM NaCl, 2 mM EDTA buffer containing the protease inhibitor cocktail, and 0.5 ml of the homogenate was centrifuged at 7000 x g for 10 min at 4 C. The supernatant was collected and protein concentration was determined using the BCA kit (Interchim, Montluçon, France). MTP activity was measured using 50 µg of the homogenate and a commercial kit (Roar Biomedical Inc., New York, NY). Lipids were extracted from the remaining 0.5 ml of liver homogenates in 2 ml isopropylether/butanol (6/4, vol/vol) in 4-ml glass vials. The mixture was centrifuged at 3500 x g for 5 min at 4 C and the supernatant (organic phase) transferred to a new vial and evaporated under N2 at 55 C. The dried pellet was suspended in ethanol and assayed for cholesterol and TG. Frozen liver sections in OCT compound were stained with Oil Red O, as previously described (36).
Statistical analysis
Values are expressed as mean ± SEM. Comparisons between groups were made using the Students t test for independent samples.
| Results |
|---|
|
|
|---|
|
We next measured the level of PCSK9 expression by immunoblot in the livers of these animals, collected on d 6 after adenoviral infusion. In Ad-null sham infused mice, the endogenous hepatic expression of PCSK9 was reduced by 50% upon fasting (Fig. 2A
). Conversely, the Ad-PCSK9 infusion resulted in an approximately 3-fold increase in the levels of hepatic PCSK9 expression in both fed and fasted mice, ruling out the possibility that variability in transgene expression may explain the differences observed in plasma lipids among both experimental groups.
|
Finally, we assessed the expression of the LDLr by immunoblot in the livers of these mice (Fig. 2E
). As expected, the overexpression of PCSK9 decreased the hepatic levels of LDLr in both fed and fasted C57BL mice. Ad-null-infused mice had similar levels of hepatic LDLr protein levels in both fed and fasted states, as published elsewhere (37). To our surprise, there was a much sharper decrease in LDLr expression upon PCSK9 overexpression in fasted mice compared with fed controls (90% vs. 55%, respectively).
ApoB-containing lipoprotein metabolism in fasted C57BL6 mice overexpressing PCSK9
To elucidate the mechanisms underlying the increased TC and hypertriglyceridemia observed in C57BL6 mice overexpressing PCSK9 and fasted for 24 h, we performed a similar experiment following the same adenoviral/nutritional pattern. On d 6 after adenoviral infusion of mice, their plasma lipases were transiently blocked with tyloxapol injections, and the resulting accumulation of TG in the plasma of the animals, reflecting the hepatic output of VLDL, was measured (Fig. 3A
). The rate of accumulation of TG was maximal in the plasma of C57BL6 mice overexpressing PCSK9 and fasted for 24 h compared with that of the three other experimental groups. Furthermore, the hepatic output of apoB100 (Fig. 3B
) but not of apoB48 (not shown), was approximately 3-fold increased in C57BL mice overexpressing PCSK9 fasted for 24 h compared with the three other groups. Mice infused with either Ad-PCSK9 or Ad-null and fed ad libitum displayed similar levels of TG and apoB hepatic output, as previously reported (15).
|
Plasma lipids, lipoproteins, and hepatic VLDL output of LDLr (/) mice overexpressing PCSK9 upon fasting conditions
Because PCSK9 dramatically decreased the expression of the LDLr in fasted mice (Fig. 2E
) and because the LDLr has been proposed to be involved in the secretion and/or recapture of nascent apoB100-containing lipoproteins by the liver (38, 39), we reasoned that the virtual disappearance of the LDLr upon PCSK9 overexpression may explain the hyperlipidemia observed in C57BL6 mice fasted for 24 h. Thus, we performed a similar series of experiments following the same adenoviral/nutritional pattern in LDLr (/) male mice on the same genetic C57BL6 background. LDLr (/) mice had plasma TC levels of approximately 400 mg/dl on d 5 after Ad-PCSK9 or Ad-null infusion. Half of the animals were then fasted for 24 h and the other half fed ad libitum. Both Ad-PCSK9- and Ad-null-infused mice plasma TC levels increased by 100 mg/dl upon fasting but remained steady in fed animals (Fig. 4A
). Likewise, LDLr (/) mice had similar plasma TG levels on d 5 after Ad-PCSK9 or Ad-null infusion, and both groups had dramatically increased plasma TG levels by 260 mg/dl upon fasting but not fed condition (Fig. 4B
). The FPLC TG profile of the four experimental groups indicates that LDLr (/) mice overexpressing or not PCSK9 presented with a massive accumulation of VLDL in their plasma upon fasting (Fig. 4C
). The levels of apoB100 in the VLDL peak followed accordingly (not shown).
|
Concomitantly, a set of C57BL6 mice underwent the same series of experiments. Plasma lipids, FPLC profiles, and tyloxapol data were identical to those presented above (Figs. 1
, 2D
, and 3A
). The rate of accumulation of TG was increased by 100% in Ad-PCSK9-infused C57BL6 mice fasted for 24 h compared with the three other experimental groups. Noteworthy, the rate of VLDL-TG output was 3-fold faster in C57BL6 mice overexpressing PCSK9 than in LDLr (/) mice, upon fasting conditions (i.e. 12.9 vs. 4.1 mg TG/g liver·h, respectively).
Hepatic lipids and plasma FFA levels in LDLr (/) and C57BL6 mice infused with Ad-null or Ad-PCSK9
To determine the origin of liver-derived VLDL-TG, we performed histological analysis of liver sections from C57BL6 mice infused with Ad-PCSK9 or Ad-null and fasted for 24 h or fed ad libitum before organ harvesting. There was an accumulation of Oil-Red-O-stained neutral lipids, i.e. steatosis, in the livers of fasted mice. The extent of fat accumulation was lower in the liver of fasted mice infused with Ad-PCSK9 compared with Ad-null (Fig. 5A
). Fed animals did not display any hepatic steatosis, irrespective of the adenoviral infusion status. We measured the cholesterol and TG contents of the livers of C57BL6 mice infused either with Ad-null or Ad-PCSK9 and fed or fasted 24 h before being killed. Fasting promoted massive accumulation of cholesterol and TG in the livers of mice irrespective of the adenoviral infusion status. However, the hepatic accumulation of TG upon fasting was lower in PCSK9-overexpressing mice compared with Ad-null controls, in agreement with our histological observations (Fig. 5B
). In these mice, there was an inverse relationship between the hepatic TG content and the level of VLDL-TG output. In the LDLr (/) background, fasting also promoted an increase in the levels of hepatic lipids accumulation, but no significant difference could be observed between Ad-PCSK9- and Ad-null-infused animals (data not shown).
|
Expression levels of genes involved in hepatic lipid metabolism in C57BL6 mice infused with Ad-null or Ad-PCSK9 and fasted or fed
To understand the molecular mechanisms underlying or associated with the modulation of VLDL output and hepatic lipid content upon PCSK9 expression in fasted C57BL6 mice, we performed quantitative RT-PCR analysis of a series of genes presumably involved in hepatic complex lipids as well as fatty acid metabolism. Fasting reduced the expression levels of key lipogenic genes such as FAS, SREBP1, stearoyl-CoA desaturase, and elongase as well as that of the steroidogenic rate-limiting enzyme HMG-CoA reductase, and to a lower extent of the LDLr, irrespective of the adenoviral infusion status (Fig. 6A
). There was a trend (P = 0.08) toward a decreased expression of SREBP2 only in fasted mice overexpressing PCSK9 (Fig. 6A
).
|
A significant difference between Ad-PCSK9- and Ad-null-infused animals was observed only in fed animals with a 50% reduction in CPTI and HMG-CoA synthase gene expression. Because the expression of both genes is regulated by PPAR
(40, 41), we also measured the expression level of PPAR
in the livers of the four experimental groups. To our surprise, the pattern of PPAR
expression was also reduced by 50% in fed mice overexpressing PCSK9 compared with Ad-null controls and increased upon fasting in both Ad-PCSK9- and Ad-null-infused animals (Fig. 6B
). To evaluate the physiological relevance of the variations in SREBP2 and PPAR
levels observed by RT-PCR among groups, we performed the immunoblot analysis of these factors in nuclear extracts isolated from mouse liver pieces from each experimental group (Fig. 6C
), because nuclear levels of transcription factors parallel their activity. In fed mice, the overexpression of PCSK9 resulted in sharply decreased nuclear SREBP2 and PPAR
levels, whereas in fasted mice, the overexpression of PCSK9 had no significant effect on SREBP2 and PPAR
nuclear expression (P = 0.92 and 0.55, respectively).
PCSK9 hepatic expression in C57BL6 and PPAR (/) mice
We have shown that PPAR
hepatic expression is decreased in fed but not in fasted mice overexpressing PCSK9. Because PPAR
plays a central role in the setting of hepatic steatosis observed upon long-term fasting (27, 28, 29, 30), and because this phenomenon is altered in the liver of fasted Ad-PCSK9 (compared with fasted Ad-null) mice, we hypothesized that PPAR
may also regulate the expression of PCSK9 in vivo. Thus we assessed the endogenous mRNA expression of PCSK9 in the livers of C57BL6 and PPAR
(/) mice previously treated with the PPAR
agonist fenofibrate or with a sham vehicle solution for 7 d (Fig. 7A
). The expression of a positive PPAR
target gene, Cyp4a10, was induced as anticipated by fenofibrate and abolished in PPAR
(/) mice. Conversely, the expression of PCSK9 was reduced by 68% in the liver of C57BL6 mice after fenofibrate treatment compared with vehicle-treated controls. Fenofibrate treatment failed to down-regulate PCSK9 expression in the liver of PPAR
(/) mice (Fig. 7A
). The PCSK9 protein expression levels assessed by Western blot followed accordingly, with a 58% reduction in PCSK9 expression in C57BL6 mice after fenofibrate treatment and a lack of effect of fenofibrate on PCSK9 protein expression in PPAR
(/) mice (Fig. 7B
). A similar 61% decrease in PCSK9 protein hepatic content was observed upon fenofibrate treatment using C57BL6 male mice instead of females (data not shown).
|
| Discussion |
|---|
|
|
|---|
activity. Furthermore, PCSK9 expression itself is down-regulated by the PPAR
agonist fenofibrate. First we showed that mice overexpressing PCSK9 and fasted for 24 h present with hyperlipidemia characterized by a massive accumulation of plasma TG-rich apoB100-containing lipoproteins (VLDL and IDL), whereas PCSK9 overexpression has no effect on the plasma levels of TG-rich lipoproteins in fed animals, as previously reported (15, 16, 17). We also showed using both the tyloxapol technique as well as apoB VLDL/IDL kinetic studies that this increase in plasma lipids results from increased hepatic VLDL apoB as well as TG output but not from altered plasma lipase activity. In agreement with these findings, PCSK9 S127R patients present with elevated VLDL-apoB100 production under fasting conditions (20), and it has been suggested by in vitro studies that the severe hypercholesterolemia observed in PCSK9 D374Y patients was associated with increased apoB100 secretion (7, 9). VLDL formation in the hepatocytes occurs in two steps. The first step involves the MTP-mediated lipidation of apoB100 during its translation (42). In our experiments, changes in hepatic MTP activity could not account for the plasma lipid increases observed. The second step in which the major amount of TG is added to the nascent VLDL particle, in coatomer protein complex vesicles, is less well characterized (43). Recently, it has been shown in rat hepatocytes that coatomer protein complex II vesicles contain a large amount of intracellular PCSK9 (44). Whether PCSK9 modulates VLDL formation at this subcellular level remains to be studied.
Next we showed that the hepatic expression of the LDLr is decreased by half in fed mice and virtually abolished in fasted mice overexpressing PCSK9. Furthermore, in LDLr (/) mice, fasting also promotes hyperlipidemia characterized by a massive accumulation of VLDL-TG and apoB, whether PCSK9 is overexpressed or not. We also showed that the net output of VLDL-TG is increased in fasted LDLr (/) mice infused with either Ad-PCSK9 or Ad-null compared with fed animals. Taken together, these data indicate that the negative modulation of LDLr expression by PCSK9 in C57BL6 mice is a key molecular mechanism allowing increased VLDL hepatic output upon fasting. The LDLr has been shown to play a pivotal role in apoB-containing lipoprotein secretion, because primary hepatocytes from LDLr (/) mice secrete more apoB than controls as a result of reduced intracellular presecretory degradation of apoB as well as a lack of recapture of nascent VLDL (39). Kinetic studies in FH patients (38, 45) are often contradictory on that matter, but it appears that the condition for an alteration of apoB production is a virtual absence of LDLr expression. Thus, the dramatic decrease in LDLr expression observed in fasted mice overexpressing PCSK9 and the subsequent decrease in intracellular apoB degradation seems to be the key mechanism by which VLDL hepatic output is increased in our model. Because upon fasting conditions, the absolute hepatic VLDL output is faster in C57BL6 mice overexpressing PCSK9 compared with LDLr (/) animals, we cannot rule out that under physiological circumstances unraveled by long-term fasting, PCSK9 may also act via LDLr-independent pathways to modulate VLDL secretion (dotted line in Fig 8
). The cell biology studies mentioned above (42, 43, 44) indicate that PCSK9 is localized in organelles in which lipids are added to nascent VLDL particles. Much work is needed to establish whether PCSK9 may directly modulate apoB-containing lipoprotein anabolism via a LDLr-independent pathway.
|
Finally, we measured the expression of a series of genes in the livers of the four experimental groups to determine the mechanisms responsible or associated with increased VLDL output in mice overexpressing PCSK9 and fasted for 24 h. Among the genes tested, none were differentially expressed in fasted mice overexpressing PCSK9 compared with fasted controls. There was only a trend toward a decrease in SREBP2 mRNA expression in the livers of the Ad-PCSK9 fasted group but there was no difference in SREBP2 activity, measured by immunoblot analysis of nuclear extracts, among these two sets of mice. However, similar measurements performed in fed mice indicate that PCSK9 overexpression results in decreased SREBP2 activity. Because the LDLr level is further decreased when PCSK9 is overexpressed upon fasting, it seems very unlikely that PCSK9 might modulate LDLr protein levels via an SREBP2-dependent mechanism. In addition, the mRNA expression of the LDLr and that of HMG-CoA reductase, two targets of SREBP2, are not modulated upon PCSK9 overexpression in both fasted and fed animals (Fig. 6A
), suggesting that the mRNA expression of both genes are probably regulated by other factor(s) antagonizing SREBP2 activity, at least in the fed state. In this panel of genes, the only significant differences between Ad-PCSK9- and Ad-null-infused animals was observed in fed animals with 50% reduced expression levels of CPTI and HMG-CoA synthase. Because both genes are known PPAR
targets (40, 41), we also measured the expression levels of PPAR
and found a similar 50% decrease in fed animals overexpressing PCSK9. Upon fasting, there was an apparent lack of down-regulation in PPAR
, CPTI, and HMG-CoA synthase gene expression in mice infused with Ad-PCSK9 compared with Ad-null. Likewise, we found a significant 56% decrease in PPAR
activity in the livers of Ad-PCSK9 fed mice compared with Ad-null in the fed state but not in the fasted state. PPAR
is known to play a critical role in the transcriptional regulatory responses to fasting and subsequent steatosis (27, 28, 29, 30). Fibrates are established PPAR
ligands widely used in humans to decrease plasma TG (48), but the exact role played by PPAR
on the net VLDL hepatic output remains elusive (49). Because PPAR
expression and activity is altered in fed mice overexpressing PCSK9, a phenomenon abolished upon fasting, we hypothesized that PPAR
may also regulate PCSK9 expression. Thus, PCSK9 gene and protein expression were sharply reduced in C57BL6 but not in PPAR
(/) mice after administration of fenofibrate. Unlike Cyp4a10, PCSK9 mRNA levels were similar in control and PPAR
(/) mice, suggesting that PPAR
does not constitutively regulate PCSK9 gene expression. We are currently investigating the mechanisms of this repression.
Upon fasting, the endogenous expression of PCSK9 is decreased in mouse liver, but this does not result in increased LDLr hepatic levels, as we previously reported (26). Conversely, upon overexpression of PCSK9 using adenoviral vectors, we surprisingly observed a dramatic decrease in LDLr protein levels compared with the fed state, and this was associated with an increased rate of VLDL production. Under these experimental conditions, the regulatory mechanisms between PCSK9 and the LDLr are clearly unbalanced and result in an abnormal overproduction of VLDL (Fig. 8
). Among the factors potentially responsible for the sharp decrease in LDLr expression and subsequent VLDL overproduction, we found a lack of down-regulation of PPAR
activity. This finding does not seem sufficient to fully explain the phenotype of our mice. To discover the precise mechanisms leading to the phenotype observed in this study, the targets acted upon by PCSK9 (Fig. 8
) and responsible for decreased LDLr must be identified. In summary, our study demonstrates that fasting leads to massive hypertriglyceridemia in mice overexpressing PCSK9 because of the lack of modulation of hepatic VLDL output mostly by the LDLr, and this is associated with the mobilization of intrahepatic lipid stores and a lack of negative regulation of PCSK9 expression by PPAR
.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure information: G.L., A.-L.J., T.P., M.C., C.L., M.K., and P.C. have nothing to declare. O.P. is a recipient of the Allocation Annee de Recherche Clinique (Hopitaux/Leem/FHF).
First Published Online June 22, 2006
Abbreviations: ALT, Alanine aminotransferase; apo, apolipoprotein; AST, aspartate aminotransferase; CPTI, carnitine-palmytoyl acyltransferase I; FCR, fractional catabolic rates; FFA, free fatty acids; FH, familial hypercholesterolemia; HDL, high-density lipoprotein; HSL, hormone-sensitive lipoprotein; IDL, intermediate-density lipoprotein; LDL, low-density lipoprotein; LDLr, LDL receptor; LpB, apoB-containing lipoproteins; LPL, lipoprotein lipase; MTP, microsomal transfer protein; PCSK9, proprotein convertase subtilisin kexin type 9; PPAR
, peroxisome proliferator-activated receptor-
; PR, production rate; SREBP, sterol regulatory element-binding protein; TC, total cholesterol; TG, triglycerides.
Received January 24, 2006.
Accepted for publication June 15, 2006.
| References |
|---|
|
|
|---|
-isoform deficiency leads to progressive dyslipidemia with sexually dimorphic obesity and steatosis. J Biol Chem 273:2957729585
-inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting. J Biol Chem 275:2891828928
controls the hepatic CYP4A induction adaptive response to starvation and diabetes. J Biol Chem 273:3158131589
(PPAR
) in the cellular fasting response: the PPAR
-null mouse as a model of fatty acid oxidation disorders. Proc Natl Acad Sci USA 96:74737478
mediates induction of lipogenesis and regulation of glucose homeostasis in leptin-deficient mice. Mol Endocrinol 18:27512764
PPAR
agonist with potent lipid-lowering and insulin-sensitizing efficacy in animal models. Br J Pharmacol 140:527537[CrossRef]
target genes, reduced fatty acid oxidation and altered fatty acid composition in the liver of mice transgenic for hTNF
. Biochim Biophys Acta 1734:235246[Medline]
increases the expression and activity of microsomal triglyceride transfer protein in the liver. J Biol Chem 280:12241229This article has been cited by other articles:
![]() |
F. Leblond, N. G. Seidah, L.-P. Precourt, E. Delvin, M. Dominguez, and E. Levy Regulation of the proprotein convertase subtilisin/kexin type 9 in intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G805 - G815. [Abstract] [Full Text] [PDF] |
||||
![]() |
M Abifadel, L Bernier, G Dubuc, G Nuel, J-P Rabes, J Bonneau, A Marques, M Marduel, M Devillers, A Munnich, et al. A PCSK9 variant and familial combined hyperlipidaemia J. Med. Genet., December 1, 2008; 45(12): 780 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lambert, N. Ancellin, F. Charlton, D. Comas, J. Pilot, A. Keech, S. Patel, D. R. Sullivan, J. S. Cohn, K.-A. Rye, et al. Plasma PCSK9 Concentrations Correlate with LDL and Total Cholesterol in Diabetic Patients and Are Decreased by Fenofibrate Treatment Clin. Chem., June 1, 2008; 54(6): 1038 - 1045. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kourimate, C. Le May, C. Langhi, A. L. Jarnoux, K. Ouguerram, Y. Zair, P. Nguyen, M. Krempf, B. Cariou, and P. Costet Dual Mechanisms for the Fibrate-mediated Repression of Proprotein Convertase Subtilisin/Kexin Type 9 J. Biol. Chem., April 11, 2008; 283(15): 9666 - 9673. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |