Endocrinology, doi:10.1210/en.2006-0580
Endocrinology Vol. 147, No. 11 5196-5204
Copyright © 2006 by The Endocrine Society
Metabolic Activation of Glucose Low-Responsive ß-Cells by Glyceraldehyde Correlates with Their Biosynthetic Activation in Lower Glucose Concentration Range But Not at High Glucose
G. A. Martens,
Q. Wang,
K. Kerckhofs,
G. Stangé,
Z. Ling and
D. Pipeleers
Diabetes Research Center, Brussels Free University (VUB), B-1090 Brussels, Belgium
Address all correspondence and requests for reprints to: Daniël Pipeleers, Diabetes Research Center, Laarbeeklaan 103, B-1090 Brussels, Belgium. E-mail: daniel.pipeleers{at}vub.ac.be.
 |
Abstract
|
|---|
Insulin synthesis and release activities of ß-cells can be acutely regulated by glucose through its glycolytic and mitochondrial breakdown involving a glucokinase-dependent rate-limiting step. Isolated ß-cell populations are composed of cells with intercellular differences in acute glucose responsiveness that have been attributed to differences in glucokinase (GK) expression and activity. This study first shows that glyceraldehyde can be used as GK-bypassing oxidative substrate and then examines whether the triose can metabolically activate ß-cells with low glucose responsiveness. Glyceraldehyde 1 mM induced a similar cellular 14CO2 output and metabolic redox state as glucose 4 mM. Using flow cytometric analysis, glyceraldehyde (0.252 mM) was shown to concentration-dependently increase the percent metabolically activated cells at all tested glucose concentrations (2.520 mM). Its ability to activate ß-cells that are unresponsive to the prevailing glucose level was further illustrated in glucose low-responsive cells that were isolated by flow sorting. Metabolic activation by glyceraldehyde was associated with an activation of nutrient-driven translational control proteins and an increased protein synthetic response to glucose, however not beyond the maximal rates that are inducible by glucose alone. It is concluded that glucose low-responsive ß-cells can be metabolically activated by the GK-bypassing glyceraldehyde, increasing their acute biosynthetic response to glucose but not their maximal glucose-inducible biosynthetic capacity, which is considered subject to chronic regulation.
 |
Introduction
|
|---|
GLUCOSE-INDUCED STIMULATION OF ß-cell functions is mediated by signals generated by glucose catabolism involving (post)mitochondrial events (1, 2, 3, 4, 5). A rate-limiting step in this glucose-signaling process is the low-affinity glucose phosphorylation by glucokinase (GK) (6, 7). Mutations of this enzyme in man have been associated with reduced insulin-releasing capacity and diabetes (8, 9, 10, 11). In the normal rat ß-cell population, intercellular differences in glucose sensitivity have also been attributed to differences in GK expression (12). ß-Cell subpopulations with low glucose responsiveness can be isolated by fluorescence-activated cell sorting (FACS) (13, 14); their lower rates of glucose-induced insulin synthesis and release were not associated with lower rates of glucose uptake but with a lower GK activity and glucose oxidation (12, 13, 14). In the reasoning that a lower rate of glucose phosphorylation is responsible for the lower glucose-induced metabolic and functional activities in this ß-cell subpopulation, we examined whether circumvention of the GK-regulated segment in glucose signaling can overcome the differences between glucose-high-responsive and glucose-low-responsive ß-cells. To this end we investigated the effects of glyceraldehyde, which is thought to enter the glycolytic pathway after its phosphorylation by triokinase (15), thereby providing substrate for distal glycolysis and mitochondrial oxidation, thus explaining its stimulatory action on ß-cell functions (16, 17). This mechanism is not consistently supported by the experimental data, which led to alternative views in the past (18, 19, 20, 21). We therefore first investigated whether glyceraldehyde can substitute for glucose in terms of its effects on cellular metabolic redox state and CO2 production before assessing whether it can correct functions in ß-cells with low glucose responsiveness.
 |
Materials and Methods
|
|---|
Materials
Mannoheptulose (MH), iodoacetamide (IAM), propidium iodide (PI), and D-glyceraldehyde were purchased from Sigma-Aldrich (Schnelldorf, Germany); one batch of glyceraldehyde and MH came from Glycoteam Gmbh (Hamburg, Germany). Only D-enantiomers of glucose and glyceraldehyde were used. D-[U-14C]glucose (306311 mCi/mmol; 1 mCi per 5 ml) and L-(3,5-3H)-tyrosine (specific activity 50 Ci/mmol; 1 mCi/ml) were obtained from Amersham Biosciences (Piscataway, NJ) and D-[U-14C]glyceraldehyde (150 mCi/mmol; 0.1 mCi/ml) from American Radiolabeled Chemicals (St. Louis, MO). Unless otherwise stated, ß-cells were studied in Hams F10 nutrient mixture (Life Technologies, Inc., Invitrogen Corp., Carlsbad, CA) supplemented with 0.5% BSA (Cohn analog; Sigma), 2 mM glutamine, penicillin (100 U/ml), and streptomycin (0.1 mg/ml), designated as basal medium at the indicated sugar concentrations.
FACS isolation and metabolic redox state analysis of ß-cells
Adult male Wistar rats (200300 g body weight, 10 wk old) were bred according to Belgian regulation on animal welfare. The local ethical committee approved the use of animals for this study. ß-Cells were purified as previously described (22) and studied on the day of isolation; experiments were also conducted on ß-cell subpopulations with, respectively, high and low glucose responsiveness. These subpopulations were flow sorted using glucose-induced increases in cellular level of nicotinamide adenine dinucleotide phosphate [NAD(P)H] autofluorescence as discriminator, exactly as described in our previous studies reporting on the identity and function of these cells (12, 13, 14). Briefly, ß-cells were first incubated (at 37 C in 95% O2-5% CO2) at 7.5 mM glucose, a glucose concentration around the Michaelis constant (Km) of GK (23) at which glucose catabolic flux in the whole ß-cell population can be expected to be half-maximally activated, and then sorted into two equally sized, nonoverlapping populations with high and low NAD(P)H autofluorescence. These high and low responder gates are set to contain each around 40% of the initial FACS-purified ß-cell population, discarding ± 10% of intact cells with intermediate glucose response and ± 10% cells that are either damaged (PI+ and lower forward scatter) or coupled to other ß-cells in small aggregates (high forward scatter).
The metabolic responsiveness of the cells was analyzed by measuring changes in their endogenous fluorescence of riboflavin [flavin adenine dinucleotide (FAD) and flavin mononucleotide (FMN), argon laser excitation 488 per emission 530 nm] and NAD(P)H (UV-argon laser excitation 351363 nm per emission 400470 nm) after 30 min incubation with glucose and/or glyceraldehyde (13). Changes in reduction state of electron carriers are normalized by measuring the percent of cells with NAD(P)H above or FAD/FMN below an operator-set threshold (percent metabolic recruitment). A ß-cell is considered metabolically activated/recruited when its NAD(P)H level exceeds, or FAD/FMN level drops below, this set threshold. The threshold for NAD(P)H and FAD/FMN is systematically set to include 10% metabolically activated cells after 30 min incubation in basal, glucose-free condition; this value was chosen because we previously observed that around 10% of all ß-cells showed protein biosynthetic activation under this condition (13).
Measurement of sugar oxidation and protein synthesis
CO2 formation from D-glucose and D-glyceraldehyde was measured in batches of 5 x 104 cells suspended in 100 µl HEPES-buffered basal medium at the indicated sugar concentration (12) (with either 50 µCi/ml D-[U-14C]glucose or 12.5 µCi/ml D-[U-14C]glyceraldehyde). After 2 h at 37 C, cellular metabolism was stopped by 20 µl HCl 1 N, and 14CO2 was captured by hydroxyhiamine during 1 h at 25 C. Molar oxidation rates are expressed as picomole substrate oxidized per 2 h x 103 ß-cells.
Total protein and (pro)insulin biosynthesis were assessed as described (13). Briefly, batches of 5 x 104 ß-cells were incubated for 2 h in 200 µl basal medium with 2 mM Ca2+ and the indicated sugar concentrations, in presence of 50 µCi L-(3,5-3H)-tyrosine (total tyrosine concentration 15 µM, of which 5 µM radiolabeled). The cells were then washed in Earles-HEPES buffer containing 1 mM unlabeled tyrosine and extracted in 2 M acetic acid with 0.25% (wt/vol) BSA. Total protein synthesis was measured after trichloroacetic acid precipitation. More than 80% of glucose- and glyceraldehyde-induced protein synthesis consisted of ß-cell-specific proinsulin biosynthesis (data not shown).
Real-time PCR of rat insulin 1 and 2 mRNA
Total cellular RNA was isolated using TRIzol reagent according to the manufacturers protocol (MP) (Life Technologies). RNA quality was checked in the 2100 Bioanalyzer (Agilent, Waldbronn, Germany), taking a minimal cutoff RIN of 8 or greater. Genomic DNA contamination was removed by DNase using TURBO DNA-free (Ambion, Austin, TX) and reverse transcribed using the high-capacity cDNA archive kit (Applied Biosystems, Foster City, CA) after MP. Targets were amplified from cDNA template on ABI Prism 7700 sequence detector using TaqMan universal PCR master Mix, sequence-specific primers and TaqMan MGB probe (Applied Biosystems) after MP. Insulin 2 mRNA was amplified using Assay on Demand Rn01774648_g1. Insulin 1 mRNA levels were detected using an Assay by Design (forward primer: GACCTTGGCACTGGAGGTT, reverse primer: TGGTAGAGGGAGCAGATGCT, Taqman probe FAM: CCACAATGCCACGCTTC). Cycle threshold (Ct) values were analyzed using SDS 1.9.1 software (Applied Biosystems), and
Ct values calculated with rat ß-actin (4352340E) as endogenous control. Because validation experiments showed no difference in amplification efficiency between insulin 1, insulin 2, and ß-actin mRNA, the comparative 
Ct-method was applied on the mean
Ct values from three independents triplicate measurements for quantification of mRNA levels, relative to a chosen calibrator.
Western blotting of translational control proteins
Samples of 2 to 3 x 104 ß-cells were lysed in 1020 µl radioimmunoprecipitation assay buffer, sonicated in sodium dodecyl sulfate-sample gel buffer, and then separated by 12% sodium dodecyl sulfate-polyacrylamide gel. After electrophoresis, protein was electronically transferred to a nitrocellulose membrane and incubated with one of the following antibodies: anti-4E-BP1 (Santa Cruz Biotechnology, Santa Cruz, CA) at 1:200 dilution; antiphospho-eIF2
(Cell Signaling Technology, Beverly, MA; phosphorylation site Ser 51), antiphospho-rS6 (Cell Signaling Technology; phosphorylation site Ser235/236) and antiphospho-eEF2 (Cell Signaling Technology; phosphorylation site Thr 56) all at 1:1000 dilution. After stripping of the nitrocellulose membranes, total protein levels were detected using anti-rS6 and anti-eEF2 (both from Cell Signaling Technology) both at 1:1000 dilution and anti-eIF2
(Santa Cruz) at 1:200 dilution. Horseradish peroxidase-linked antirabbit, antimouse, or antigoat Ig (1:1000; Amersham) was used as second antibody and peroxidase activity was detected by enhanced chemiluminescence (Amersham, Buckinghamshire, UK). The intensities of the bands of interest were quantified by Scion/NIH image 1.63 software, expressed in arbitrary units of OD and normalized by the intensity of actin from the same blot.
Statistical analysis
Data are presented as means ± SE of n independent experiments. Statistical analysis was performed using SPSS software (SPSS Inc., Chicago, IL) for regression analysis and comparison of means. Statistical analysis was performed using ANOVA or paired Students t testing where appropriate. Differences were considered significant when P < 0.05.
 |
Results
|
|---|
Metabolic activation of ß-cells by low glyceraldehyde concentrations
The metabolic redox state of the ß-cells is a sensitive parameter for their responsiveness to glucose. This nutrient concentration-dependently increases the percent ß-cells with elevated cellular NAD(P)H and reduced flavin (FADH2/FMNH2) fluorescence intensities (24) (Fig. 1
). In a normal ß-cell population, this glucose-induced metabolic activation reflects intercellular differences in sensitivity with the highest increase in NAD(P)H-responding cells between 5 and 10 mM glucose (Fig. 1A
). At 10 mM glucose, 58 ± 4% of the ß-cells were activated. Only 12% more ß-cells were recruited by further increasing glucose concentration from 10 to 20 mM (P < 0.01, n = 10), leaving 30% of the cells in a redox state that is characteristic for cells that are not metabolically activated (Fig. 1A
). Addition of low glyceraldehyde concentrations, 0.25 mM (P < 0.05, n = 5) and 1 mM (P < 0.001, n = 10), to the 10 mM glucose condition exerted a similar degree of recruitment as increasing glucose concentration from 10 to 20 mM. This additional glyceraldehyde effect was maintained at 20 mM glucose (P < 0.05, n = 510), which is indicative for glyceraldehydes potential to metabolically recruit ß-cells with low responsiveness to high glucose (10 and 20 mM). This glyceraldehyde-induced recruitment is also seen at lower glucose levels and in absence of glucose, albeit at higher triose concentrations (Fig. 1
, A and B). Glyceraldehyde concentration-dependently shifted the glucose concentration-response curves to the left. At 1 mM, it reduced the Km of the glucose effects on NAD(P)H and FADH2/FMNH2, respectively, from 8 to 4 mM glucose and from 9 to 5 mM glucose.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1. Glucose and glyceraldehyde effects on cellular NAD(P)H and mitochondrial FADH2/FMNH2 in rat ß-cells. ß-Cells were exposed for 30 min to the indicated sugar concentrations, followed by simultaneous measurement of reduced NAD(P)H-derived (A) and oxidized mitochondrial riboflavin (FAD and FMN) (B) fluorescence as specified in Materials and Methods. Incubations were conducted in absence (filled circles) or presence of 0.25 mM (diamonds), 1 mM (squares), 2 mM (triangles), and 10 mM (inverted triangles) glyceraldehyde. Data represent percent living (PI negative) ß-cells with NAD(P)H or FADH2/FMNH2 above an operator set threshold (mean percent ± SE, n = 510 independent experiments). Glucose-induced NAD(P)H was significantly (P < 0.05 or less) increased by 0.25 mM glyceraldehyde (n = 5) at 10 and 20 mM glucose (P < 0.05), 1 mM (n = 10) at 2.5 mM (P < 0.01) up to 20 mM glucose (P < 0.001), and 2 and 10 mM glyceraldehyde (n = 10) at 0 mM (P < 0.05) up to 20 mM glucose (P < 0.001). Glucose-induced FADH2/FMNH2 levels were significantly increased by 0.25 mM glyceraldehyde (n = 5) at 10 and 20 mM glucose (P < 0.05), 1 and 2 mM glyceraldehyde (n = 10) at 5 (P < 0.01) up to 20 mM glucose (P < 0.005), 10 mM glyceraldehyde (n = 10) at 0 (P < 0.01) up to 10 mM glucose (P < 0.01), but not at 20 mM glucose (P = 0.44).
|
|
The proportion of metabolically recruited ß-cells was markedly reduced when GK or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were inhibited by, respectively, MH (20 mM) or IAM (1 mM) (decrease by 39 ± 2 and 46 ± 5%, respectively, n = 5, P < 0.005, Table 1
). Glyceraldehyde, at 10 mM, increased cellular NAD(P)H to the same extent in ß-cells incubated in the absence of glucose (17 ± 5% up, P < 0.05) as in 10 mM glucose plus MH (16 ± 2% up, P < 0.001, n = 5, Table 1
); 10 mM glyceraldehyde, however, did not increase NAD(P)H formation in IAM-treated cells (Table 1
), indicating that glyceraldehyde-induced metabolic activation was suppressed by GAPDH inhibition but not by inhibition of GK.
View this table:
[in this window]
[in a new window]
|
TABLE 1. Effects of metabolic inhibitors on glucose and glyceraldehyde oxidation and recruitment of ß-cells with elevated NAD(P)H
|
|
When compared with other nutrient stimuli, such as leucine, arginine, glutamine, succinic acid methyl ester, and
-ketoisocaproate, glyceraldehyde was found to exhibit the strongest acute stimulation on NAD(P)H formation by FACS-purified rat ß-cells (data not shown).
Stoichiometric potency of glyceraldehyde oxidation by ß-cells
As reported previously (25), the rate of glucose oxidation by rat ß-cells increases markedly (12-fold) and linearly (r2 = 0.999) between 1 and 10 mM and to a lower extent between 10 and 20 mM glucose (Fig. 2A
). The rise in 14CO2 production from (U-14C)-D-glyceraldehyde also proceeds linearly between 0.5 and 5 mM and levels off between 5 and 10 mM (Fig. 2B
). We compared oxidation rates of both sugars by expressing molar oxidation values as the number of oxidized three-carbon groups. With one glucose hexose equaling two glyceraldehyde trioses, molar oxidation rates of glucose and medium glucose concentration were thus multiplied by 2 before plotting against molar oxidation rates of glyceraldehyde (Fig. 3
). Linear curve fits and r2 values indicate an overall 3.8-fold higher oxidation rate for glyceraldehyde than for glucose. The difference is higher in the lower concentration range of glyceraldehyde (up to 5 mM); at 1 mM the molar oxidation rate of glyceraldehyde is comparable with that of 8 mM glucose-derived triose equivalents, or 4 mM glucose (Fig. 3
).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 2. D-Glucose and D-glyceraldehyde oxidation rates by freshly isolated rat ß-cells. A, Rate of 14CO2 release during 2 h incubation with D-[U-14C]glucose in absence (filled squares) or presence (open squares) of 1 mM D-glyceraldehyde. B, Rate of 14CO2 release during 2 h incubation with D-[U-14C]glyceraldehyde in absence of glucose (filled circles) or presence of 5 mM glucose (open circles). Results are expressed as picomoles oxidized per103 ß-cells per 2 h. Data represent means ± SE of six independent experiments in duplicate. Significance of differences between oxidation rates of glucose and glyceraldehyde alone or in presence of both was calculated using paired Students t test. *, P < 0.05).
|
|

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 3. Comparison of D-glucose and D-glyceraldehyde oxidation rates expressed as three-carbon (3-C) equivalents. Oxidation rates were expressed per 103 ß-cells per 2 h. Mean glucose oxidation rates were multiplied by 2 to convert picomoles oxidized hexose to picomoles oxidized three-carbon groups and then plotted (open squares) against glyceraldehyde oxidation rates at corresponding three-carbon concentrations (filled circles). Linear curve fitting and r2 (SPSS software) are shown for oxidation rates of both sugars in the lower concentration range. Data represent mean molar oxidation rates ± SE of six independent experiments in duplicate. 3-C, 3-Carbon equivalents.
|
|
The respective oxidation of glucose and glyceraldehyde largely occur independently of each other. Addition of 5 mM glucose to the 1 mM glyceraldehyde condition moderately increases the rate of glyceraldehyde oxidation (30%, P < 0.05, Fig. 2B
) and exerts no effect at higher glyceraldehyde concentrations (data not shown). Addition of 1 mM glyceraldehyde has a slight stimulatory effect on glucose oxidation at 5 mM glucose (25% increase, P < 0.05) but not at any other glucose concentration tested (Fig. 2A
).
The oxidation of both sugars was suppressed by 1 mM IAM (Table 1
), an irreversible inhibitor of GAPDH, which is indicative for a common catabolic step at the triose level of glycolysis. In line with previous results (17), the specific GK inhibitor (26) mannoheptulose suppresses oxidation of glucose but has no effect on glyceraldehyde oxidation (Table 1
).
-Cyanohydroxycinnaminic acid (2 mM), an inhibitor of mitochondrial pyruvate uptake, reduced glucose as well as glyceraldehyde-induced NAD(P)H formation by approximately 50% (data not shown), which supports the view that the two nutrients influence NAD(P)H autofluorescence intensity through an activation of mitochondrial metabolism.
Comparison of glyceraldehyde metabolism in ß-cells with low or high metabolic responsiveness to glucose
ß-Cells were separated according to their level of NAD(P)H formation at 7.5 mM glucose whereby subpopulations with low or with high metabolic responsiveness were distinguished, each comprising around 40% of the total FACS-purified ß-cell population (12, 13). The glucose low-responsive subpopulation exhibited a slightly lower rate of glyceraldehyde oxidation than the glucose high-responsive subpopulation (23% lower at 1 mM, P = 0.03, n = 4), whereas its glucose-oxidation rate was more reduced (53% lower at 5 mM, P = 0.003, n = 4).
Both subpopulations were then compared for their glucose-inducible changes in metabolic redox state in the absence or presence of 1 mM glyceraldehyde (Fig. 4
). The glucose low-responsive subpopulation exhibited, in the absence of glyceraldehyde, much lower percentages of metabolically activated cells at all glucose concentrations. Addition of 1 mM glyceraldehyde markedly reduced this difference. At 10 mM glucose, the triose did not further increase the percent activated cells in the high-responsive subpopulation but more than doubled the percent in the low-responsive one up to the values in the high-responsive one. In presence of glyceraldehyde, differences in Km between the two subpopulations almost disappeared (decrease from 9 to 4 mM in low glucose-responsive cells and from 6 to 3 mM in high glucose-responsive cells; Fig. 4
); NAD(P)H levels in glucose low-responsive cells exposed to glyceraldehyde were now no longer statistically different from those in glucose high-responsive cells in the absence of the triose (P values between 0.11 and 0.92, n = 4) and only borderline lower in its presence (P value between 0.04 and 0.17, n = 4). Taken together, addition of 1 mM glyceraldehyde increased the glucose-induced area under the curve in the 020 mM glucose range, by 209% in the glucose low-responsive population and by only 17% in the high-responsive population (Fig. 4
). These data indicate that the glyceraldehyde effects that were observed in the total ß-cell population at 10 or 20 mM glucose have been induced in ß-cells that were poorly responsive to these high glucose levels. The effects at lower glucose concentrations (2.5 and 5 mM) show that glyceraldehyde increases glucose sensitivity in both subpopulations.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 4. Comparison of glyceraldehyde-induced metabolic recruitment in ß-cell subpopulations with high or low metabolic responsiveness to 7.5 mM glucose. ß-Cells with high (left panel) and low (right panel) glucose responsiveness were exposed for 30 min to the indicated glucose concentrations in absence (open circles) or presence (filled diamonds) of 1 mM D-glyceraldehyde. Data represent mean percent ß-cells with high NAD(P)H ± SE (n = 5; paired Students t test). *, P < 0.001 and **, P < 0.01 vs. controls without glyceraldehyde.
|
|
Effect of glyceraldehyde on translational control proteins and protein biosynthesis
In line with previous observations by others (27), glucose rapidly and concentration-dependently activated translational control proteins. This is reflected by increased phosphorylation of ribosomal S6 (P-rS6), an alpha to gamma band shift of 4E-binding protein 1 (4E-BP1), dephosphorylation of eukaryotic initiation factor (eIF)-2
, and dephosphorylation of eukaryotic elongation factor (eEF)-2 (Fig. 5
). Addition of 1 mM glyceraldehyde to 5 and 10 mM glucose further increased this glucose effect (respectively, P < 0.01 for P-eIF2
, P < 0.05 for P-rS6, n = 5, and P < 0.05 for both P-eIF2
and P-rS6, n = 5) (Fig. 5
). Glyceraldehydes effect on eEF2 dephosphorylation was less marked but showed the same trend. Over a 2-h incubation, rS6, eIF2
, and eEF2 protein did not change significantly (n = 45, representative bands shown in Fig. 5
).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 5. Effect of glucose (Glc) and glyceraldehyde (Glyc) on phosphorylation/activation state of translation regulators. Freshly isolated rat ß-cells were incubated in an aggregated state for 2 h at the indicated glucose concentrations with or without 1 mM glyceraldehyde, followed by extraction of cellular proteins and processing for Western blotting as specified in Materials and Methods. For each of the translation regulator proteins a representative blot is shown as well as a bar graph showing the mean ± SE of four to five independent experiments. Upper left panel, Nutrient-associated band shift from 4E-BP1 (lower lane on blot) over ß (middle lane) to (upper lane) isoforms. Bar graphs represent the relative distribution of (white), ß (gray), and (black) isoforms, expressed as percentage of total amount of 4E-BP1. Lower left panel, Representative blot of P-rS6, compared with total rS6 protein (rS6); bar graphs represent actin-normalized levels of P-rS6 (mean ± SE, n = 45). Upper right and lower right panel, Representative blots of phosphorylated and total eIF2 and eEF2, respectively. Bar graphs again represent mean ± SE from four to five experiments. *, At least P < 0.05 significant difference, compared with the same glucose concentration without glyceraldehyde.
|
|
Glyceraldehyde also stimulated protein synthesis but only at glucose concentrations lower than 10 mM (Fig. 6A
); this was also the case when (pro)insulin biosynthesis was measured (data not shown). When protein synthetic rates in absence or presence of glyceraldehyde were plotted against the corresponding rates of nutrient oxidation, i.e. total three-carbon oxidation rates of the glucose and/or glyceraldehyde levels present, they fit a polynomial regression line (Fig. 6B
; r2 = 0.975), illustrating that protein biosynthesis proportionally increases with the nutrient oxidation rate until it reached its maximal capacity. In the presently used rat ß-cell preparations, this capacity corresponded to the level that is inducible by 10 mM glucose alone. Thus, induction of higher oxidation rates than those measured at 10 mM glucose alone, be it by increasing glucose and/or adding glyceraldehyde, did not result in a further increase in protein synthesis (P = 0.23, Fig. 6
, A and B).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6. Correlation between nutrient-induced oxidation and protein synthetic activity in rat ß-cells. A, Total protein synthesis was measured over 2-h incubations at the indicated glucose concentrations in absence (open circles) or presence (filled squares) of 1 mM D-glyceraldehyde. Data represent means ± SE of five independent experiments. *, P < 0.001, paired students t test. B, Plotting of total protein synthesis data from A against corresponding oxidation rate (expressed as picomoles 3-carbon equivalents) results in polynomial regression line (SPSS, r2 = 0.975). Open circles, Glucose alone; filled squares, glucose + 1 mM D-glyceraldehyde.
|
|
The dissociation between the glyceraldehyde effects on metabolism and protein synthesis was confirmed in the two subpopulations (Fig 7
). In both the high- and low-responsive subpopulation, addition of 1 mM glyceraldehyde to 5 mM glucose increases protein biosynthesis in proportion to the increase in oxidation. This increases amounts to 10.6 ± 1.9 and 7.1 ± 1.5 dpm/103 cells x 2 h, respectively, in high- and low-responsive cells whereby the 30% lower value in the low-responsive cells corresponds to their 23% lower triose oxidation rate.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7. Effect of glyceraldehyde on protein biosynthetic activity in ß-cell subpopulations with high or low metabolic responsiveness to 7.5 mM glucose. Total protein synthesis was measured over 2-h incubations at the indicated glucose concentrations in absence (black bars) or presence (white bars) of 1 mM glyceraldehyde in ß-cell subpopulations with high (left panel) and low (right panel) metabolic responsiveness to 7.5 mM glucose. Data represent means ± SE of four independent experiments. *, P < 0.001, paired students t test with vs. without glyceraldehyde.
|
|
The absence of a stimulatory effect on protein synthesis by glucose low-responsive ß-cells at 10 mM glucose (Fig. 7
, right panel) contrasted with its marked metabolic activation in this condition (Fig. 4
, right panel). This could not be attributed to a lower content of insulin mRNA as judged from quantitative real-time RT-PCR of insulin 1 and 2 mRNA in the two subpopulations. Insulin 1 and 2 mRNA levels in the low-responsive subset were 94 ± 17 and 84 ± 33% of the corresponding levels in the high responsive (n = 4, P > 0.30). In both subsets, insulin 1 mRNA was 6- to 7-fold more abundant than insulin 2 mRNA (n = 4).
 |
Discussion
|
|---|
Previous studies have shown that the pancreatic ß-cell population is composed of cells that differ in their individual glucose sensitivity (28). This intercellular heterogeneity was first identified in isolated rat and human ß-cells (29) and later shown to express the functional state of the in situ population (30). It remained present after acute stimulation by high glucose (31) or glibenclamide (30) but was markedly altered by chronic exposure to these stimulatory conditions (32). In normal rat ß-cells, intercellular differences in glucose-induced metabolic activation correlate with differences in cellular sensitivity to glucose-induced insulin synthesis and release (13). The cellular metabolic redox state can be used to separate glucose low- and high-responsive ß-cells through flow cytometry (33). For example, at 7.5 mM glucose, the rat ß-cell population can be divided into two subpopulations, depending on an absent/low or high cellular metabolic response; these subpopulations are of similar size because this concentration approximates the Km for GK (12, 13). Glucose low-responsive ß-cells exhibit a lower glucose sensitivity of their metabolic, secretory and biosynthetic activities than glucose high-responsive ß-cells (13, 14). Their maximal glucose-inducible protein synthetic activity is also lower (13), but their cellular insulin content is comparable with the high-responsive cells (13 and our data), which infers a similarly reduced secretory responsiveness to glucose.
These characteristics can be attributed, at least in part, to the lower GK expression and activity in these cells (12). ß-Cells with a lower GK expression have also been noticed in the intact pancreas (34). [They might represent a potential therapeutic target in type 2 diabetes, considering the discovery of molecules that selectively increase GK activity (GK activators) and that can thus be expected to enhance the lower rates of insulin biosynthesis and release in these cells (35).] In the present study, we investigated whether metabolic activation distal to GK could overcome the constraints imposed by a low cellular GK activity on their functional responsiveness to glucose. Glyceraldehyde was shown to be useful for this study because it bypasses GK and mimics glucose actions.
The stimulatory action of glyceraldehyde on ß-cells has been known for many years (17). Glyceraldehyde is classically seen as first being phosphorylated by triokinase to glyceraldehyde-3-phosphate, which then enters the distal glycolytic pathway via GAPDH to be further mitochondrially oxidized, thus mimicking a glucose-dependent signal (15, 16, 17, 36). The observation that glyceraldehyde generated a stronger stimulation than equimolar glucose concentrations (17, 37) led to other possible mechanisms. On the basis of experiments in HIT-15 hamster insulinoma cells, Best and colleagues (19) suggested that electrogenic transport of glyceraldehyde across the plasma membrane might result in cellular acidification and/or depolarization, causing insulin release independent of metabolic activity. Whereas it is not excluded that such effect also occurs in primary ß-cells, it is unclear how it could explain acute stimulatory effects on mitochondrial and protein biosynthetic activities. The finding that islets contain a much lower triokinase than GAPDH activity led MacDonald (18) to propose that, in addition to its metabolism via triokinase, glyceraldehyde could also be directly oxidized by GAPDH without prior phosphorylation; this would then lead to the metabolic dead-end intermediates glycerate-1-phosphate and glycerate with formation of reduced nicotinamide adenine dinucleotide that could serve as a stimulatory signal (38). It was also suggested that glyceraldehyde isomerizes to dihydroxyacetone (39), thus modulating ß-cell function through the glycerol-3-phosphate shuttle (40) or via dihydroxyacetone itself, which can also, albeit less potently, stimulate ß-cells (17, 40).
Glyceraldehyde conversion to glycerate (18) or glycerol-3-phosphate (39) has been reported to occur at higher glyceraldehyde concentrations (>2 mM) than those used in the present study and might then indeed contribute to the toxic actions of the sustained exposure to high concentrations of the triose (21, 41). However, at 1 mM, we found glyceraldehyde to be a potent mitochondrial substrate in primary ß-cells. This supports the view that glyceraldehyde, at low concentrations, is not primarily diverted into alternative metabolic pathways but enters glycolysis and oxidative catabolism in ß-cells, presumably at the level of GAPDH, thus bypassing the GK step in glucose signaling (16). At this concentration, its stoichiometric potency in ß-cell activation can be entirely explained by its remarkably high rate of oxidation: for all tested functions, addition of 1 mM glyceraldehyde to 5 mM glucose exerted a similar stimulating effect as 89 mM glucose, namely on NAD(P)H-formation, CO2 formation, phosphorylation of translational regulators, and rates of protein biosynthesis. Under the presently used conditions, the observation that glyceraldehyde oxidation rates are up to 4-fold higher than those of glucose when adjusting for triose equivalents is compatible with the GK-induced limitation in glucose breakdown. It supports the rationale of using glyceraldehyde as a nutrient substrate for distal glycolysis, for example to investigate the level at which glucose responsiveness is impaired in ß-cells.
As for glucose, the glyceraldehyde-induced mitochondrial activity is associated with an activation of key regulators in translation initiation and a stimulation of protein synthetic activity. The total sugar oxidation rate correlated with the stimulatory effect on protein synthesis until the latter had reached its maximal capacity as measured at 10 mM glucose, corresponding roughly to the combination of 5 mM glucose plus 1 mM glyceraldehyde. Sugar oxidation could reach higher rates than those at 10 mM glucose, but this did not result in higher protein biosynthesis. Such dissociation was already previously observed when an increase from 10 to 20 mM glucose further stimulated oxidation but not insulin synthesis (12, 42). It was now particularly evident in the glucose low-responsive subpopulation in which addition of 1 mM glyceraldehyde to 10 mM glucose markedly increased its metabolic activity, bringing its metabolic redox state to the level of that in glucose high-responsive cells but not its protein synthetic capacity.
Our study showed that failure to stimulate biosynthesis beyond the levels induced by 10 mM glucose cannot be attributed to a limitation in mitochondrial signaling (27). Indeed, addition of 1 mM glyceraldehyde to 10 mM glucose-exposed ß-cells increased metabolic rates, in particular in the cells that were refractory to the 10-mM glucose stimulus. This metabolic stimulation resulted in: 1) further phosphorylation of ribosomal protein S6, 2) alpha to gamma shift of 4E-BP1, and 3) dephosphorylation of eIF2
. The failure appeared related to neither insufficient mammalian target of rapamycin (mTOR)-mediated nutrient sensing and translational activation nor a shortage in insulin mRNA because no differences at these levels were measured between the glucose low- and high-responsive subpopulations. It seems more likely that the maximal glucose-inducible protein synthetic capacity at a given time is a characteristic of the ß-cell phenotype, which is subject to chronic rather than acute variations in the cellular environment. Such phenotypic differences might be expressed at various levels of the protein biosynthesis process, i.e. the amount of functional ribosomes (43), endoplasmic reticulum, or the size of the mRNA pool that is directly available for translation (44, 45).
In conclusion, low glyceraldehyde concentrations can substitute for glucose by entering ß-cell intermediary metabolism downstream of glucokinase, thereby metabolically activating the cells proportionate to their oxidation level. This action is most pronounced in ß-cells with glucose low responsiveness, which is consistent with the view that these cells exhibit a lower GK activity and can be activated by substrates entering more distally. Glyceraldehyde-induced metabolic activation is associated with an activation of translation regulators and an increase in protein synthetic activity. This acute effect does not amplify the maximal glucose-inducible protein synthetic capacity as measured at 10 mM glucose, suggesting that this property is a characteristic of the ß-cell phenotype. Along this view, the inability of an acute nutrient stimulus to correct intercellular differences in protein synthetic capacity is consistent with the presence of a functional heterogeneity in the pancreatic ß-cell population, which is subject to chronic regulation.
 |
Acknowledgments
|
|---|
The authors thank René De Proft, Lut Heylen, and Erik Quartier (Diabetes Research Center) for expert technical assistance.
 |
Footnotes
|
|---|
This work was supported by the Research Foundation Flanders (FWO) Grant FWO-G.0357.03 and PhD Grant 101/8 (to G.A.M.) and the Inter-University Poles of Attraction Program (IUAP P5/17) from the Belgian Science Policy. The Diabetes Research Center is a partner of the JDRF Center for Beta Cell Therapy in Diabetes.
Disclosure statement: the authors have nothing to disclose.
First Published Online August 17, 2006
Abbreviations: Ct, Cycle threshold; 4E-BP1, 4E-binding protein 1; eEF, eukaryotic elongation factor; eIF, eukaryotic initiation factor; FACS; fluorescence-activated cell sorting; FAD, flavin adenine dinucleotide; FMN, flavin mononucleotide; FAD(H2), (reduced) FAD; FMN(H2), (reduced) FMN; GK, glucokinase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; IAM, iodoacetamide; Km, Michaelis constant; MH, mannoheptulose; MP, manufacturers protocol; NAD(P)H, reduced nicotinamide adenine dinucleotide (phosphate); PI, propidium iodide; P-rS6, phosphorylation of ribosomal S6.
Received May 3, 2006.
Accepted for publication August 9, 2006.
 |
References
|
|---|
- Prentki M 1996 New insights into pancreatic ß-cell metabolic signaling in insulin secretion. Eur J Endocrinol 134:272286[Abstract/Free Full Text]
- Wollheim CB, Maechler P 2002 ß-Cell mitochondria and insulin secretion: messenger role of nucleotides and metabolites. Diabetes 51(Suppl 1):S37S42
- Henquin JC 2000 Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes 49:17511760[Abstract]
- Eto K, Suga S, Wakui M, Tsubamoto Y, Terauchi Y, Taka J, Aizawa S, Noda M, Kimura S, Kasai H, Kadowaki T 1999 NADH shuttle system regulates K(ATP) channel-dependent pathway and steps distal to cytosolic Ca(2+) concentration elevation in glucose-induced insulin secretion. J Biol Chem 274:2538625392[Abstract/Free Full Text]
- Alarcon C, Wicksteed B, Prentki M, Corkey BE, Rhodes CJ 2002 Succinate is a preferential metabolic stimulus-coupling signal for glucose-induced proinsulin biosynthesis translation. Diabetes 51:24962504[Abstract/Free Full Text]
- Matschinsky FM, Glaser B, Magnuson MA 1998 Pancreatic ß-cell glucokinase: closing the gap between theoretical concepts and experimental realities. Diabetes 47:307315[Abstract]
- Matschinsky FM 2002 Regulation of pancreatic ß-cell glucokinase: from basics to therapeutics. Diabetes 51(Suppl 3):S394S404
- Vionnet N, Stoffel M, Takeda J, Yasuda K, Bell GI, Zouali H, Lesage S, Velho G, Iris F, Passa P, Froguel P, Cohen D 1992 Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature 356:721722[CrossRef][Medline]
- Gloyn AL, Odili S, Zelent D, Buettger C, Castleden HA, Steele AM, Stride A, Shiota C, Magnuson MA, Lorini R, dAnnunzio G, Stanley CA, Kwagh J, van Schaftingen E, Veiga-da-Cunha M, Barbetti F, Dunten P, Han Y, Grimsby J, Taub R, Ellard S, Hattersley AT, Matschinsky FM 2005 Insights into the structure and regulation of glucokinase from a novel mutation (V62M), which causes maturity-onset diabetes of the young. J Biol Chem 280:1410514113[Abstract/Free Full Text]
- Stoffel M, Froguel P, Takeda J, Zouali H, Vionnet N, Nishi S, Weber IT, Harrison RW, Pilkis SJ, Lesage S, Vaxillaire M, Velho G, Sun F, Iris F, Passa P, Cohen D, Bell GI 1992 Human glucokinase gene: isolation, characterization, and identification of two missense mutations linked to early-onset non-insulin-dependent (type 2) diabetes mellitus. Proc Natl Acad Sci USA 89:76987702[Abstract/Free Full Text]
- Byrne MM, Sturis J, Clement K, Vionnet N, Pueyo ME, Stoffel M, Takeda J, Passa P, Cohen D, Bell GI, Velho G, Froguel P, Polonsky KS 1994 Insulin secretory abnormalities in subjects with hyperglycemia due to glucokinase mutations. J Clin Invest 93:11201130[Medline]
- Heimberg H, De Vos A, Vandercammen A, Van Schaftingen E, Pipeleers D, Schuit F 1993 Heterogeneity in glucose sensitivity among pancreatic ß-cells is correlated to differences in glucose phosphorylation rather than glucose transport. EMBO J 12:28732879[Medline]
- Kiekens R, Int Veld P, Mahler T, Schuit F, Van De Winkel M, Pipeleers D 1992 Differences in glucose recognition by individual rat pancreatic ß cells are associated with intercellular differences in glucose-induced biosynthetic activity. J Clin Invest 89:117125[Medline]
- Van Schravendijk CF, Kiekens R, Pipeleers DG 1992 Pancreatic ß cell heterogeneity in glucose-induced insulin secretion. J Biol Chem 267:2134421348[Abstract/Free Full Text]
- Malaisse WJ, Herchuelz A, Levy J, Sener A, Pipeleers DG, Devis G, Somers G, Obberghen EV 19751976 The stimulus-secretion coupling of glucose-induced insulin release XIX. The insulinotropic effect of glyceraldehyde. Mol Cell Endocrinol 4:112
- Alcazar O, Gine E, Qiu-Yue Z, Tamarit-Rodriguez J 1995 The stimulation of insulin secretion by D-glyceraldehyde correlates with its rate of oxidation in islet cells. Biochem J 310(Pt 1):215220
- Zawalich WS, Dye ES, Rognstad R, Matschinsky FM 1978 On the biochemical nature of triose- and hexose-stimulated insulin secretion. Endocrinology 103:20272034[Abstract/Free Full Text]
- MacDonald MJ 1989 Does glyceraldehyde enter pancreatic islet metabolism via both the triokinase and the glyceraldehyde phosphate dehydrogenase reactions? A study of these enzymes in islets. Arch Biochem Biophys 270:1522[CrossRef][Medline]
- Elliott AC, Trebilcock R, Yates AP, Best L 1993 Stimulation of HIT-T15 insulinoma cells by glyceraldehyde does not require its metabolism. Eur J Biochem 213:359365[Medline]
- Best L, Thornalley PJ 1999 Trioses and related substances: tools for the study of pancreatic ß-cell function. Biochem Pharmacol 57:583588[CrossRef][Medline]
- Takahashi H, Tran PO, LeRoy E, Harmon JS, Tanaka Y, Robertson RP 2004 D-Glyceraldehyde causes production of intracellular peroxide in pancreatic islets, oxidative stress, and defective ß cell function via non-mitochondrial pathways. J Biol Chem 279:3731637323[Abstract/Free Full Text]
- Pipeleers DG, int Veld PA, Van de Winkel M, Maes E, Schuit FC, Gepts W 1985 A new in vitro model for the study of pancreatic A and B cells. Endocrinology 117:806816[Abstract/Free Full Text]
- Matschinsky FM 1996 Banting Lecture 1995. A lesson in metabolic regulation inspired by the glucokinase glucose sensor paradigm. Diabetes 45:223241[Abstract]
- Van De Winkel M, Pipeleers D 1983 Autofluorescence-activated cell sorting of pancreatic islet cells: purification of insulin-containing ß-cells according to glucose-induced changes in cellular redox state. Biochem Biophys Res Commun 114:835842[CrossRef][Medline]
- Schuit F, De Vos A, Farfari S, Moens K, Pipeleers D, Brun T, Prentki M 1997 Metabolic fate of glucose in purified islet cells. Glucose-regulated anaplerosis in ß cells. J Biol Chem 272:1857218579[Abstract/Free Full Text]
- Coore HG, Randle PJ 1964 Inhibition of glucose phosphorylation by mannoheptulose. Biochem J 91:5659[Medline]
- McDaniel ML, Marshall CA, Pappan KL, Kwon G 2002 Metabolic and autocrine regulation of the mammalian target of rapamycin by pancreatic ß-cells. Diabetes 51:28772885[Abstract/Free Full Text]
- Pipeleers DG 1992 Heterogeneity in pancreatic ß-cell population. Diabetes 41:777781[Abstract]
- Pipeleers D 1987 The biosociology of pancreatic ß cells. Diabetologia 30:277291[CrossRef][Medline]
- Ling Z, Wang Q, Stange G, Int Veld P, Pipeleers D 2006 Glibenclamide treatment recruits ß-cell subpopulation into elevated and sustained basal insulin synthetic activity. Diabetes 55:7885[Abstract/Free Full Text]
- Martens GA, Cai Y, Hinke S, Stange G, Van De Casteele M, Pipeleers D 2005 Glucose suppresses superoxide generation in metabolically responsive pancreatic ß cells. J Biol Chem 280:2038920396[Abstract/Free Full Text]
- Ling Z, Kiekens R, Mahler T, Schuit FC, Pipeleers-Marichal M, Sener A, Kloppel G, Malaisse WJ, Pipeleers DG 1996 Effects of chronically elevated glucose levels on the functional properties of rat pancreatic ß-cells. Diabetes 45:17741782[Abstract]
- Van de Winkel M, Maes E, Pipeleers D 1982 Islet cell analysis and purification by light scatter and autofluorescence. Biochem Biophys Res Commun 107:525532[Medline]
- Jetton TL, Magnuson MA 1992 Heterogeneous expression of glucokinase among pancreatic ß cells. Proc Natl Acad Sci USA 89:26192623[Abstract/Free Full Text]
- Grimsby J, Sarabu R, Corbett WL, Haynes NE, Bizzarro FT, Coffey JW, Guertin KR, Hilliard DW, Kester RF, Mahaney PE, Marcus L, Qi L, Spence CL, Tengi J, Magnuson MA, Chu CA, Dvorozniak MT, Matschinsky FM, Grippo JF 2003 Allosteric activators of glucokinase: potential role in diabetes therapy. Science 301:370373[Abstract/Free Full Text]
- Ashcroft SJ, Weerasinghe LC, Randle PJ 1973 Interrelationship of islet metabolism, adenosine triphosphate content and insulin release. Biochem J 132:223231[Medline]
- Jain K, Logothetopoulos J, Zucker P 1975 The effects of D- and L-glyceraldehyde on glucose oxidation, insulin secretion and insulin biosynthesis by pancreatic islets of the rat. Biochim Biophys Acta 399:384394[Medline]
- Dukes ID, McIntyre MS, Mertz RJ, Philipson LH, Roe MW, Spencer B, Worley JF 1994 Dependence on NADH produced during glycolysis for ß-cell glucose signaling. J Biol Chem 269:1097910982[Abstract/Free Full Text]
- Maswoswe SM, Daneshmand F, Davies DR 1986 Metabolic effects of D-glyceraldehyde in isolated hepatocytes. Biochem J 240:771776[Medline]
- Eto K, Tsubamoto Y, Terauchi Y, Sugiyama T, Kishimoto T, Takahashi N, Yamauchi N, Kubota N, Murayama S, Aizawa T, Akanuma Y, Aizawa S, Kasai H, Yazaki Y, Kadowaki T 1999 Role of NADH shuttle system in glucose-induced activation of mitochondrial metabolism and insulin secretion. Science 283:981985[Abstract/Free Full Text]
- MacDonald MJ, Chaplen FW, Triplett CK, Gong Q, Drought H 2006 Stimulation of insulin release by glyceraldehyde may not be similar to glucose. Arch Biochem Biophys 447:118126[CrossRef][Medline]
- Schuit FC, Kiekens R, Pipeleers DG 1991 Measuring the balance between insulin synthesis and insulin release. Biochem Biophys Res Commun 178:11821187[CrossRef][Medline]
- Powers T, Walter P 1999 Regulation of ribosome biogenesis by the rapamycin-sensitive TOR-signaling pathway in Saccharomyces cerevisiae. Mol Biol Cell 10:9871000[Abstract/Free Full Text]
- Welsh M, Scherberg N, Gilmore R, Steiner DF 1986 Translational control of insulin biosynthesis. Evidence for regulation of elongation, initiation and signal-recognition-particle-mediated translational arrest by glucose. Biochem J 235:459467[Medline]
- Greenman IC, Gomez E, Moore CE, Herbert TP 2005 The selective recruitment of mRNA to the ER and an increase in initiation are important for glucose-stimulated proinsulin synthesis in pancreatic ß-cells. Biochem J 391:291300[CrossRef][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
G. A. Martens, A. Vervoort, M. Van de Casteele, G. Stange, K. Hellemans, H. V. Van Thi, F. Schuit, and D. Pipeleers
Specificity in Beta Cell Expression of L-3-Hydroxyacyl-CoA Dehydrogenase, Short Chain, and Potential Role in Down-regulating Insulin Release
J. Biol. Chem.,
July 20, 2007;
282(29):
21134 - 21144.
[Abstract]
[Full Text]
[PDF]
|
 |
|