help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0496
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/11/5110    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Attali, V.
Right arrow Articles by Leibowitz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Attali, V.
Right arrow Articles by Leibowitz, G.
Endocrinology Vol. 147, No. 11 5110-5118
Copyright © 2006 by The Endocrine Society

Regulation of Insulin Secretion and Proinsulin Biosynthesis by Succinate

Veronique Attali1, Marcela Parnes1, Yafa Ariav, Erol Cerasi, Nurit Kaiser and Gil Leibowitz

Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah-Hebrew University Medical Center, Jerusalem 91120, Israel

Address all correspondence and requests for reprints to: Gil Leibowitz, M.D., Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah-Hebrew University Medical Center, P.O. Box 12000, Jerusalem 91120, Israel. E-mail: gleib{at}hadassah.org.il.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Succinate stimulates insulin secretion and proinsulin biosynthesis. We studied the effects of reduced nicotinamide adenine dinucleotide phosphate (NADPH)-modulating pathways on glucose- and succinate-stimulated insulin secretion and proinsulin biosynthesis in the rat and the insulin-resistant Psammomys obesus. Disruption of the anaplerotic pyruvate/malate shuttle by phenylacetic acid inhibited glucose- and succinate-stimulated insulin secretion and succinate-stimulated proinsulin biosynthesis in both species. In contrast, phenylacetic acid failed to inhibit glucose-stimulated proinsulin biosynthesis in P. obesus islets. Inhibition of the NADPH-consuming enzyme neuronal nitric oxide synthase (nNOS) with L-NG-nitro-L-arginine methyl ester or with NG-monomethyl-L-arginineG doubled succinate-stimulated insulin secretion in rat islets, suggesting that succinate- and nNOS-derived signals interact to regulate insulin secretion. In contrast, nNOS inhibition had no effect on succinate-stimulated proinsulin biosynthesis in both species. In P. obesus islets, insulin secretion was not stimulated by succinate in the absence of glucose, whereas proinsulin biosynthesis was increased 5-fold. Conversely, under stimulating glucose levels, succinate doubled insulin secretion, indicating glucose-dependence. Pyruvate ester and inhibition of nNOS partially mimicked the permissive effect of glucose on succinate-stimulated insulin secretion, suggesting that anaplerosis-derived signals render the ß-cells responsive to succinate. We conclude that ß-cell anaplerosis via pyruvate carboxylase is important for glucose- and succinate-stimulated insulin secretion and for succinate-stimulated proinsulin biosynthesis. In P. obesus, pyruvate/malate shuttle dependent and independent pathways that regulate proinsulin biosynthesis coexist; the latter can maintain fuel stimulated biosynthetic activity when the succinate-dependent pathway is inhibited. nNOS signaling is a negative regulator of insulin secretion, but not of proinsulin biosynthesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE MAINTENANCE OF blood glucose in a narrow range requires tight coupling among circulating nutrients, insulin secretion, and proinsulin biosynthesis. Glucose, the main physiological stimulus for insulin secretion, regulates insulin release through actions on so-called triggering and amplifying pathways in the ß-cell (1). The ATP-sensitive K+ (K+-ATP) channels are key players in the triggering pathway (2, 3). Their activity is regulated by the mitochondrial oxidative phosphorylation of glucose metabolites, which results in an increased cytosolic ATP to ADP ratio (3), thus inhibiting potassium efflux via the channel, depolarizing the plasma membrane, and opening voltage-dependent L-type calcium channels, which increases cytosolic calcium and leads to exocytosis of insulin. In addition to the triggering pathway, the ß-cell displays pathways downstream to the K+-ATP channel, which amplify insulin secretion to yield physiological levels of the hormone in response to glucose (amplifying pathways). The metabolic regulation of the amplifying pathways is not fully clarified.

The islet redox state is correlated with its secretory function, but the causal relationship remains undetermined (4). Recently it was shown that reduced nicotinamide adenine dinucleotide phosphate (NADPH) directly stimulates insulin secretion, probably via the thioredoxin and glutaredoxin signaling pathways (5). Several anaplerotic shuttles, thought to be important for glucose-stimulated insulin secretion, produce NADPH (6, 7, 8, 9). NMR isotopomer analysis emphasized the importance of the anaplerotic flux via pyruvate carboxylase for glucose-stimulated insulin secretion (10). Moreover, it was suggested that the adaptive increase of insulin secretion in response to insulin resistance is mediated via increased activity of the pyruvate/malate shuttle (11). ß-Cell NADPH levels can be modulated also by neuronal nitric oxide synthase (nNOS), because this enzyme uses NADPH, converting it to NADP. Inhibition of nNOS was shown to augment insulin secretion (12, 13, 14). Thus, nNOS could negatively regulate insulin secretion, by reducing the ß-cell NADPH levels.

The maintenance of glucose homeostasis in the face of acute and chronic changes in insulin demand depends on tight coupling between insulin secretion and proinsulin biosynthesis. Others and we have shown that succinate is an important mediator of glucose-stimulated proinsulin biosynthesis in rat pancreatic islets (15, 16). However, the downstream metabolic signals that mediate succinate effects on proinsulin biosynthesis are not known.

In this study, we examined the role of metabolic pathways that modulate islet NADPH in the regulation of succinate-stimulated insulin secretion and proinsulin biosynthesis in rat islets. We extended our studies to the insulin-resistant gerbil Psammomys obesus, which is a good model to address questions related to ß-cell adaptation to insulin demand (17). P. obesus islets show increased sensitivity to glucose with a leftward shift of the glucose-insulin dose-response curve (17). Intriguingly, unlike its effect on rat islets, succinate did not increase insulin secretion in P. obesus (18). In light of this surprising observation, we studied the regulation of insulin secretion and proinsulin biosynthesis by succinate in P. obesus islets. Our studies unravel important metabolic networks involving anaplerotic shuttles and nNOS that modulate insulin secretion in response to mitochondrial substrates such as succinate. Furthermore, we found that these metabolic pathways differentially regulate insulin secretion and proinsulin biosynthesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals
Diabetes-prone P. obesus, age 2.5–3.5 months (Hebrew University Colony) and Wistar rats (140–170 g body weight) were obtained from Harlan (Jerusalem, Israel). After weaning at 3 wk, P. obesus were maintained on low energy diet (2.38 kcal/g; Koffolk, Petach-Tikva, Israel), and rats on standard laboratory chow (3.2 kcal/g; Harlan-Teklad, Madison, WI), until studied. These are weight-maintaining diets for both species that keep the animal normoglycemic. The use of animals was approved by the Institutional Animal Care and Use Committee of the Hebrew University and the Hadassah Medical Organization, and the principles of laboratory animal care (National Institutes of Health publication no. 85-23, revised 1985) were followed.

Islet isolation and culture
Islets were isolated by collagenase digestion (Collagenase P; Roche Diagnostics GmbH, Mannheim, Germany), as described (19). When large quantities were required, islets were hand-picked once under the stereomicroscope, followed by purification on Histopaque 1083 density gradient (Sigma, St. Louis, MO). The islets were used after repeated washes with Hanks’ balanced salt solution, unless otherwise specified. Batches of 200–300 islets of similar size were collected and maintained at 37 C in 5% CO2 atmosphere in suspension in 5 ml RPMI 1640 medium (Biological Industries, Beit-Hemeek, Israel), 10% fetal bovine serum (Biological Industries) and different glucose concentrations and various agents according to the experimental protocols.

Insulin secretion studies
Insulin response to secretagogues was evaluated by static incubation of islets in four-chamber culture plates (Nunclon {delta} Multidishes; Nunc A/S, Roskilde, Denmark) with 10 islets/chamber in triplicate. Batches of islets were preincubated for 150 min in RPMI 1640 containing 3.3 mmol/liter glucose and then incubated in the individual chambers for 1 h at 37 C in 1 ml of modified Krebs-Ringer bicarbonate buffer containing 20 mmol/liter HEPES and 0.25% BSA (KRBH-BSA), supplemented with glucose and test compounds according to the experimental protocols. At the end of the incubation the medium was collected, centrifuged, and frozen at –20 C pending insulin assay. Islets were collected and counted for reference. Islet insulin content was determined by RIA in extracts of batches of islets subjected to repeated freeze-thaw cycles in 1.5-ml microfuge tubes containing 450 µl 0.1% BSA in 0.1 N HCl, followed by centrifugation.

Insulin assay
P. obesus insulin immunoreactivity was determined using anti-insulin-coated tubes (ICN Pharmaceuticals, Costa Mesa, CA) and 125I-insulin from Linco Research Inc. (St. Charles, MO) with human insulin standard from Novo-Nordisk (Bagsvaerd, Denmark) or Linco Research Inc. Rat insulin was determined using a commercial rat RIA kit from Linco Research Inc. The antiserum used in the P. obesus assay cross-reacts with proinsulin and proinsulin conversion intermediates; hence, insulin secretion refers to the summed quantification of all insulin-related immunoreactive peptides secreted during the study. The routine intraassay coefficient of variation was 4–6% and interassay coefficient of variation was 6–10%.

Proinsulin biosynthesis
Batches of isolated islets were preincubated in RPMI 1640 as described in the insulin secretion studies. Groups of 25 islets were collected after culture and incubated for 1 h at 37 C in KRBH-BSA, supplemented with glucose and test compounds (20). After incubation, the islets were centrifuged and labeled in 50 µl fresh KRBH-BSA buffer containing glucose and test compounds, as above, and 25 µCi L-[4,5-3H]leucine (150 Ci/mmol/liter; Amersham, Aylesbury, UK). Leucine incorporation was terminated after 15 min of labeling at 37 C by the addition of 1 ml ice-cold glucose-free KRBH-BSA buffer and rapid centrifugation. The islet pellet was suspended in 450 µl of 0.2 mol/liter glycine buffer containing 0.1% RIA-grade BSA and 0.5% NP-40, pH 8.8 (GB/NP40 buffer), and subjected to four freeze-thaw cycles in liquid nitrogen. Each sample (50 µl) was pretreated with protein A-Sepharose (Sigma) before immunoprecipitation with anti-insulin serum (Sigma), to correct for nonspecific binding (16). Aliquots were used for determination of total insulin content by RIA and for measurement of total protein biosynthesis by trichloroacetic acid (TCA) precipitation (21).

Malic enzyme expression and activity in P. obesus and rat islets
Malic enzyme expression in P. obesus and rat islets was analyzed by RT-PCR. Total islet RNA was extracted using TRI-Reagent (Sigma, Rehovot, Israel) and then reverse-transcribed. Samples of 1 µg total RNA were reverse transcribed using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI). The resulting cDNA was subjected to PCR in 25 µl reaction volume containing 2.5 µl Taq polymerase buffer, 1.5 mM MgCl2, 0.4 mM of each dNTP, 50 pmol of each of the specific primers, and 2.5 U of Taq Polymerase (Promega). The PCR amplification conditions were as follows: 2 min at 94 C followed by 30 cycles of 30 sec at 94 C, 45 sec at 54 C, and 45 sec at 72 C. PCR products were analyzed on a 1% agarose gel. The specific primers for malic enzyme used: sense–TCCGACCAGCAAAGCTGAGT; antisense–CAAGGAAACATCTCGGATGG. ß-Actin was used as an internal control.

Malic enzyme activity was measured in cytosolic extracts of P. obesus and rat islets as described by Sener et al. (22) with slight modifications. Briefly, 250–500 islets were sonicated in 100 ml Tris-HCl buffer, pH 7.8, and 0.02% BSA. Extracts (100 µg) were added to 1 ml prewarmed reaction buffer (4 mM MnCl2, 0.5 mM NADP, 0.1 mM dithiothreitol, and 1 mM L-malate in Tris-HCl buffer, pH 7.8). Fluorescence was measured for 30 min at 37 C at excitation 340 nM and emission at 420 nM. Activity is expressed as nanomoles of NADPH per minute per milligram of protein.

Experimental protocols
Isolated P. obesus and rat islets were incubated in the presence of 0–22.2 mmol/liter glucose with and without different concentrations of succinic acid monomethyl ester (SAM). Pyruvic acid monomethyl ester (PE), {alpha}-ketoisocaproic acid (KIC), tolbutamide, and 3-isobutyl-1-methlxanthine (IBMX) were used to test the islet response to different insulin secretagogues. To study the amplifying effects of succinate, the islets were treated with 250 µmol/liter diazoxide and 40 mmol/liter KCl. The role of the pyruvate/malate shuttle in the regulation of insulin secretion and of proinsulin biosynthesis was evaluated by disrupting the shuttle with different concentrations of the pyruvate carboxylase inhibitor, phenylacetic acid (PAA). To study the effects of nNOS on succinate-stimulated insulin secretion and proinsulin biosynthesis, we inhibited the enzyme with 10 mmol/liter of L-NG-nitro-L-arginine methyl ester (L-NAME) or of NG-monomethyl-L-arginine (L-NMMA). All reagents were purchased from Sigma.

Data presentation and statistical analysis
Data shown are means ± SE. Statistical significance of differences between groups was determined by one-way ANOVA followed by Tukey test using the InStat statistical program from GraphPad Software, Inc. (San Diego, CA). A paired-sample t test was used when the difference between a reference (taken as 100%) and test was analyzed. A P value of less than 0.05 was considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of pyruvate/malate shuttle in the regulation of insulin secretion and proinsulin biosynthesis in rat islets
The pyruvate/malate shuttle is an important anaplerotic pathway in ß-cells (10), shown to be activated by glucose and succinate (6, 23). We used the pyruvate carboxylase inhibitor PAA to disrupt the shuttle to study its role in glucose- and succinate-stimulated insulin secretion and proinsulin biosynthesis. PAA dose-dependently inhibited insulin secretion and proinsulin biosynthesis in response to both glucose and succinate (Fig. 1Go). A similar inhibition was observed for insulin secretion and proinsulin biosynthesis. This suggests that signals derived from the pyruvate/malate shuttle are required for the succinate action on insulin release and biosynthesis.


Figure 1
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 1. Effect of pyruvate carboxylase inhibition in rat islets on glucose- and succinate-stimulated insulin secretion (A), proinsulin biosynthesis (B), and specific proinsulin biosynthesis (corrected for total protein biosynthesis) (C). Islets were incubated for 1 h in 3.3 mmol/liter glucose, 16.7 mmol/liter glucose, or in 3.3 mmol/liter glucose with 10 mmol/liter SAM with increasing concentrations of PAA. Data are normalized to the maximal stimulation in 16.7 mmol/liter glucose or 3.3 mmol/liter glucose plus SAM. The maximal stimulated secretion calculated as percent of content was 9.6 ± 1.5 and 5.1 ± 0.7 at 16.7 mmol/liter glucose and 3.3 mmol/liter glucose plus SAM, respectively. Results are mean ± SE of five individual experiments, each performed on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 compared with the maximal stimulation at G16.7 or G3.3 plus 10 mmol/liter SAM.

 
Effects of nNOS inhibition on insulin secretion and proinsulin biosynthesis in rat islets
The pyruvate/malate shuttle can support insulin secretion and proinsulin biosynthesis by recycling of carbons exported from the TCA cycle and/or by producing NADPH equivalents. To study the potential role of NADPH in the regulation of insulin secretion and proinsulin biosynthesis by succinate, we treated rat islets with SAM and the nNOS inhibitors L-NAME and L-NMMA. nNOS uses NADPH as a cofactor, depleting NADPH levels by its conversion to NADP; therefore, inhibition of this enzyme is expected to increase islet NADPH concentration (24). SAM, L-NAME, and L-NMMA induced 2.5-, 4-, and 1.3-fold increase of insulin secretion, respectively (Fig. 2Go). Treatment with SAM in presence of L-NAME or L-NMMA stimulated insulin secretion by 10- and 4.5-fold, respectively. Thus, inhibition of nitric oxide signaling markedly amplifies succinate-stimulated insulin secretion. The effect of SAM on proinsulin biosynthesis was approximately 2-fold higher compared with its effect on insulin secretion. However, whereas L-NAME increased insulin secretion, it failed to amplify succinate-stimulated proinsulin biosynthesis (Fig. 2Go).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Effect of nNOS inhibition on succinate-stimulated insulin secretion (A) and total (B) or specific (corrected for total protein synthesis) proinsulin biosynthesis (C) in rat islets. Islets were treated for 1 h in the absence of glucose (G0), with 10 mmol/liter SAM, 10 mmol/liter L-NAME, 10 mM L-NMMA or with SAM and the indicated nNOS inhibitors together. Incubation was performed in the absence of glucose in the medium. Insulin secretion results are mean ± SE of three to four individual experiments, each performed in triplicates on islets pooled from three animals. Proinsulin biosynthesis results are mean ± SE of eight individual experiments, each performed on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 compared with control at G0.

 
Succinate does not trigger insulin secretion without the permissive effect of glucose in P. obesus islets
To characterize the responsiveness of P. obesus islets, we analyzed succinate stimulation of insulin secretion at different glucose concentrations (Fig. 3Go). In line with our previous reports (17, 25), the glucose-insulin concentration-response curve revealed a leftward shift in P. obesus compared with rat islets (Fig. 3Go). In rat islets, SAM doubled insulin secretion at substimulatory glucose concentrations (0 and 3.3 mmol/liter; Fig. 3BGo). In contrast, SAM did not stimulate insulin secretion in P. obesus islets in the absence of glucose or at the substimulatory glucose concentration of 1.7 mmol/liter glucose (Fig. 3AGo). However, SAM doubled insulin secretion from P. obesus islets incubated at 3.3 and 5.5 mmol/liter glucose, both stimulatory concentrations in this species (Fig. 3AGo). These data indicate that succinate responsiveness in P. obesus islets is glucose-dependent and occurs only at stimulating glucose concentrations. The difference between the two species regarding this aspect is more clearly illustrated in the inserts in Fig. 3Go. There was no additional stimulation of insulin secretion by succinate at the maximal stimulatory glucose concentrations in P. obesus (8.3–16.7 mmol/liter) or rat islets (16.7–22.2 mmol/liter).


Figure 3
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 3. Concentration-response curve for the stimulation of insulin secretion by SAM in P. obesus (A) and rat (B) islets. P. obesus and rat islets were incubated for 1 h with increasing glucose concentrations alone or supplemented with 10 mmol/liter SAM. The insets in A and B show the effect of SAM on insulin secretion in the absence of glucose in P. obesus and rat islets, respectively. Results are mean ± SE of seven individual experiments for P. obesus and three individual experiments for rat islets, each performed in triplicate on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 for the differences between SAM and control at similar glucose concentrations.

 
Succinate lacks amplifying effect in the absence of glucose in P. obesus islets
Membrane depolarization with K+ in presence of diazoxide and the absence of glucose induced a 3.5-fold increase of insulin secretion (Fig. 4AGo). However, there was no additional stimulation of insulin secretion by succinate after membrane depolarization with K+ plus diazoxide (Fig. 4AGo). In contrast, succinate induced 1.5- to 2-fold increase of insulin secretion in depolarized P. obesus islets at 3.3 mmol/liter glucose (Fig. 4BGo).


Figure 4
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Amplifying effect of succinate on insulin secretion from P. obesus islets in the absence of glucose in the medium (G0, A) or at 3.3 mmol/liter glucose (G3.3, B). P. obesus islets were incubated for 1 h with 10 mmol/liter SAM, 250 µmol/liter diazoxide (Diaz), 40 mmol/liter KCl or SAM plus Diaz/KCl, and with 16.7 mmol/liter glucose (G-16.7). Results are mean ± SE of three to four individual experiments, each performed in triplicates on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 compared with control incubations at G0 or G3.3, as appropriate.

 
Taken together, our data show that succinate can neither trigger nor amplify insulin secretion in P. obesus islets without the permissive effect of glucose.

Malic enzyme is expressed in P. obesus islets
Lack of insulin secretory response to succinate is not unique to P. obesus, but was described also in mouse islets (23). It was suggested that mouse islets do not respond to succinate because they lack malic enzyme, which is part of the anaplerotic pyruvate/malate shuttle (23). Therefore, we studied the expression and function of malic enzyme in cytosolic extracts of P. obesus islets. RT-PCR showed that malic enzyme mRNA is present in P. obesus islets (Fig. 5AGo). Moreover, the activity of the enzyme was 3-fold higher than that in rat islets (Fig. 5Go, B and C). Thus, lack of malic enzyme does not explain the failure of P. obesus islets to respond to succcinate.


Figure 5
View larger version (26K):
[in this window]
[in a new window]
 
FIG. 5. Malic enzyme expression and function in P. obesus and rat islets. A, RT-PCR analysis for malic enzyme (ME) expression in extracts of P. obesus (Ps) and rat islets. ß-Actin was used as an internal control. B and C, Malic enzyme activity in cytosolic extracts of P. obesus and rat islets. Islet extracts (100 µg) were added to 1 ml prewarmed reaction buffer (4 mM MnCl2, 0.5 mM NADP, 0.1 mM dithiothreitol, and 1 mM L-malate in Tris-HCl buffer, pH 7.8) at 30 min (arrow). Fluorescence was measured for 30 min at 37 C (excitation at 340 nM, emission at 420 nM). B, Representative absorbance curves reflecting NAD(P)H accumulation after addition of P. obesus ({blacksquare}) and rat (bullet) islet extracts. C, Quantification of malic enzyme activity expressed as nanomoles of NADPH per minute per milligram of protein in P. obesus and rat islets. Results are the means ± SE of three islet preparations, each pooled from three animals. *, P < 0.05 for the difference between P. obesus and rat islets.

 
cAMP does not substitute for glucose in succinate-stimulated insulin secretion in P. obesus islets
Several studies indicated that glucose increases cAMP levels in pancreatic ß-cells, which has an important role in amplifying insulin secretion (26, 27, 28). We questioned whether raising islet cAMP would mimic the permissive effect of glucose on succinate-stimulated insulin secretion in P. obesus. Islets incubated in the absence of glucose were treated with different secretagogues and 0.1 mmol/liter of the phosphodiesterase inhibitor IBMX. IBMX induced 2- and 3-fold increase of KIC and tolbutamide-stimulated insulin secretion, respectively (Fig. 6AGo). In marked contrast, there was no stimulation of insulin secretion when IBMX was added to succinate in the absence of glucose (Fig. 6AGo). The insulin response to tolbutamide plus IBMX was similar to that of high glucose (Fig. 6AGo) and there was no additional effect of SAM under these conditions (data not shown). Contrasting with the absence of SAM/IBMX interaction at 0 mmol/liter glucose, in the presence of 3.3 mmol/liter glucose IBMX markedly amplified succinate-induced insulin secretion in P. obesus islets (Fig. 6BGo). Taken together, our data show that cAMP is an efficient amplifier of insulin secretion in P. obesus islets; however, it does not substitute for glucose as a permissive agent for the succinate response.


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. cAMP amplification of insulin secretion from P. obesus islets in response to succinate and different secretagogues in the absence of glucose in the medium (G0, A) or at 3.3 mmol/liter glucose (B). Islets were incubated for 1 h with 10 mmol/liter SAM, 10 mmol/liter KIC, and 250 µmol/liter tolbutamide with and without 0.5 mmol/liter IBMX, and at 16.7 mmol/liter glucose (G16.7). Results are mean ± SE of three individual experiments, each performed in triplicate on islets pooled from three animals. **, P < 0.01; ^, P < 0.001 compared with control incubations at G0 or G3.3, as appropriate.

 
Pyruvate replaces glucose for succinate-stimulated insulin secretion in P. obesus islets
Glucose may render islets responsive to succinate by signals derived either from glycolysis or from mitochondrial metabolism of pyruvate. To distinguish between the two possibilities, islets were treated in glucose-free medium with SAM with and without 5 mmol/liter PE. Insulin secretion in response to SAM plus PE was approximately 2-fold higher compared with that of SAM or PE alone (Fig. 7Go), indicating that pyruvate metabolism is sufficient to enable stimulation of insulin secretion by succinate.


Figure 7
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 7. Effect of pyruvate on succinate-stimulated insulin secretion in P. obesus. Islets were incubated for 1 h with 10 mmol/liter SAM, 5 mmol/liter PE, or both in the absence of glucose (G0) in the medium and at 16.7 mmol/liter glucose (G16.7). Results are mean ± SE of three individual experiments, each performed in triplicate on islets pooled from three animals. **, P < 0.01; ^, P < 0.001 compared with G0 control.

 
The role of pyruvate/malate shuttle in the regulation of insulin secretion and proinsulin biosynthesis in P. obesus islets
PAA inhibited dose-dependently glucose- and succinate (at 3.3 mmol/liter glucose)-stimulated insulin secretion in P. obesus islets (Fig. 8AGo). However, whereas succinate-stimulated proinsulin biosynthesis was inhibited as in rat islets, PAA did not inhibit glucose-stimulated proinsulin biosynthesis in P. obesus islets even at the high concentration of 20 mmol/liter (Fig. 8Go, B and C), indicating that in P. obesus the pyruvate/malate shuttle is required for insulin secretion and succinate-stimulated proinsulin biosynthesis, but not for glucose-induced proinsulin biosynthesis.


Figure 8
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 8. Effect of pyruvate carboxylase inhibition in P. obesus islets on glucose- and succinate-stimulated insulin secretion (A), proinsulin biosynthesis (B), and specific proinsulin biosynthesis (corrected for total protein biosynthesis) (C), and on potassium-induced insulin secretion (D). A–C, Islets were incubated for 1 h in 3.3 mmol/liter glucose, 16.7 mmol/liter glucose, or in 3.3 mmol/liter glucose with 10 mmol/liter SAM with increasing concentrations of PAA. Data are normalized to the maximal stimulation in 16.7 mmol/liter glucose or 3.3 mmol/liter glucose plus SAM. The maximal stimulated secretion calculated as percent of content was 12.1 ± 0.3 and 8.2 ± 1.4 at 16.7 mmol/liter glucose and 3.3 mmol/liter glucose plus SAM, respectively. D, Islets were stimulated with 40 mmol/liter KCl in the absence of glucose without and with 10 and 20 mmol/liter PAA. Results are mean ± SE of eight individual experiments (A–C) and three individual experiments (D), each performed on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 compared with the maximal stimulation at G16.7 or G3.3 + 10 mmol/liter SAM, as appropriate.

 
PAA had no effect on potassium-induced insulin secretion (Fig. 8DGo), indicating that the effect of the inhibitor is specific for fuel-stimulated secretion.

Inhibition of nNOS renders insulin secretion in P. obesus islets responsive to succinate in the absence of glucose
Treatment of P. obesus islets with L-NAME or L-NMMA in the absence of glucose did not affect insulin secretion. However, combined treatment with SAM and L-NAME or LNMMA induced a 1.25- and 2.1-fold increase of insulin secretion, respectively, compared with islets treated with SAM alone (Fig. 9AGo).


Figure 9
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 9. Effect of nNOS inhibition on succinate-stimulated insulin secretion (A) and total (B) or specific (corrected for total proteing synthesis) proinsulin biosynthesis (C) in P. obesus islets. Islets were incubated for 1 h with 10 mmol/liter SAM), 10 mmol/liter L-NAME, 10 mmol/liter L-NMMA, and with SAM and the indicated nNOS inhibitors together. Incubation was performed in the absence of glucose in the medium (G0). Insulin secretion results are mean ± SE of three to four individual experiments, each performed in triplicate on islets pooled from three animals. Proinsulin biosynthesis results are mean ± SE of five to six individual experiments, each performed on islets pooled from three animals. *, P < 0.05; **, P < 0.01; ^, P < 0.001 compared with control at G0.

 
Glucose or inhibition of nNOS is not required for succinate stimulation of proinsulin biosynthesis
In light of the peculiar insulin secretory response to succinate in P. obesus islets, we studied its effects on proinsulin biosynthesis. In marked contrast to the lack of succinate effect on insulin secretion at nonstimulating glucose concentrations, SAM markedly stimulated total and specific (corrected for total protein synthesis) proinsulin biosynthesis in P. obesus islets in the absence of glucose (Fig. 9Go, B and C). Thus, the permissive effect of glucose is not required for succinate-stimulated proinsulin biosynthesis in the P. obesus. L-NAME did not amplify succinate stimulation of proinsulin biosynthesis in these islets (Fig. 9Go, B and C).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The aim of this study was to identify the metabolic pathways, which regulate succinate stimulation of insulin secretion and proinsulin biosynthesis in normal physiology and in islets adapted to insulin resistance. We have shown previously that succinate metabolism via succinate dehydrogenase is required for glucose-induced proinsulin biosynthesis and insulin secretion (16). However, the messengers mediating the succinate effect are still elusive.

In this study, we show that anaplerosis via pyruvate carboxylase plays an important role in the regulation of insulin secretion and proinsulin biosynthesis by both succinate and glucose. Succinate metabolism in the TCA cycle leads to massive efflux of malate from the mitochondria to the cytosol (6). Malate is converted to pyruvate that reenters the mitochondria via pyruvate carboxylase, thus completing the anaplerotic pyruvate/malate shuttle (8). In the ß-cells, TCA cycle intermediates are exported from the mitochondria (cataplerosis) and serve as signals for insulin secretion (29, 30, 31). This should be accompanied by efficient anaplerotic pathways that maintain the mitochondrial level of TCA cycle intermediates and thus regulate TCA cycle flux (9). Therefore, disruption of the pyruvate/malate shuttle, e.g. by PAA, can lead to dysregulation of the TCA cycle flux, resulting in decreased ATP production (32), insulin secretion, and proinsulin biosynthesis. Our observation that PAA did not inhibit potassium-induced insulin secretion and data showing no effect of PAA on calcium-induced exocytosis, K-ATP channel conductance or ß-cell viability (32), indicate that the inhibitory effect of PAA is specific to fuel stimulated insulin secretion. Succinate-stimulated proinsulin biosynthesis is highly dependent on the cycling of carbons via the pyruvate/malate shuttle in both P. obesus and rat islets. However, glucose-stimulated proinsulin biosynthesis was differentially affected by disruption of the shuttle with PAA in these species. Whereas PAA inhibited the glucose stimulation of proinsulin biosynthesis in the rat, it had no effect in P. obesus. This may be related to the fact that P. obesus shows increased sensitivity of the biosynthetic machinery to glucose (17). It is likely that, in a state of insulin-resistance, as is the case in P. obesus, additional glucose-activated pathways provide signals for proinsulin biosynthesis, driving the biosynthetic activity when the pyruvate/malate shuttle is inoperative.

In addition to recycling of carbons exported from the TCA cycle, each cycling of carbons through the pyruvate/malate shuttle leads to generation of one molecule of NADPH in the cytoplasm. Thus, the pyruvate/malate shuttle can support insulin secretion and proinsulin biosynthesis also by producing NADPH equivalents.

The potential role of NADPH in the regulation of insulin secretion and proinsulin biosynthesis by succinate was studied using nNOS inhibitors that increase ß-cell NADPH (24). In rat islets, L-NAME and L-NMMA synergistically interacted with succinate, resulting in robust stimulation of insulin secretion. Thus, in line with previous studies (12, 13), we also found that nNOS negatively regulates insulin secretion. It is likely that nNOS inhibitors mediate the stimulation of insulin secretion by increasing cellular NADPH, although the possible involvement of other downstream targets of nNOS cannot be excluded. Theoretically, augmentation of insulin secretion could also result from decreased NO production and increased nNOS-related cytochrome c reductase activity (12). Regardless of the mechanism involved, it is clear that nNOS activity plays an important role in maintaining the islet secretory response to succinate.

The observation that inhibition of nNOS augmented insulin secretion but not proinsulin biosynthesis may suggest a specific role for NADPH in insulin secretion, but not in proinsulin biosynthesis. This is in agreement with previous studies (33), suggesting that the cytosolic redox state has minor impact on proinsulin biosynthesis.

An interesting observation was that succinate ester (SAM), a potent stimulus for insulin release in the rat, failed to stimulate insulin secretion in P. obesus islets at a substimulatory glucose concentration (18). This failure comprised both the triggering and the amplifying pathways as demonstrated by the inability of succinate to stimulate insulin secretion in depolarized P. obesus islets. A small increase in glucose concentration was sufficient to render the insulin secretion of P. obesus responsive to succinate. Moreover, with the permissive effect of glucose, succinate became an efficient amplifier of insulin secretion in depolarized P. obesus islets. In marked contrast, succinate efficiently stimulated proinsulin biosynthesis in the absence of glucose. This indicates differential dependency of the secretory and biosynthetic machineries on glucose-derived signals.

cAMP is a potent amplifier of insulin secretion in rat (26, 27, 28) and P. obesus islets incubated with stimulatory glucose concentrations (Fig. 6BGo). However, in the absence of glucose, it failed to augment insulin secretion in response to succinate in P. obesus. Similar to succinate, KIC is also a poor secretagogue in P. obesus islets in the absence of glucose (18). Yet, in presence of IBMX, it markedly stimulated insulin secretion. The difference in the SAM and KIC responses to cAMP may be related to their differential metabolism. KIC undergoes transamination with endogenous glutamate to form leucine and {alpha}-ketoglutarate, both involved in insulin secretion. The leucine derived from transamination can enhance glutamate metabolism by activating glutamate dehydrogenase. In addition, KIC is converted to acetyl-CoA, a substrate for the TCA cycle. Thus, KIC can stimulate insulin secretion by multiple mechanisms (9), which may account for its higher sensitivity to the amplifying effect of cAMP.

Pyruvate ester, a powerful stimulator of insulin secretion in rat (34) as well as in P. obesus islets (Fig. 6Go), mimicked the permissive effect of glucose on succinate-stimulated insulin secretion, suggesting that signals derived from the mitochondrial metabolism of pyruvate are sufficient to render P. obesus islets responsive to succinate. Glucose and pyruvate may enhance succinate metabolism in the TCA cycle by providing acetyl CoA for condensation with oxaloacetate with subsequent increase in TCA cycle flux. However, it is unlikely that the pyruvate effect is explained by increasing mitochondrial succinate levels because treating P. obesus islets with higher concentrations of SAM had no additional effect on insulin secretion at basal or stimulating glucose concentrations (data not shown). Pyruvate ester was shown to have a direct inhibitory effect on the K-ATP channel activity (35). Therefore, additional mechanisms could be involved in the stimulation of insulin secretion by methyl pyruvate.

Lack of malic enzyme in mouse islets is suggested to account for the inability to secrete insulin in response to succinate (23). This is not the case in P. obesus islets, because expression of the enzyme was detected at the mRNA level. Moreover, malic enzyme activity in P. obesus islets was higher than that of rat islets. This may reflect the adaptive response of the islets to insulin resistance as shown in the Zucker fatty rat (11). Interestingly, the increase of malic enzyme activity was not sufficient to provoke insulin secretion in response to succinate in P. obesus islets; thus, additional signals are required to render the islets responsive to succinate.

Based on the observation that nNOS inhibition markedly amplified succinate-stimulated insulin secretion in rat islets, we hypothesized that an increase in islet NADPH via inhibition of nNOS could enable the stimulation of insulin secretion by succinate (and possibly other mitochondrial substrates) in P. obesus. Indeed, inhibition of nNOS rendered the islets responsive to succinate; however, the magnitude of the insulin response was much lower compared with that induced by glucose. Thus, additional, yet unidentified, glucose-derived signals are required for the stimulation of insulin secretion by succinate in P. obesus.

In marked contrast to the glucose requirement for succinate stimulation of insulin secretion, succinate efficiently stimulated proinsulin biosynthesis in the absence of glucose in P. obesus islets. We and others have previously shown that succinate is an important signal for proinsulin biosynthesis in rat islets (15, 16). The marked stimulation of proinsulin biosynthesis by succinate in P. obesus islets in the absence of glucose, with no increase in insulin secretion, further emphasizes its prime role as a regulator of the biosynthetic process. Moreover, it supports our previous contention that the stimulation of proinsulin biosynthesis is not mediated via the secreted insulin (36).

In summary, anaplerosis via pyruvate carboxylase is important for glucose- and succinate-stimulated insulin secretion and proinsulin biosynthesis. nNOS signaling is a negative regulator of insulin secretion, but not of proinsulin biosynthesis. In the insulin-resistant P. obesus, succinate-dependent and -independent pathways regulating proinsulin biosynthesis coexist. The latter can maintain fuel stimulated biosynthetic activity when the succinate-dependent pathway is inhibited. Further studies are required to identify the succinate-independent signals that regulate insulin secretion and proinsulin biosynthesis.


    Acknowledgments
 
This work was supported by the Israel Science Foundation, The Israel Ministry of Health, The Russell Berrie Foundation and D-Cure, Diabetes Care in Israel.


    Footnotes
 
First Published Online August 17, 2006

1 V.A. and M.P. contributed equally to this work. Back

Abbreviations: IBMX, Isobutylmethylxanthine; KIC, {alpha}-ketoisocaproic acid; L-NAME, L-NG-nitro-L-arginine methyl ester; L-NMMA, NG-monomethyl-L-arginine; NADPH, reduced nicotinamide adenine dinucleotide phosphate; nNOS, neuronal nitric oxide synthase; PAA, phenylacetic acid; PE, pyruvic acid monomethyl ester; SAM, succinic acid monomethyl ester; TCA, trichloroacetic acid.

Received April 17, 2006.

Accepted for publication August 4, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Henquin JC 2004 Pathways in ß-cell stimulus-secretion coupling as targets for therapeutic insulin secretagogues. Diabetes 53(Suppl 3):S48–S58
  2. Ashcroft FM, Harrison DE, Ashcroft SJ 1984 Glucose induces closure of single potassium channels in isolated rat pancreatic ß-cells. Nature 312:446–448[CrossRef][Medline]
  3. Cook DL, Hales CN 1984 Intracellular ATP directly blocks K+ channels in pancreatic B-cells. Nature 311:271–273[CrossRef][Medline]
  4. Van De Winkel M, Pipeleers D 1983 Autofluorescence-activated cell sorting of pancreatic islet cells: purification of insulin-containing B-cells according to glucose-induced changes in cellular redox state. Biochem Biophys Res Commun 114:835–842[CrossRef][Medline]
  5. Ivarsson R, Quintens R, Dejonghe S, Tsukamoto K, in ’t Veld P, Renstrom E, Schuit FC 2005 Redox control of exocytosis: regulatory role of NADPH, thioredoxin, and glutaredoxin. Diabetes 54:2132–2142[Abstract/Free Full Text]
  6. MacDonald MJ 2003 The export of metabolites from mitochondria and anaplerosis in insulin secretion. Biochim Biophys Acta 1619:77–88[Medline]
  7. Farfari S, Schulz V, Corkey B, Prentki M 2000 Glucose-regulated anaplerosis and cataplerosis in pancreatic ß-cells: possible implication of a pyruvate/citrate shuttle in insulin secretion. Diabetes 49:718–726[Abstract]
  8. Lu D, Mulder H, Zhao P, Burgess SC, Jensen MV, Kamzolova S, Newgard CB, Sherry AD 2002 13C NMR isotopomer analysis reveals a connection between pyruvate cycling and glucose-stimulated insulin secretion (GSIS). Proc Natl Acad Sci USA 99:2708–2713[Abstract/Free Full Text]
  9. MacDonald MJ, Fahienm LA, Brown LJ, Hasan NM, Buss JD, Kendrick MA 2005 Perspective: emerging evidence for signaling roles of mitochondrial anaplerotic products in insulin secretion. Am J Physiol Endocrinol Metab 288:E1–E15
  10. Cline GW, Lepine RL, Papas KK, Kibbey RG, Shulman GI 2004 13C NMR isotopomer analysis of anaplerotic pathways in INS-1 cells. J Biol Chem 279:44370–44375[Abstract/Free Full Text]
  11. Liu YQ, Jetton TL, Leahy JL 2002 ß-Cell adaptation to insulin resistance. Increased pyruvate carboxylase and malate-pyruvate shuttle activity in islets of nondiabetic Zucker fatty rats. J Biol Chem 277:39163–39168[Abstract/Free Full Text]
  12. Lajoix AD, Reggio H, Chardes T, Peraldi-Roux S, Tribillac F, Roye M, Dietz S, Broca C, Manteghetti M, Ribes G, Wollheim CB, Gross R 2001 A neuronal isoform of nitric oxide synthase expressed in pancreatic ß-cells controls insulin secretion. Diabetes 50:1311–1323[Abstract/Free Full Text]
  13. Beffy P, Lajoix AD, Masiello P, Dietz S, Peraldi-Roux S, Chardes T, Ribes G, Gross R 2001 A constitutive nitric oxide synthase modulates insulin secretion in the INS-1 cell line. Mol Cell Endocrinol 183:41–48[CrossRef][Medline]
  14. Henningsson R, Salehi A, Lundquist I 2002 Role of nitric oxide synthase isoforms in glucose-stimulated insulin release. Am J Physiol Cell Physiol 283:C296–C304
  15. Alarcon C, Wicksteed B, Prentki M, Corkey BE, Rhodes CJ 2002 Succinate is a preferential metabolic stimulus-coupling signal for glucose-induced proinsulin biosynthesis translation. Diabetes 51:2496–2504[Abstract/Free Full Text]
  16. Leibowitz G, Khaldi MZ, Shauer A, Parnes M, Oprescu AI, Cerasi E, Jonas JC, Kaiser N 2005 Mitochondrial regulation of insulin production in rat pancreatic islets. Diabetologia 48:1549–1559[CrossRef][Medline]
  17. Kaiser N, Nesher R, Donath MY, Fraenkel M, Behar V, Magnan C, Ktorza A, Cerasi E, Leibowitz G 2005 Psammomys obesus, a model for environment-gene interactions in type 2 diabetes. Diabetes 54(Suppl 2):S137–S144
  18. Nesher R, Warwar N, Kahn A, Efecndic S, Cerasi E, Kaiser N 2001 Defective stimulus-secretion coupling in islets of Psammomys obesus, an animal model for type 2 diabetes. Diabetes 50:308–314[Abstract/Free Full Text]
  19. Gadot M, Leibowitz G, Shafrir E, Cerasi E, Gross D, Kaiser N 1994 Hyperproinsulinemia and insulin deficiency in the diabetic Psammomys obesus. Endocrinology 135:610–616[Abstract]
  20. Leibowitz G, Uckaya G, Oprescu AI, Cerasi E, Gross DJ, Kaiser N 2002 Glucose-regulated proinsulin gene expression is required for adequate insulin production during chronic glucose exposure. Endocrinology 143:3214–3220[Abstract/Free Full Text]
  21. Alarcon C, Lincoln B, Rhodes CJ 1993 The biosynthesis of the subtilisin-related proprotein convertase PC3, but not that of the PC2 convertase, is regulated by glucose in parallel to proinsulin biosynthesis in rat pancreatic islets. J Biol Chem 268:4276–4280[Abstract/Free Full Text]
  22. Sener A, Mallaise-Lagae F, Dufrane SP, Malaisse W 1984 The coupling of metabolic to secretory events in pancreatic islets. Biochem J 220:433–440[Medline]
  23. MacDonald MJ 2002 Differences between mouse and rat pancreatic islets: succinate responsiveness, malic enzyme, and anaplerosis. Am J Physiol Endocrinol Metab 283:E302–E310
  24. Gunawardana SC, Rocheleau JV, Head WS, Piston DW 2006 Mechanisms of time-dependent potentiation of insulin release: involvement of nitric oxide synthase. Diabetes 55:1029–1033[Abstract/Free Full Text]
  25. Pertusa JA, Nesher R, Kaiser N, Cerasi E, Henquin JC, Jonas JC 2002 Increased glucose sensitivity of stimulus-secretion coupling in islets from Psammomys obesus after diet induction of diabetes. Diabetes 51:2552–2560[Abstract/Free Full Text]
  26. Grill V, Cerasi E 1974 Stimulation by D-glucose of cyclic adenosine 3':5'-monophosphate accumulation and insulin release in isolated pancreatic islets of the rat. J Biol Chem 249:4196–4201[Abstract/Free Full Text]
  27. Charles MA, Fanska R, Schmid FG, Forsham PH, Grodsky GM 1973 Adenosine 3',5'-monophosphate in pancreatic islets: glucose-induced insulin release. Science 179:569–571[Abstract/Free Full Text]
  28. Harndahl L, Jing XJ, Ivarsson R, Degerman E, Ahren B, Manganiello VC, Renstrom E, Holst LS 2002 Important role of phosphodiesterase 3B for the stimulatory action of cAMP on pancreatic ß-cell exocytosis and release of insulin. J Biol Chem 277:37446–37455[Abstract/Free Full Text]
  29. Maechler P, Wollheim CB 1999 Mitochondrial glutamate acts as a messenger in glucose-induced insulin exocytosis. Nature 402:685–689[CrossRef][Medline]
  30. MacDonald MJ, Fahien LA, Buss JD, Hasan NM, Fallon MJ, Kendrick MA 2003 Citrate oscillates in liver and pancreatic ß cell mitochondria and in INS-1 insulinoma cells. J Biol Chem 278:51894–51900[Abstract/Free Full Text]
  31. Flamez D, Berger V, Kruhoffer M, Orntoft T, Pipeleers D, Schuit FC 2002 Critical role for cataplerosis via citrate in glucose-regulated insulin release. Diabetes 51:2018–2024[Abstract/Free Full Text]
  32. Fransson U, Rosengren AH, Schuit FC, Renstrom E, Mulder H 2006 Anaplerosis via pyruvate carboxylase is required for the fuel-induced rise in the ATP:ADP ratio in rat pancreatic islets. Diabetologia 49:1578–1586[CrossRef][Medline]
  33. Skelly RH, Bollheimer LC, Wicksteed BL, Corkey BE, Rhodes CJ 1998 A distinct difference in the metabolic stimulus-response coupling pathways for regulating proinsulin biosynthesis and insulin secretion that lies at the level of a requirement for fatty acyl moieties. Biochem J 331:553–561
  34. Zawalich WS, Zawalich KC 1997 Influence of pyruvic acid methyl ester on rat pancreatic islets. Effects on insulin secretion, phosphoinositide hydrolysis, and sensitization of the ß cell. J Biol Chem 272:3527–3531[Abstract/Free Full Text]
  35. Dufer M, Krippeit-Drews P, Buntinas L, Siemen D, Drews G 2002 Methyl pyruvate stimulates pancreatic ß-cells by a direct effect on KATP channels, and not as a mitochondrial substrate. Biochem J 368:817–825[CrossRef][Medline]
  36. Leibowitz G, Oprescu AI, Uckaya G, Gross DJ, Cerasi E, Kaiser N 2003 Insulin does not mediate glucose stimulation of proinsulin biosynthesis. Diabetes 52:998–1003[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
DiabetesHome page
M. Fraenkel, M. Ketzinel-Gilad, Y. Ariav, O. Pappo, M. Karaca, J. Castel, M.-F. Berthault, C. Magnan, E. Cerasi, N. Kaiser, et al.
mTOR Inhibition by Rapamycin Prevents {beta}-Cell Adaptation to Hyperglycemia and Exacerbates the Metabolic State in Type 2 Diabetes
Diabetes, April 1, 2008; 57(4): 945 - 957.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
S. Weksler-Zangen, I. Raz, S. Lenzen, A. Jorns, S. Ehrenfeld, G. Amir, A. Oprescu, Y. Yagil, C. Yagil, D. H. Zangen, et al.
Impaired Glucose-Stimulated Insulin Secretion Is Coupled With Exocrine Pancreatic Lesions in the Cohen Diabetic Rat
Diabetes, February 1, 2008; 57(2): 279 - 287.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/11/5110    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Attali, V.
Right arrow Articles by Leibowitz, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Attali, V.
Right arrow Articles by Leibowitz, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals