help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0493
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Resch, Z. T.
Right arrow Articles by Conover, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Resch, Z. T.
Right arrow Articles by Conover, C. A.
Endocrinology Vol. 147, No. 12 5634-5640
Copyright © 2006 by The Endocrine Society

Targeted Disruption of the Pregnancy-Associated Plasma Protein-A Gene Is Associated with Diminished Smooth Muscle Cell Response to Insulin-like Growth Factor-I and Resistance to Neointimal Hyperplasia after Vascular Injury

Zachary T. Resch, Robert D. Simari and Cheryl A. Conover

Department of Internal Medicine, Endocrine Research Unit (Z.T.R., C.A.C.), and Division of Cardiovascular Diseases (R.D.S.), Mayo Clinic College of Medicine, Rochester, Minnesota 55905

Address all correspondence and requests for reprints to: Cheryl A. Conover, Ph.D., Mayo Clinic, 200 First Street Southwest, 5-194 Joseph, Rochester, Minnesota 55905. E-mail: conover.cheryl{at}mayo.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IGF-I is an important determinant of the vascular response to injury in large part through its ability to stimulate migration and proliferation of smooth muscle cells (SMCs). In this study, we used mice with targeted disruption of the pregnancy-associated plasma protein-A gene (PAPP-A–/–) and wild-type (WT) littermates to test the hypotheses that PAPP-A, a metalloproteinase that cleaves inhibitory IGF binding protein (IGFBP)-4, regulates vascular SMC responses to IGF-I in vitro and is critical for the development of vascular neointima after injury in vivo. Vascular SMCs from PAPP-A–/– mice lacked IGFBP-4 protease activity and failed to respond to treatment with IGF-I in the presence of IGFBP-4, whereas SMCs from WT mice with robust IGFBP-4 protease activity showed significant migratory and proliferative responses to IGF-I/IGFBP-4. For in vivo testing, PAPP-A–/– and WT mice underwent unilateral carotid ligation, a model of injury-induced neointimal hyperplasia. In WT mice, PAPP-A mRNA expression was markedly elevated 7 and 14 d after carotid ligation, associated with a progressive increase in neointimal hyperplasia and, in many cases, with complete occlusion of the vessel at 28 d. In contrast, PAPP-A–/– mice showed little evidence of progression resulting in a 75% reduction in neointimal area when compared with WT at 28 d. Cells staining for proliferating cell nuclear antigen were plentiful in the SMC-rich medial and neointimal areas of the injured WT vessel in stark contrast to the relatively few proliferating cells in the same areas of the PAPP-A–/– vessel. Expression of IGF-I and IGFBP-4 was similarly elevated in injured carotids from WT and PAPP-A–/– mice with no change in IGF-I receptor expression. IGFBP-5, an IGF-responsive gene, was increased 2-fold in WT but not in PAPP-A–/– carotids, suggesting reduced IGF activity in the absence of PAPP-A. Thus, PAPP-A-deficient mice are resistant to neointimal formation after injury, which may be explained in part by the ability of PAPP-A to enhance local IGF-I stimulation of vascular SMCs through proteolysis of IGFBP-4.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MIGRATION AND PROLIFERATION of vascular smooth muscle cells (SMCs) play major roles in the development of atherosclerosis and in restenosis after angioplasty (1, 2, 3, 4). The molecular mediators that regulate this vascular remodeling are yet to be completely understood but appear to involve complex interactions of locally produced cytokines and growth factors expressed in response to injury or insult. One of these growth factors, IGF-I, is elevated in human atherosclerotic lesions and the neointima of injured vessels and appears to contribute to pathophysiological responses to injury (5, 6, 7, 8, 9). In vitro studies of SMCs have shown that increases in IGF-I receptor signaling lead to increased migration, proliferation, and matrix protein synthesis, all characteristics of medial SMCs that infiltrate the intimal layer and contribute to neointimal formation (10, 11, 12, 13).

IGF-I bioactivity is not only the result of the expression of IGF-I and its receptors but is also modulated by a structurally related family of proteins known collectively as the IGF binding proteins (IGFBP-1 through -6). IGFBPs bind IGF-I and modulate activation of receptor signaling in addition to having several IGF-independent actions (14, 15, 16). In turn, posttranslational modification of IGFBPs by IGFBP-specific proteases provides a mechanism for fine-tuned control of local IGF bioavailability (17, 18). Previous studies have shown that SMCs in culture produce IGFBP-2 through -6, with some variability between species (19, 20). However, IGFBP-4 appears to be a major IGFBP produced by rodent and human SMCs and, when intact, has an inhibitory effect on IGF-I action (19, 21, 22, 23, 24, 25). In fact, mice engineered to overexpress IGF-I in smooth muscle exhibited vascular hypertrophy, whereas those expressing a protease-resistant form of IGFBP-4 exhibited vascular hypotrophy (6, 26).

An IGFBP-4 protease expressed in human fibroblasts and SMCs, among other cell types, was identified as pregnancy-associated plasma protein-A (PAPP-A) (27, 28). PAPP-A has been further characterized as a metalloproteinase in the metzincin superfamily of proteins (29). Importantly, the specific IGFBP-4 protease activity of PAPP-A has been shown to increase the responsiveness of cultured fibroblasts and osteoblasts to IGF-I in vitro, an effect that can be attributed to a decrease in the inhibitory influence intact IGFBP-4 has on IGF bioavailability (30, 31). The effect of PAPP-A on vascular SMC responsiveness to IGF-I has not been determined. Furthermore, very little is known about PAPP-A in vivo. The first reported in vivo study determined PAPP-A expression in a porcine model of postangioplasty restenosis (28). Immunohistochemical analysis showed that, after balloon angioplasty, PAPP-A expression in the injured coronary artery was significantly elevated by 7 d and continued to increase through d 28, the phase of active neointimal hyperplasia in this model. The sites of highest expression were the media and intima, locations where increased IGFBP-4 protease activity could be speculated to increase IGF-mediated migration and proliferation of SMCs.

In this study, we use primary vascular SMC cultures from PAPP-A-deficient and wild-type mice to demonstrate PAPP-A/IGFBP-4/IGF-I regulation of migration and proliferation of vascular SMCs. Moreover, we provide direct evidence for PAPP-A’s contribution to vascular restenosis using this unique mouse model that is deficient in functional PAPP-A protease activity (32).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Targeted disruption of the PAPP-A gene in mice
Generation of PAPP-A–/– mice in a C57BL/6, 129 background through targeted disruption of exon 4 of the PAPP-A gene encoding the protease domain was previously described (32).

Primary SMC cultures
Primary SMCs were isolated from aorta (AoSMCs) as described previously (33, 34). Briefly, the aortic arch and descending aorta were collected from wild-type (WT) and PAPP-A–/– mice and the vessels incubated in digestion medium [Hanks’ balanced salt solution (HBSS) containing 0.25 mg/ml soybean trypsin inhibitor, 1 mg/ml collagenase, 2 mg/ml BSA and 15 mmol/liter HEPES] for 1 h. The vessels were washed in HBSS, and the advential and endothelial layers dissected away microscopically. Vessels were then minced with a sterile razor blade and incubated in digestion medium plus 0.125 mg/ml elastase for 1 h. Cells were filtered using a 0.1-mm cell strainer, washed twice with HBSS, and plated in DMEM containing 10% fetal bovine serum (FBS) and penicillin/streptomycin (100 U/ml and 100 µg/ml, respectively). All of the dispersals resulted in > 95% of the cells staining positive for {alpha}-smooth muscle actin (SMA). For experiments, AoSMCs were used between passage 3 and 7, and data presented are the mean ± SEM of a minimum of three separate dispersals.

IGFBP-4 protease assay
Cell-free IGFBP-4 proteolysis was assayed as previously described (28, 31, 32, 35). Conditioned media (25 µl) from WT and PAPP-A–/– AoSMCs were incubated at 37 C for 6 h with 125I-IGFBP-4 (10,000 cpm) in the absence or presence of 5 nmol/liter recombinant IGF-II (Bachem Inc., Torrance, CA). IGF-II appears to facilitate PAPP-A-mediated IGFBP-4 proteolysis in the assay by binding IGFBP-4 and changing its conformation (36, 37). Reaction products were separated by SDS-PAGE and visualized by autoradiography.

Migration assay
AoSMCs were lifted with EDTA/PBS and added to fibronectin-coated (20 ng/ml), Costar Transwells (0.4 µm pore size) at 20,000 cells/well. The chemoattractant for migration was DMEM containing 0.1% FBS (basal), IGF-I (5 nmol/liter; kindly provided by Dr. Martin Spencer, San Francisco, CA) alone or IGF-I and IGFBP-4 (10 nmol/liter; GroPep Inc.). Cells were allowed to migrate for 4 h, and then methanol fixed and hemotoxylin stained. Four fields per membrane were counted.

Proliferation assay
AoSMC monolayers were washed twice, preincubated overnight in DMEM containing 0.1% FBS, washed, and treated ± 1 nmol/liter (Research Diagnostics Inc.) for 24 h. Recombinant IGFBP-4 (10 nmol/liter) ± [Leu27)]IGF-II (5 nmol/liter; GroPep Inc., Adelaide, Australia) was added to the culture medium for 6 h. Without changing the medium, IGF-I (5 nmol/liter) was added, and [3H]-thymidine incorporation was measured at 22–26 h, as previously described (31, 35).

Carotid ligation
Male WT and PAPP-A–/– mice (18–22 g) obtained from heterozygous matings underwent unilateral carotid ligation for the evaluation of vascular remodeling (38). Briefly, animals were anesthetized using an ip injection of xylazine (8 mg/kg) and ketamine (80 mg/kg). A midline incision on the ventral surface of the neck was made and the right and left common carotid arteries isolated from surrounding tissues. A suture was passed under the right vessel just proximal to the carotid bifurcation and the artery ligated; the left vessel was treated similarly (minus the ligation) and was considered the sham control. The overlying fascia was closed with 6–0 vicryl suture and the incision closed using Nexaband tissue glue (Veterinary Products Laboratories, Phoenix, AZ). Animals were given 1 ml lactated Ringer’s solution sc and Enrofloxacin (Bayer Corp., Clayton, NC) im (2.5 mg/kg) the day of the surgery and 1 d after surgery. All procedures were approved by Mayo Clinic’s Institutional Animal Care and Use Committee and complied with the standards stated in the Guide for the Care and Use of Laboratory Animals.

PAPP-A gene expression
WT animals were killed 4, 7, 14, or 21 d after ligation for the measurement of PAPP-A gene expression by semiquantitative PCR. The right (experimental) and left (control) carotid arteries were immediately isolated, dissected and snap frozen. Total RNA was isolated from each vessel using RNeasy Mini Kits (QIAGEN Inc., Valencia, CA), reverse-transcribed (TaqMan; Applied Biosystems, Foster City, CA), and used in the semiquantitative PCR for PAPP-A and the reference gene, ß-actin. The PCR product band intensities were quantified using ethidium bromide and AlphaImager 3.3 analysis software (Alpha Innotech Corp., San Leandro, CA). The linear ranges for PCR products were determined for both PAPP-A and ß-actin using pooled, total RNA collected from uninjured mouse carotid arteries (36 cycles for PAPP-A, 32 for ß-actin). PAPP-A mRNA levels were normalized to ß-actin using the arbitrary OD units and values expressed as a percentage of control vessel [(experimental-control)/experimental].

IGF-I, IGF-I receptor, and IGFBP gene expression
WT and PAPP-A–/– mice were killed 7 d after ligation for measurement of IGF-I, IGF-I receptor, IGFBP-4 and IGFBP-5 gene expression in ligated and nonligated arteries by quantitative PCR using the iCycler Detection System with SYBR green PCR Master Mix (Applied BioSystems). Amplification plots were analyzed with iCycler Detection System analysis software version 3.0.6070 (Bio-Rad, Hercules, CA). Gene expression was normalized to ribosomal protein L19 as an internal control. Sequences were (forward and reverse, respectively): Ribosomal Protein L19 (RPL19) GTATCACAGCCTGTACCTGA and AGACTGATCCACATGAGGCC, IGF-I CTGGTGGATGCTCTTCAGTTC and CCAGT-CTCCTCAGATCACAGC, IGF-I receptor AGCAAGTTCTTCGTTTCG-TCA and CTCCATCTCATCCTTGATGCT, IGFBP-4 GAGAAGCCCC-TGCGTACAT and AGGAAGCTTCACCCCTGTCT, IGFBP-5 ATGAGA-CAGGAATCCGAACAA and ACCAGCAGATGCCACGTTT.

Immuno- and histomorphometry
WT and PAPP-A–/– mice were killed 14 or 28 d after ligation and the carotid arteries fixed in situ by perfusion with PBS-buffered formalin at physiological pressure. Individual arteries were removed, placed into PBS-buffered formalin and fixed for 24 h before paraffin embedding. 5.0-µm thick sections were collected 0.5, 1.0, and 1.5 mm distal to a reference point (0.25 mm distal the ligature). At each distance, Verhoff von Giessen-stained (Accustain; Sigma Corp., St. Louis, MO) sections were evaluated for neointimal formation using Image Pro Plus quantitative analysis (Media Cybernetics, Silver Spring, MD). Neointimal area [area within the internal elastic lamina (IEL) minus luminal area] for each animal was expressed as the mean of the neointimal area measured at the three distinct distances. Medial area was quantified as area defined by the external elastic lamina minus that defined by the IEL. Vessels were stained using anti-SMA (Spring Bioscience, Fremont CA), antiproliferating cell nuclear antigen (PCNA; ABCAM, Cambridge, MA), and the macrophage marker CD68 (clone KP1; Dako, Carpinteria, CA). 3,3'-Diaminobenzidine was the horseradish peroxidase substrate used for detection. Slides were counterstained with hematoxylin.

Data analysis
For all data, ANOVA and post hoc Student’s t tests were used to compare means of multiple groups using JMP 5.1 statistical software (Cary, NC). Means were considered significant at P < 0.05 and values presented are mean ± SEM.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PAPP-A–/– aortic SMCs are deficient in IGFBP-4 protease activity and exhibit decreased response to IGF-I/IGFBP-4
To investigate mechanisms by which PAPP-A regulates vascular responses to injury, SMCs were isolated from the aorta of WT and PAPP-A–/– mice. These AoSMCs stained positive for {alpha}-SMA and exhibited the typical "hill and valley" appearance in culture. No difference in morphologic appearance or proliferation rate was observed between WT and PAPP-A–/– cells under normal growth conditions in 10% FBS (data not shown). Figure 1Go shows a representative IGFBP-4 protease assay from conditioned medium (CM) taken from primary cultures in low serum conditions (0.1% FBS). Forty-eight-hour CM was used in a cell-free assay to determine the relative contribution of PAPP-A to the total proteolysis of 125I-labeled IGFBP-4. WT CM exhibited the IGF-dependent proteolysis characteristic of PAPP-A that we and others (27, 28, 31, 35, 36, 37) have reported previously in other cell types. Conversely, unconditioned medium (0.1% FBS) and CM from PAPP-A–/– mice had no detectable IGFBP-4 proteolytic activity. These results were reproduced in SMCs from aortas of three WT mice and four PAPP-A–/– mice.


Figure 1
View larger version (11K):
[in this window]
[in a new window]
 
FIG. 1. IGFBP-4 protease activity in AoSMC conditioned medium. Representative 125I-IGFBP-4 protease assay of 48-h conditioned medium from WT and PAPP-A–/– AoSMC cultures. +, Addition of 5 nmol/liter IGF-II to the cell-free assay to facilitate IGF-dependant cleavage (36 37 ). Arrows indicate intact and cleaved IGFBP-4.

 
After vascular injury, IGF-I and IGFBP-4 levels are elevated (Ref. 39 and see Fig. 6Go). Therefore, increased PAPP-A expression in this local environment could influence IGF receptor activation by releasing IGF from IGFBP-4. We sought to determine whether PAPP-A–/– AoSMCs could respond to an IGF-I/IGFBP-4 chemotactic stimulus as might occur within the injured vessel. Cells were stimulated to migrate through fibronectin-coated membranes by an IGF-I or IGF-I/IGFBP-4 chemotactic gradient for a period of 4 h. WT and PAPP-A–/– AoSMCs responded similarly to IGF-I alone in migration through the membrane (1056.7% ± 79.2 and 942.6% ± 96.9 of unstimulated control, respectively). However, when AoSMCs were exposed to an IGF-I/IGFBP-4 gradient, AoSMCs isolated from WT animals showed 3-fold increased migration when compared with PAPP-A–/– AoSMCs (620 ± 24% vs. 198 ± 10%; P < 0.01).


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 6. IGF-I, IGF-I receptor (IGF-IR) and IGFBP gene expression after unilateral carotid ligation. Seven days after carotid ligation in WT (solid black bars) and PAPP-A–/– (hatched gray bars) mice, the indicated mRNA levels were measured by real-time PCR and expressed relative to the unligated artery. Results are mean ± SEM, n = 3 separate experiments.

 
After the migration from the media to the intima subsequent to injury, SMCs proliferate and secrete extracellular matrix that contributes to the formation of neointima and luminal narrowing. Two of the proinflammatory cytokines produced after vascular injury, TNF-{alpha} (40) and IL-1ß, have been shown to stimulate PAPP-A gene transcription and translation in human fibroblasts and human coronary artery SMCs (35, 41). Thus, WT and PAPP-A–/– AoSMCs were pretreated without and with TNF-{alpha} for 24 h to stimulate the accumulation of PAPP-A in the medium, allowing for the in vitro comparison of AoSMC responses in the absence of PAPP-A (PAPP-A–/–), with basal levels of PAPP-A (WT), and under elevated PAPP-A conditions as seen after vascular injury (+ TNF-{alpha}). AoSMCs were treated with recombinant IGFBP-4 and [Leu27]IGF-II, an IGF-II variant that binds IGFBP-4 and facilitates IGF-dependent cleavage but does not activate the IGF-I receptor (42). The AoSMCs were then treated with a stimulatory dose of IGF-I. WT and PAPP-A–/– AoSMCs responded similarly to treatment with IGF-I alone (1210.8% ± 178.3 and 1301.7% ± 119.2 of control, respectively). Conversely, WT AoSMCs responded with 2-fold greater [3H]-thymidine incorporation in response to the IGF-I/IGFBP-4 treatment than did PAPP-A–/– cells (Fig. 2Go). When cells were treated with TNF-{alpha} to increase PAPP-A expression, WT AoSMCs responded with enhanced [3H]-thymidine incorporation (6-fold) in response to IGF-I/IGFBP-4. TNF-{alpha} pretreatment of PAPP-A–/– AoSMCs had no effect on their proliferative response to IGF-I/IGFBP-4 (Fig. 2Go).


Figure 2
View larger version (12K):
[in this window]
[in a new window]
 
FIG. 2. AoSMC proliferation in response to IGF-I/IGFBP-4 treatment. WT and PAPP-A–/– AoSMCs were treated ± TNF-{alpha} for 24 h to allow for the accumulation of PAPP-A. After a 6-h incubation with [Leu27]IGF-II to facilitate the proteolysis of IGFBP-4, cells were stimulated with IGF-I and proliferation measured by [3H]-thymidine incorporation. Values are expressed as a percentage of basal proliferation (0.1% FBS). n = 3 independent experiments; *, P < 0.01 vs. WT; #, P < 0.01 vs. WT without TNF-{alpha}.

 
Carotid artery ligation results in elevated PAPP-A gene expression
We have previously reported increased PAPP-A expression after angioplasty in a porcine model of neointimal hyperplasia (28). To determine whether PAPP-A is similarly elevated in a murine model of vascular injury and neointimal formation, we examined PAPP-A mRNA expression in WT mice after unilateral carotid artery ligation (38). As shown in Fig. 3Go, no change in PAPP-A mRNA was observed 4 d after ligation. However, PAPP-A gene expression was significantly elevated 7 and 14 d after carotid ligation. PAPP-A mRNA levels returned to near baseline by d 21. This time-course of elevated PAPP-A gene expression at 7 and 14 d coincides with medial SMC migration across the internal elastic lamina and proliferation within the intima in this murine model of vascular remodeling (43, 44).


Figure 3
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 3. PAPP-A gene expression after unilateral carotid ligation. A, PAPP-A mRNA levels were measured by semiquantitative PCR in ligated carotid arteries and are expressed relative to the unligated (control) artery. Baseline (0), 4, 7, 14, and 21 d after ligation were measured. n = 5 independent experiments; *, P < 0.01 vs. d 0. B, Example of the semiquantitative PCR bands of PAPP-A and actin.

 
PAPP-A–/– mice exhibit reduced intimal lesion formation after carotid ligation
To directly address the contribution of PAPP-A to neointimal formation, PAPP-A–/– and WT littermates were subjected to carotid ligation. Fourteen days after ligation, neointima was detectable in both WT and PAPP-A–/– mice (Fig. 4Go). A marked 5-fold increase in neointimal area was observed in WT animals between d 14 and 28, and several of the WT vessels had completely occluded (see Fig. 5Go). In contrast, there was no significant progression in intimal lesion formation in PAPP-A–/– mice between d 14 and 28. This resulted in a 75% reduction in neointimal area in PAPP-A–/– mice (12,930 ± 3900 µm2) compared with WT mice (50,066 ± 11,700 µm2) at 28 d. The results were similar whether expressed as intimal area (Fig. 4Go), percent of luminal area or of vessel size (as measured by IEL). Medial area was not significantly different between WT and PAPP-A–/– at 14 d (9311 ± 910 vs. 7688 ± 670 µm2) or at 28 d (7552 ± 511 vs. 7726 ± 649 µm2). There was no significant difference between WT and PAPP-A–/– mice in the luminal or intimal area of the contralateral vessel.


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
FIG. 4. Neointimal formation in wild-type and PAPP-A–/– mice. Days 14 and 28 after carotid ligation, neointima in WT and PAPP-A–/– mice was quantified using VVG stained cross sections as described in Materials and Methods. n = 5 for d 14, n = 7 for d 28; *, P < 0.001 vs. WT; #, P < 0.001 vs. d 14.

 

Figure 5
View larger version (59K):
[in this window]
[in a new window]
 
FIG. 5. Immunohistochemistry for SMA and PCNA. Sections from representative WT and PAPP-A–/– vessels 28 d after ligation were stained for SMA, PCNA, or with IgG as control. Black and red arrows in the IgG sections indicate the external elastic lamina and IEL, respectively. Yellow arrows in the PCNA sections indicate some of the positive-staining nuclei.

 
Ten sets of carotids at 28 d after ligation were stained for SMA, macrophages, and PCNA. Figure 5Go represents the general findings from the WT and PAPP-A–/– mice. The neointimal area was primarily made up of SMCs with very few macrophages detected by CD68 staining (not shown), suggesting that the vast majority of increased neointima was not caused by differences in immune cell infiltration after ligation (thrombus or fibrous clot formation) but rather by medial SMC migration and proliferation. Migration is difficult to quantify in vivo; however, proliferation in the carotids of the WT mice was indicated by strong PCNA staining of numerous SMCs in the media and neointima. In comparison, there was relatively sparse PCNA staining of SMCs in the media and neointima of carotids of PAPP-A–/– mice.

Reduced IGF bioactivity despite elevated IGF-I gene expression in ligated carotids from PAPP-A–/– mice
IGF-I gene expression was increased 2- to 3-fold in carotid arteries after injury (Fig. 6Go). This was true in both WT and PAPP-A–/– mice. IGFBP-4 gene expression was also increased 7 d after carotid ligation in both mice genotypes. IGF-I receptor expression was not significantly increased in either group. This sets up an in vivo situation, similar to our in vitro simulation (see Fig. 2Go) where cleavage of IGFBP-4 by PAPP-A could augment IGF-I available for receptor-mediated actions during the active phase of neointimal hyperplasia. One approach to assessing IGF receptor-mediated activity in vivo is by measurement of expression levels of an IGF-responsive gene. IGFBP-5 mRNA is known to be increased by IGF-I in several cell types (45, 46, 47), and IGFBP-5 mRNA abundance has been used as a marker of IGF-I signaling in vivo (48, 49). As shown in Fig. 6Go, IGFBP-5 mRNA was increased 2-fold in injured carotids from WT mice, but there was no significant response in carotids from PAPP-A–/– mice.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, we present evidence of PAPP-A’s ability to modulate local IGF-I stimulation of migration and proliferation of vascular SMCs, processes that contribute to neointimal formation in response to injury. In addition, we demonstrate a critical role for PAPP-A in the development of neointima in a murine model of vascular remodeling. These data support the notion that regulation of IGF bioavailability by an IGFBP protease in vivo has physiological consequences.

IGFBP-4 is a major binding protein produced by vascular SMCs and in the intact form inhibits IGF-I action (19, 24, 25, 28). Therefore, regulation of IGFBP-4 function through IGFBP-4 protease expression may be critical to IGF-mediated SMC responses. In a cell-free assay of IGFBP-4 protease activity, conditioned medium from the WT AoSMC cultures but not PAPP-A–/– AoSMC cultures exhibited IGFBP-4 cleavage, indicating that PAPP-A is the source of IGFBP-4 protease activity in these SMCs. There has been some suggestion of IGFBP-4 proteases besides PAPP-A (24, 39), but several recent studies support the notion that PAPP-A is the major, if not the only, physiologically relevant IGFBP-4 protease (28, 30, 32). AoSMCs isolated from WT and PAPP-A–/– mice responded similarly to treatment with IGF-I with chemotactic migration and proliferation, suggesting no fundamental difference in IGF-I receptors and receptor responsiveness. However, if cells were treated with a combination of IGF-I and IGFBP-4, which is relevant in the arena of vascular injury, the WT cells responded with increased migration and proliferation when compared with PAPP-A–/– AoSMCs. Furthermore, if WT cells were stimulated with TNF-{alpha}, a proinflammatory cytokine produced within the injured vessel (40) and that increases PAPP-A production (35, 41), the proliferative effect of IGF-I/IGFBP-4 treatment was further enhanced when compared with WT cells that were not exposed to TNF-{alpha}. These data are consistent with the role of PAPP-A in modulating acute IGF-I bioavailability through cleavage of IGFBP-4 (27, 28, 30, 31, 32, 35, 41), although they do not rule out other possible substrates of PAPP-A or other functions not as yet identified. Indeed, PAPP-A has been shown to cleave IGFBP-5 in vitro (37). However, the physiological relevance is unclear, especially given that there are several IGFBP-5 proteases (50, 51, 52, 53).

In the restenosis response to vascular injury, the immediate thrombosis and inflammation is followed by activation of SMC migration into the intima, proliferation, and subsequent production of extracellular matrix (1, 2, 3, 4). PAPP-A mRNA expression was markedly elevated in the injured vessel 7–14 d after unilateral carotid ligation in WT mice. This increase in expression preceded and paralleled the active phase of neointimal hyperplasia in this model. Indeed, in WT mice, neointimal area increased 5-fold between 14 and 28 d after the injury, and at 28 d many of the vessels were occluded with SMC and extracellular matrix. Thus, the increase in PAPP-A mRNA expression appears to be associated with the active phase of neointimal formation, rather than with the early thrombotic phase. This may explain the presence of some neointima in PAPP-A–/– vessels at 14 d, equivalent to that in WT. Although PAPP-A mRNA and not protein was measured in these experiments (there are no specific murine antibodies against PAPP-A available at present), a similar time course of immunostaining for PAPP-A protein was seen in a porcine model of restenosis (28). Direct evidence for a role of PAPP-A in the vascular injury response was the finding in the present study that PAPP-A-deficient mice were resistant to progressive neointimal formation in response to vascular injury. It should be noted that carotid ligation elicits not only neointimal formation but also negative vessel remodeling (43, 44), the extent of which depends on the strain of mice (54). The medial area was not significantly different in the injured vessels between WT and PAPP-A–/– mice, suggesting that whatever remodeling was occurring, it was not differentially contributing to the narrowing of the lumen. Migration is difficult to assess in vivo, and a decrease in SMC number in the media could be due to migration of the cells into the intima or to apoptosis (55). However, a decrease in proliferating SMCs in the media and neointima of PAPP-A–/– compared with WT carotids was clearly indicated by PCNA staining.

Although PAPP-A has been shown to be important in regulating IGF bioavailability during fetal development (32, 56), these data are the first to show direct involvement of PAPP-A in the postnatal regulation of IGF bioavailability in vivo, as assessed by regulation of the IGF-responsive gene, IGFBP-5 (45, 46, 47, 48, 49). Several previous lines of evidence suggested the importance of the regulation of IGF-I bioavailability in the response to vascular injury. Wang et al. (6) reported that overexpression of IGF-I in mice using a smooth muscle-specific promoter led to organ remodeling and vascular overgrowth. Additionally, when these animals underwent carotid injury, they exhibited an increased rate of neointimal formation (57). When this same group expressed a protease-resistant form of IGFBP-4 specifically in smooth muscle cells, vascular hypotrophy was observed (26). Protease-resistant IGFBP-4 has been a valuable tool for evaluating the role of proteolysis in IGF-I action (24, 58). Whereas previous studies provided important insight into the dynamics of IGF and IGFBP interactions and regulation of IGF bioavailability when one component was exaggerated, this study provides direct evidence for a role of an IGFBP protease in neointimal formation under "normal" injury conditions in which both IGF-I and IGFBP-4 are up-regulated coordinately (Fig. 6Go).

In summary, we propose that after vascular insults increased PAPP-A production within the vessel wall increases local IGF bioavailability via cleavage of IGFBP-4. This role of PAPP-A may be part of the normal repair process, as seen in wound healing (59), or may be dysregulated, possibly in those 30–40% of angioplasty procedures that result in the restenosis of the vessel. Therefore, PAPP-A may provide a novel target of therapeutic intervention for excessive SMC proliferation and migration, hallmarks of a number pathophysiological conditions observed in cardiovascular medicine.


    Acknowledgments
 
We thank Laurie Bale, Sean Harrington, and Tyra Witt for excellent technical assistance and Kimberly Kalli, Ph.D., for critiquing the manuscript.


    Footnotes
 
Current address for Z.T.R.: University of Missouri, D110A Diabetes Center, One Hospital Drive, Columbia, Missouri 65211. E-mail: reschz{at}health.missouri.edu.

Current address for R.D.S.: Mayo Clinic, 200 First Street Southwest, Guggenheim 942B, Rochester, Minnesota 55905. E-mail: simari.robert{at}mayo.edu.

This work was supported by grants from the American Heart Association (0225543Z to Z.T.R. and 01-51292Z to C.A.C.).

There is nothing to declare by any of the authors.

First Published Online September 7, 2006

Abbreviations: AoSMCs, Primary SMCs isolated from aorta; CM, conditioned medium; FBS, fetal bovine serum; HBSS, Hanks’ balanced salt solution; IEL, internal elastic lamina; IGFBP, IGF binding protein; PAPP-A, pregnancy-associated plasma protein A; SMA, smooth muscle actin; SMC, smooth muscle cell; WT, wild type.

Received April 17, 2006.

Accepted for publication August 30, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schwartz SM, deBlois D, O’Brien ER 1995 The intima. Soil for atherosclerosis and restenosis. Circ Res 77:445–465[Free Full Text]
  2. Bennett MR, O’Sullivan M 2001 Mechanisms of angioplasty and stent restenosis: implications for design of rational therapy. Pharmacol Ther 91:149–166[CrossRef][Medline]
  3. Newby AC, Zaltsman AB 2000 Molecular mechanisms in intimal hyperplasia. J Pathol 190:300–309[CrossRef][Medline]
  4. Casterella PJ 2001 Restenosis: an overview. Front Radiat Ther Oncol 35:147–171[Medline]
  5. Khorsandi M, Fagin JA, Fishbein MC, Forrester JS, Cercek B 1992 Effects of hypophysectomy on vascular insulin-like growth factor-I gene expression after balloon denudation in rats. Atherosclerosis 93:115–122[CrossRef][Medline]
  6. Wang J, Niu W, Nikiforov Y, Naito S, Chernausek S, Witte D, LeRoith D, Strauch A, Fagin JA 1997 Targeted overexpression of IGF-I evokes distinct patterns of organ remodeling in smooth muscle cell tissue beds of transgenic mice. J Clin Invest 100:1425–1439[Medline]
  7. Hayry P, Myllarniemi M, Aavik E, Alatalo S, Aho P, Yilmaz S, Raisanen-Sokolowski A, Cozzone G, Jameson BA, Baserga R 1995 Stabile D-peptide analog of insulin-like growth factor-1 inhibits smooth muscle cell proliferation after carotid ballooning injury in the rat. FASEB J 9:1336–1344[Abstract]
  8. Grant MB, Wargovich TJ, Ellis EA, Tarnuzzer R, Caballero S, Estes K, Rossing M, Spoerri PE, Pepine C 1996 Expression of IGF-I, IGF-I receptor and IGF binding proteins-1, -2, -3, -4 and -5 in human atherectomy specimens. Regul Pept 67:137–144[CrossRef][Medline]
  9. Bayes-Genis A, Conover CA, Schwartz RS 2000 The insulin-like growth factor axis: a review of atherosclerosis and restenosis. Circ Res 86:125–130[Abstract/Free Full Text]
  10. Imai Y, Moralez A, Andag U, Clarke JB, Busby Jr WH, Clemmons DR 2000 Substitutions for hydrophobic amino acids in the N-terminal domains of IGFBP-3 and -5 markedly reduce IGF-I binding and alter their biologic actions. J Biol Chem 275:18188–18194[Abstract/Free Full Text]
  11. Schwartz RS 1998 Pathophysiology of restenosis: interaction of thrombosis, hyperplasia, and/or remodeling. Am J Cardiol 81:14E–17E[CrossRef]
  12. Schwartz RS, Henry TD 2002 Pathophysiology of coronary artery restenosis. Rev Cardiovasc Med 3(Suppl 5):S4–S9
  13. Bayes-Genis A, Schwartz RS, Bale LK, Conover CA 2003 Effects of insulin-like growth factor-I on cultured human coronary artery smooth muscle cells. Growth Horm IGF Res 13:246–253[CrossRef][Medline]
  14. Le Roith D 2003 The insulin-like growth factor system. Exp Diabesity Res 4:205–212[Medline]
  15. Duan C 2002 Specifying the cellular responses to IGF signals: roles of IGF-binding proteins. J Endocrinol 175:41–54[Abstract]
  16. Baxter RC 2000 Insulin-like growth factor (IGF)-binding proteins: interactions with IGFs and intrinsic bioactivities. Am J Endocrinol Metab 278:E967–E976
  17. Conover CA 1999 Posttranslational modification of the IGF binding proteins. In: Rosenfeld R, Roberts Jr C, eds. Contemporary endocrinology: the IGF system. Totawa, NJ: Humana Press; 355–376
  18. Bunn RC, Fowlkes JL 2003 Insulin-like growth factor binding protein proteolysis. Trends Endocrinol Metab 14:176–181[CrossRef][Medline]
  19. Clemmons DR 1998 Role of insulin-like growth factor binding proteins in controlling IGF actions. Mol Cell Endocrinol 140:19–24[CrossRef][Medline]
  20. Delafontaine P, Song YH, Li Y 2004 Expression, regulation, and function of IGF-1, IGF-1R, and IGF-1 binding proteins in blood vessels. Arterioscler Thromb Vasc Biol 24:435–444[Abstract/Free Full Text]
  21. Gustafsson T, Andersson P, Chen Y, Magnusson JO, Arnqvist HJ 1999 Interaction of angiotensin II and the insulin-like growth factor system in vascular smooth muscle cells. Am J Physiol 277:H499–H507
  22. Kamyar A, Pirola CJ, Wang HM, Sharifi B, Mohan S, Forrester JS, Fagin JA 1994 Expression and insulin-like growth factor-dependent proteolysis of insulin-like growth factor-binding protein-4 are regulated by cell confluence in vascular smooth muscle cells. Circ Res 74:576–585[Abstract/Free Full Text]
  23. Conover CA, Kiefer MC, Zapf J 1993 Posttranslational regulation of insulin-like growth factor binding protein-4 in normal and transformed human fibroblasts. Insulin-like growth factor dependence and biological studies. J Clin Invest 91:1129–1137[Medline]
  24. Rees C, Clemmons DR, Horvitz GD, Clarke JB, Busby WH 1998 A protease-resistant form of insulin-like growth factor (IGF) binding protein 4 inhibits IGF-1 actions. Endocrinology 139:4182–4188[Abstract/Free Full Text]
  25. Hsieh T, Gordon RE, Clemmons DR, Busby Jr WH, Duan C 2003 Regulation of vascular smooth muscle cell responses to insulin-like growth factor (IGF)-I by local IGF-binding proteins. J Biol Chem 278:42886–42892[Abstract/Free Full Text]
  26. Zhang M, Smith EP, Kuroda H, Banach W, Chernausek SD, Fagin JA 2002 Targeted expression of a protease-resistant IGFBP-4 mutant in smooth muscle of transgenic mice results in IGFBP-4 stabilization and smooth muscle hypotrophy. J Biol Chem 277:21285–21290[Abstract/Free Full Text]
  27. Lawrence JB, Bale LK, Haddad TC, Clarkson JT, Conover CA 1999 Characterization and partial purification of the insulin-like growth factor (IGF)-dependent IGF binding protein-4-specific protease from human fibroblast conditioned media. Growth Horm IGF Res 9:25–34[Medline]
  28. Bayes-Genis A, Schwartz RS, Lewis DA, Overgaard MT, Christiansen M, Oxvig C, Ashai K, Holmes Jr DR, Conover CA 2001 Insulin-like growth factor binding protein-4 protease produced by smooth muscle cells increases in the coronary artery after angioplasty. Arterioscler Thromb Vasc Biol 21:335–341[Abstract/Free Full Text]
  29. Boldt HB, Overgaard MT, Laursen LS, Weyer K, Sottrup-Jensen L, Oxvig C 2001 Mutational analysis of the proteolytic domain of pregnancy-associated plasma protein-A (PAPP-A): classification as a metzincin. Biochem J 358:359–367[CrossRef][Medline]
  30. Byun D, Mohan S, Yoo M, Sexton C, Baylink DJ, Qin X 2001 Pregnancy-associated plasma protein-A accounts for the insulin-like growth factor (IGF)-binding protein-4 (IGFBP-4) proteolytic activity in human pregnancy serum and enhances the mitogenic activity of IGF by degrading IGFBP-4 in vitro. J Clin Endocrinol Metab 86:847–854[Abstract/Free Full Text]
  31. Ortiz CO, Chen BK, Bale LK, Overgaard MT, Oxvig C, Conover CA 2003 Transforming growth factor-ß regulation of the insulin-like growth factor binding protein-4 protease system in cultured human osteoblasts. J Bone Miner Res 18:1066–1072[CrossRef][Medline]
  32. Conover CA, Bale LK, Overgaard MT, Johnstone EW, Laursen UH, Fuchtbauer EM, Oxvig C, Van Deursen J 2004 Metalloproteinase pregnancy-associated plasma protein A is a critical growth regulatory factor during fetal development. Development 131:1187–1194[Abstract/Free Full Text]
  33. Moon SK, Thompson LJ, Madamanchi N, Ballinger S, Papaconstantinou J, Horaist C, Runge MS, Patterson C 2001 Aging, oxidative responses, and proliferative capacity in cultured mouse aortic smooth muscle cells. Am J Physiol Heart Circ Physiol 280:H2779–H2788
  34. Wang Y, Kovanen PT 1999 Heparin proteoglycans released from rat aerosal mast cells inhibit proliferation of rat aortic smooth muscle cells in culture. Circ Res 84:74–83[Abstract/Free Full Text]
  35. Resch ZT, Chen BK, Bale LK, Oxvig C, Overgaard MT, Conover CA 2004 Pregnancy-associated plasma protein-A gene expression as a target of inflammatory cytokines. Endocrinology 145:1124–1129[Abstract/Free Full Text]
  36. Qin X, Byun D, Lau K-HW, Baylink DJ, Mohan S Evidence that the interaction between insulin-like growth factor (IGF)-II and IGF binding protein (IGFBP)-4 is essential for the action of the IGF-II-dependent IGFBP-4 protease. Arch Biochem Biophys 379:209–216
  37. Laursen LS, Overgaard MT, Rikke S, Boldt HB, Sottrup-Jensen L, Giudice LC, Conover CA, Oxvig C 2001 Pregnancy-associated plasma protein-A (PAPP-A) cleaves insulin-like growth factor binding protein (IGFBP)-5 independent of IGF: implications for the mechanism of IGFBP-4 proteolysis by PAPP-A. FEBS Lett 504:36–50[CrossRef][Medline]
  38. Kumar A, Lindner V 1997 Remodeling with neointima formation in the mouse carotid artery after cessation of blood flow. Arterioscler Thromb Vasc Biol 17:2238–2244[Abstract/Free Full Text]
  39. Smith EP, Kamyar A, Niu W, Wang J, Cercek B, Chernausek SD, Fagin JA 2001 IGF-binding protein-4 expression and IGF-binding protein-4 protease activity are regulated coordinately in smooth muscle during postnatal development and after vascular injury. Endocrinology 142:4420–4427[Abstract/Free Full Text]
  40. Monraats PS, Pires NMM, Schepers A, Agema WRP, Boesten LSM, de Vries MR, Zwinderman AH, de Maat MPM, Doevendans PAFM, de Winter RJ, Tio RA, Waltenberger J, t’Hart LM, Frants RR, Quax PHA, van Vlijmen BJM, Havekes LM, van der Laarse A, van der Wall EE, Jukema JW 2005 Tumor necrosis factor-{alpha} plays an important role in restenosis development. FASEB J 19:1998–2004[CrossRef][Medline]
  41. Conover CA, Bale LK, Harrington SC, Resch ZT, Overgaard MT, Oxvig C 2006 Cytokine stimulation of pregnancy associated plasma protein-A expression in human coronary artery smooth muscle cells: inhibition by resveratrol. Am J Physiol 290:C183–C188
  42. Beukers MW, Oh Y, Zhang H, Ling N, Rosenfeld RG 1991 [Leu27] insulin-like growth factor II is highly selective for the type-II IGF receptor in binding, cross-linking and thymidine incorporation experiments. Endocrinology 128:1201–1203[Abstract/Free Full Text]
  43. de Waard V, Arkenbout EK, Carmeliet P, Lindner V, Pannekoek H 2002 Plasminogen activator inhibitor 1 and vitronectin protect against stenosis in a murine carotid artery ligation model. Arterioscler Thromb Vasc Biol 22:1978–1983[Abstract/Free Full Text]
  44. Kumar A, Hoover JL, Simmons CA, Lindner V, Shebuski RJ 1997 Remodeling and neointimal formation in the carotid artery of normal and P-selectin-deficient mice. Circulation 96:4333–4342[Abstract/Free Full Text]
  45. Conover CA, Clarkson JT, Bale LK 1995 Effect of glucocorticoid on insulin-like growth factor (IGF) regulation of IGF-binding protein expression in fibroblasts. Endocrinology 136:1403–1410[Abstract]
  46. Duan C, Hawes SB, Prevette T, Clemmons DR 1996 Insulin-like growth factor-I (IGF-I) regulates IGF-binding protein-5 synthesis through transcriptional activation of the gene in aortic smooth muscle cells. J Biol Chem 271:4280–4288[Abstract/Free Full Text]
  47. Fleming JM, Leibowitz BJ, Kerr DE, Cohick WS 2005 IGF-I differentially regulates IGF-binding protein expression in primary mammary fibroblasts and epithelial cells. J Endocrinol 186:165–178[Abstract/Free Full Text]
  48. Adamo ML, Ma X, Ackert-Bicknell CL, Donahue LR, Beamer WG, Rosen CJ 2006 Genetic increase in serum insulin-like growth factor-I (IGF-I) in C3H/HeJ compared with C57BL/6J mice is associated with increased transcription from the IGF-I exon 2 promoter. Endocrinology 147:2944–2955[Abstract/Free Full Text]
  49. Nichols TC, du Laney T, Zheng B, Bellinger DA, Nickols GA, Engleman W, Clemmons DR 1999 Reduction in atherosclerotic lesion size in pigs by {alpha}Vß3 inhibitors is associated with inhibition of insulin-like growth factor-I-mediated signaling. Circ Res 85:1040–1045[Abstract/Free Full Text]
  50. Campbell PG, Andress DL 1997 Plasma degradation of insulin-like growth factor-binding protein-5 (IGFBP-5): regulation by IGFBP-5-(201–218). Am J Physiol 36:E996–E1004
  51. Zheng B, Clarke JB, Busby WH, Duan C, Clemmons DR 1998 Insulin-like growth factor-binding protein-5 is cleaved by physiological concentrations of thrombin. Endocrinology 139:1708–1714[Abstract/Free Full Text]
  52. Busby Jr WH, Nam T-J, Moralez A, Smith C, Jennings M, Clemmons DR 2000 The complement component C1s is the protease that accounts for cleavage of insulin-like growth factor-binding protein-5 in fibroblast medium. J Biol Chem 275:37638–37644[Abstract/Free Full Text]
  53. Mohan S, Thompson GR, Amaar YG, Hathaway G, Tschesche H, Baylink DJ 2002 ADAM-9 is an insulin-like growth factor binding protein-5 protease produced and secreted by human osteoblasts. Biochemistry 41:15394–15403[CrossRef][Medline]
  54. Harmon KJ, Couper LL, Lindner V 2000 Strain-dependent vascular remodeling phenotypes in inbred mice. Am J Pathol 156:1741–1748[Abstract/Free Full Text]
  55. Choi ET, Khan MF, Leidenfrost JE, Collins ET, Boc KP, Villa BR, Novack DV, Parks WC, Abendschein DR 2004 ß3-Integrin mediates smooth muscle cell accumulation in neointima after carotid ligation in mice. Circulation 109:1564–1569[Abstract/Free Full Text]
  56. Bale LK, Conover CA 2005 Disruption of insulin-like growth factor-II imprinting during embryonic development rescues the dwarf phenotype of mice null for pregnancy-associated plasma protein-A. J Endocrinol 186:325–331[Abstract/Free Full Text]
  57. Zhu B, Zhao G, Witte DP, Hui DY, Fagin JA 2001 Targeted overexpression of IGF-I in smooth muscle cells of transgenic mice enhances neointimal formation through increased proliferation and cell migration after intraarterial injury. Endocrinology 142:3598–3606[Abstract/Free Full Text]
  58. Qin X, Byun D, Strong DD, Baylink DJ, Mohan S 1999 Studies on the role of human insulin-like growth factor-II (IGF-II)-dependent IGF binding protein (hIGFBP)-4 protease in human osteoblasts using protease-resistant IGFBP-4 analogs. J Bone Miner Res 14:2079–2088[CrossRef][Medline]
  59. Chen BK, Leiferman KM, Pittelkow MR, Overgaard MT, Oxvig C, Conover CA 2003 Localization and regulation of pregnancy-associated plasma protein a expression in healing human skin. J Clin Endocrinol Metab 88:4465–4471[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
T. C. Nichols, W. H. Busby Jr., E. Merricks, J. Sipos, M. Rowland, K. Sitko, and D. R. Clemmons
Protease-Resistant Insulin-Like Growth Factor (IGF)-Binding Protein-4 Inhibits IGF-I Actions and Neointimal Expansion in a Porcine Model of Neointimal Hyperplasia
Endocrinology, October 1, 2007; 148(10): 5002 - 5010.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
E. Grad, M. Golomb, I. Mor-Yosef, N. Koroukhov, C. Lotan, E. R. Edelman, and H. D. Danenberg
Transgenic expression of human C-reactive protein suppresses endothelial nitric oxide synthase expression and bioactivity after vascular injury
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H489 - H495.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
S. C. Harrington, R. D. Simari, and C. A. Conover
Genetic Deletion of Pregnancy-Associated Plasma Protein-A Is Associated With Resistance to Atherosclerotic Lesion Development in Apolipoprotein E-Deficient Mice Challenged With a High-Fat Diet
Circ. Res., June 22, 2007; 100(12): 1696 - 1702.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
B. S Miller, J. T Bronk, T. Nishiyama, H. Yamagiwa, A. Srivastava, M. E Bolander, and C. A Conover
Pregnancy associated plasma protein-A is necessary for expeditious fracture healing in mice
J. Endocrinol., March 1, 2007; 192(3): 505 - 513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Resch, Z. T.
Right arrow Articles by Conover, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Resch, Z. T.
Right arrow Articles by Conover, C. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals