help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0867
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/12/6019    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Noon, L. A.
Right arrow Articles by King, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Noon, L. A.
Right arrow Articles by King, P. J.
Endocrinology Vol. 147, No. 12 6019-6026
Copyright © 2006 by The Endocrine Society

A CCAAT/Enhancer-Binding Protein Site at –87 Is Required for the Activation of a Novel Murine Melanocortin 2-Receptor Promoter at Late Stages during Adipogenesis

Luke A. Noon, Adrian J. L. Clark, Peter J. O’Shaughnessy and Peter J. King

Molecular Endocrinology Centre (L.A.N., A.J.L.C., P.J.K.), William Harvey Research Institute, Bart’s and The London, Queen Mary, University of London, London EC1M 6BQ, United Kingdom; and Institute of Comparative Medicine (P.J.O.), University of Glasgow Veterinary School, Glasgow G61 1QH, Scotland, United Kingdom

Address all correspondence and requests for reprints to: Dr. Peter King, Molecular Endocrinology Centre, William Harvey Research Institute, Charterhouse Square, Bart’s and The London, Queen Mary, University of London, London EC1M 6BQ, United Kingdom. E-mail: p.j.king{at}qmul.ac.uk


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The peptide hormone ACTH stimulates lipolysis and suppresses leptin production in adipocytes via the G protein-coupled receptor, melanocortin 2 receptor (MC2-R). We have shown previously that peroxisome proliferator-activated receptor-{gamma}2 is the primary factor responsible for transactivation of the already identified murine MC2-R promoter in the differentiating 3T3-L1 adipocyte cell line. In this study we show that despite the activity of this promoter being transient during differentiation, MC2-R message remains elevated at later time points during adipogenesis. Analysis of the late transcripts reveals that they initiate from a transcriptional start site in the first intron of the murine MC2-R. The genomic sequence upstream of this start site acts as an adipocyte-specific promoter whose activation is delayed in differentiation, compared with the upstream promoter. A CCAAT/enhancer-binding protein binding site, 87 bp upstream of the transcriptional initiation site, is necessary for the activity of this promoter, and protein binding analyses reveal that this site is bound by CCAAT/enhancer-binding protein factors. Real-time PCR analysis of mRNA initiating from the two start sites shows that there is a switch in promoter usage from the 5' to the 3' promoter around d 5, indicating the complex regulation of the murine MC2-R during adipogenesis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE MELANOCORTIN 2 RECEPTOR (MC2-R) is a seven-transmembrane G protein-coupled receptor that signals primarily through the cAMP pathway. The MC2-R exclusively binds the anterior pituitary-derived, proopiomelanocortin product ACTH and regulates glucocorticoid output from the adrenal cortex in the hypothalamo-pituitary-adrenal axis (1). Outside the adrenal cortex, MC2-R expression has been described in a growing number of locations in which the role of the receptor has been less well characterized. In the adult, the main nonadrenal site of MC2-R expression is in the murine adipocyte (2, 3) in which ACTH has been shown to stimulate lipolysis to release free fatty acids from triglyceride stores (4, 5) and also inhibit leptin production, indicating a role for MC2-R in the control of body fat content (6). More recently it has been shown that there is also detectable MC2-R expression in murine fetal testes and that ACTH is able to stimulate testosterone production in this tissue (7).

The murine MC2-R gene is located on chromosome 18 (3, 8) and contains five exons (9). The coding region is located entirely within exon 5 and multiple mRNAs are generated by alternative splicing of the 5' untranslated region (UTR) (9, 10). The region upstream of exon 1 has been shown to act as a promoter in murine adrenocortical Y1 cells (3), and the equivalent region in the human gene has also been shown to have promoter activity in Y1 and human adrenocortical H295R cells (11, 12, 13). We also investigated the regulation of the mMC2-R promoter in 3T3-L1 cells, a fibroblast cell line that can be induced to differentiate from a preadipocyte into an adipocyte phenotype (reviewed in Ref. 14). In brief, the addition of differentiation inducing agents to this cell line causes a defined series of events in which adipogenic transcription factors, notably CCAAT/enhancer-binding protein (C/EBP) family members and peroxisome proliferator-activated receptor (PPAR)-{gamma}2, are up-regulated. PPAR{gamma} and C/EBP{alpha} induce a large number of adipocyte genes, and the overexpression of either has been shown to be sufficient to promote differentiation (15, 16).

Our data (17) indicated that MC2-R mRNA synthesis is rapidly induced by the differentiating agents dexamethasone, insulin, and 3-isobutyl-1-methyl-xanthine in combination. This is a consequence of the transcriptional activation of the MC2-R proximal promoter through a peroxisome proliferator response element (PPRE), a binding element for PPAR{gamma}2. However, we noted that the promoter activation during differentiation appeared to be transient, whereas the mRNA expression (as judged by PCR of the coding exon) remained elevated. We mapped the 5' ends of these transcripts by 5' rapid amplification of cDNA ends (RACE) and shown that during differentiation there is a switch in activity between the previously characterized promoter and a novel adipocyte-specific promoter located within the first intron of the murine gene, which is activated at late times during differentiation after the decline in activity of the upstream promoter. The prolonged expression of the coding exon of the MC2-R during 3T3-L1 differentiation is therefore a consequence of the sequential activation of these two promoters. Analysis of the novel promoter indicates that a C/EBP site at –87 is necessary for its activity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture
3T3-L1 preadipocytes (American Type Culture Collection, Manassas, VA) were maintained in DMEM, 10% fetal bovine serum (Sigma, St. Louis, MO) at 37 C with 5% CO2 and differentiated by treating 2-d postconfluent cells (d 0) with media containing 0.5 mM 3-isobutyl-1-methyl-xanthine, 0.25 µM dexamethasone, and 1 µg/ml insulin for 2 d. On d 2 the media were replaced with DMEM and 10% fetal bovine serum containing insulin (1 µg/ml) for a further 48 h before returning the cells to normal cell culture conditions.

RT-PCR
RNA was harvested from 3T3-L1 cells grown in six-well plates using the RNeasy miniprep kit (QIAGEN, Valencia, CA) and extracted from adult and fetal (embryonic d 17.5) mouse (derived from F1 hybrids of C3H/HeH and 101/H strains) tissues using Trizol (Life Technologies, Grand Island, NY) according to the manufacturer’s guidelines. Two micrograms RNA were DNase treated at 37 C for 15 min before reverse transcriptase (RT), which was performed at 37 C for 1 h using Moloney murine leukemia virus-RT and random hexamers (Promega, Madison, WI). PCRs were performed using the cDNA equivalent of 50 ng RNA. The following primer sequences (SigmaGenosys, Haverhill, UK) were used: MC2-R exon 1 forward (CTTGCCGAGAAAGATCCT), exon 1* forward (ACACACCAATGACACCGC), exon 4/5 intron spanning, reverse (GGATCTGGCTTAGAAGGG), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) forward, reverse (TGCACCACCAACTGCTTAG, GGATGCAGGGATGATGTTC).

Quantitative PCR
Quantitative PCR was performed using SYBR green (Molecular Probes, Eugene, OR) and an MX4000 real-time PCR machine (Stratagene, La Jolla, CA). SYBR green fluorescence was quantified using a serial dilution of template-containing plasmid or PCR product of known concentration and relative abundance of transcript was normalized against GAPDH. The following primer sequences were used (forward, reverse), MC2-R exon 1 (AGTGATGTATATGTTCCGG, CTTCAGCTCTGAAGTAGG), MC2-R exon 1* (ACGAAATCTGTGAGGTTGC, AGTTTCTGCCCTCCCTTG), MC2-R exon 5 (TTGCAGCTGACCGTTACATCA, CGGCGCATGGTCACAA), and GAPDH as above.

5' RACE
The GeneRacer kit (Invitrogen, Carlsbad, CA) was used to generate cDNA with full-length5' ends according to the maunfacturer’s instructions. Briefly, total RNA isolated from d 16 3T3-L1 adipocytes was treated with calf intestinal phosphatase to remove the 5' phosphate of non-full-length RNA molecules. A 44-bp RNA oligonucleotide was ligated to decapped full-length molecules, and these mRNAs were then reverse transcribed into cDNA using an MC2-R gene-specific primer (GSP) (CCTTGGAAGCAGCAGAATCATTTGTG) using SuperScript III reverse transcriptase (Invitrogen). After RT the reaction was incubated with 1 µl RNase H (2 U/µl; Invitrogen) at 37 C for 20 min. The cDNA was amplified by nested PCR using the oligo-specific primers provided with the kit and the GSP above for first round of PCR followed by a second, 5' GSP (CCAAGACATCCATCAACTGATGAGTGG) as the nested 3' PCR primer. The resulting band was gel purified and subcloned into pCR4-TOPO (Invitrogen) and the inserts were sequenced.

Plasmids and constructs
The extensor long PCR kit (Advanced Biotechnologies, Columbia, MD) was used to amplify murine genomic DNA containing the upstream and downstream MC2-R promoters according to the manufacturer’s instructions. The fragment contained sequences from –910 of the upstream promoter to +146* of the downstream promoter. The forward primer (AAAGGTACCGAGTCCAGAGAAGGTCAGTG) and reverse primer (AAAAGATCTCCAGTTTCTGCCCTCCCTTG) incorporated KpnI and BglII sites, respectively, which were used to subclone the fragment into the promoterless luciferase vector pGL3 (Promega). 5' deletions were created by linearizing this construct with Asp718 and treating with exonuclease III. Deleted products were blunt ended with mung bean nuclease, ligated to MluI linkers and ligated back into pGL3 as MluI/BglII fragments to create a 5' deletion series with the structure pMC2-R[–x*/+146*]pGL3 (relative to the downstream promoter initiation site). Site-directed mutagenesis, converting the sequence at –87* from ATTGAGCAAC to ATAGAGCTAC, was performed using the QuikChange protocol (Stratagene). To distinguish between the two transcriptional start sites, numbering relative to the upstream start site is shown throughout as normal (e.g. –910) and that relative to the downstream transcriptional start site is denoted by an asterisk (e.g. –87*).

Transfections
Stable transfections.
The 3T3-L1 cell line stably harboring the pMC2-R[–2340*/+146*]GL3 reporter was created by transfecting 10 µg plasmid DNA along with 0.5 µg pcDNA3.1 (Invitrogen), which confers resistance to G418S (Geneticin; Invitrogen), using the calcium phosphate precipitation transfection. Cells were selected and maintained in media containing 500 µg/ml G418S, and the resulting colonies were pooled to produce polyclonal cell cultures.

Electroporation of 3T3-L1 cells.
3T3-L1 cells were differentiated in 10-cm dishes, trypsinized, pelleted, and resuspended in 0.5 ml PBS per dish. The resuspended cells were placed in electroporation cuvettes with 30 µg promoter construct and 3 µg pCMV-RL (Promega) as a transfection control. The cells were electroporated in a PG 200 Progenetor II electroporator (Hoefer Scientific Instruments, San Francisco, CA) at 160 V and 980 µF. After 10 min recovery at room temperature, the cells were added to 10 ml DMEM/10% fetal calf serum in collagen-coated 10-cm dishes and incubated for a further 48 h before harvesting.

Reporter assays
Luciferase was measured using the dual-luciferase reporter assay (Promega). Cell lysates were prepared according to the manufacturer’s instructions, and luciferase activity was measured using a BioOrbit 1253 luminometer (LabTech International, Christchurch, New Zealand). Reporter activity for stable transfections was calculated by normalizing the reporter luciferase value with the protein content of the extract, assessed by the Bradford assay (Bio-Rad Laboratories, Hemel Hempstead, UK) and for transient transfections was calculated by normalizing the reporter luciferase value with that of the renilla luciferase expressed from the control vector.

EMSA
Probes were created by filling in the 5' overhangs of the annealed complementary oligonucleotides with Klenow DNA polymerase using a mixture of dATP, dGTP, dTTP, and {alpha}32P dCTP. Nuclear extracts were prepared by Nonidet P-40-mediated cytoplasmic lysis (18), and EMSA was performed using 10 µg extract per reaction as previously described (19) using 3 µg poly(dI.dC).poly(dI.dC) as competitor (Amersham, Aylesbury, UK). Supershifts were performed by extending the initial incubation to 1 h on ice in the presence of 2 µl of rabbit preimmune serum, C/EBP{alpha} or C/EBPß antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Complexes were electrophoresed on a 5% native acrylamide gel, dried, and visualized by autoradiography. Oligonucleotide sequences (SigmaGenosys) used were (overhang in lower case): –87 C/EBP upper strand, gatcATTGAGCAAC, and C/EBP consensus upper strand, gatcATTGCGCAAT.

Chromatin immunoprecipitation (ChIP)
ChIP was performed on d 10 3T3-L1 cells essentially as described (20) with one modification. After cross-linking, the cells were resuspended in buffer A (21), incubated on ice for 5 min, and centrifuged in a microfuge for 2 min after the addition of Nonidet P-40 to a final concentration of 0.125%. The pelleted nuclei were then lysed according to the ChIP protocol and immunoprecipitated with rabbit preimmune serum, anti-C/EBP{alpha}, or anti-C/EBPß (Santa Cruz). After reversal of the cross-linking and DNA purification, the immunoprecipitated genomic DNA was amplified by PCR using primers spanning the C/EBP site: forward, CCTTGAGCCAGACTGGAAAG, reverse, TTGCAACCTCACAGATTTCG (243 bp product). As a specificity control, the same samples were also amplified using primers specific to the coding exon, exon 5: forward primer, TCGTGATTTCTGTAAGTC, reverse, GACCTGGAAGAGAGACATGTAG (843-bp product). Ten percent of input DNA was used as a positive control for PCR.

Statistical analysis
ANOVA was performed as appropriate followed by Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Analysis of MC2-R mRNA production during a time course of 3T3-L1 differentiation
We have shown previously that MC2-R mRNA is rapidly detectable after addition of induction media to 3T3-L1 cells and that this was accompanied by up-regulation of MC2-R promoter activity. However, this promoter activity was transient, peaking on d 3 and declining to near basal levels by d 5, even though it appeared that the mRNA remained elevated at this time (17). To confirm the transient nature of the promoter activation, we performed real-time PCR analysis on a longer time course of 3T3-L1 differentiation. Cells were differentiated for 14 d, and RNA was prepared throughout the time course. Figure 1AGo shows the results of real-time RT-PCR using primers within exon 1. Confirming our previous results, there is no detectable MC2-R mRNA in untreated 3T3-L1 cells, but exon 1-specific message is expressed after commencement of differentiation. This message peaks on d 3 and then declines so that no exon 1-containing PCR product is detectable by d 14. These observations mirror the previously reported activity of a –1805/+105 MC2-R promoter construct (17). However, when coding exon 5-specific primers are used, although there is an early peak of expression on d 3, maximal expression is observed from d 7 to d 14 (Fig. 1BGo).


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Analysis of MC2-R mRNA expression during differentiation of 3T3-L1 cells. 3T3-L1 cells were differentiated and mRNA was harvested for up to more than 14 d. Real-time PCR was performed as described in Experimental procedures. A, Real-time PCR of MC2-R expression in differentiating 3T3-L1 cells using exon 1-specific primers is shown as a histogram. The expression levels are corrected for GAPDH. B, Real-time PCR of MC2-R expression in differentiating 3T3-L1 cells using exon 5-specific primers is shown as a histogram. The expression levels are corrected for GAPDH. These experiments were conducted three times and the data shown as the mean ± SE.

 
MC2-R transcription at late time points during differentiation initiates from a downstream site
Clearly at late time points during the differentiation process, when exon 5-containing MC2-R message is most abundant, these transcripts do not contain exon 1. This implies that the transcripts are being synthesized from an alternative transcriptional start site(s). To locate the 5' end of these late time point messages, a 5' RACE analysis of RNA from d 16 3T3-L1 adipocytes was conducted, and the resulting full-length products were isolated and subcloned. Six clones were sequenced, and all contained the 5' adapter followed by a 146-bp sequence upstream of exon 2 of MC2-R. This sequence maps within the 7-kb intron separating exons 1 and 2 of the murine MC2-R gene. Figure 2AGo shows the location of this alternative first exon, referred to as exon 1*, 1.4 kb downstream of exon 1. The PPRE in the 5' promoter and a putative C/EBP binding site observed upstream of exon 1* are depicted. The sequence of exon 1* is shown in Fig. 2BGo aligned to a homologous region within the first intron of the rat MC2-R gene.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 2. MC2-R transcription at later times during differentiation initiates from a downstream exon. A, An alternative first exon was identified by performing 5' RACE on mRNA from d 16 3T3-L1 adipocytes. The diagram shows the organization of the two transcriptional initiation sites, depicted by arrows. The upper figures, marked with a star (*) give the coordinates relative to the downstream initiation site, and the lower figures give the coordinates relative to the upstream initiation site. The PPRE in the upstream promoter and the putative C/EBP site in the downstream promoter are indicated. The diagram is not to scale. B, The sequence of the [murine (M)] alternative first exon, exon 1*, is shown, aligned to a homologous region from the rat MC2-R gene (R). C, Real-time PCR of MC2-R expression in differentiating 3T3-L1 cells using exon 1*-specific primers is shown as a histogram. The expression levels are corrected for GAPDH. This experiment was conducted three times and the data shown as the mean ± SE.

 
Primers specific for exon 1* were used in real-time PCR to analyze the expression from this alternative start site during 3T3-L1 differentiation. As expected, there is no detectable expression before induction of differentiation, but in contrast to the expression of exon 1-containing mRNA, exon 1*-containing message is induced more slowly, peaking at d 10 but remaining elevated at d 14 (Fig. 2CGo). By comparing the time courses of expression of exons 1 and 1*, it can be seen that the decline of exon 5 expression between d 3 and 4 corresponds to the decline in exon 1-containing message, which occurs before appreciable levels of exon 1* are detected. It therefore appears that at around d 5, there is a switch in the transcriptional start site, implying that a novel promoter is activated to drive transcription from the downstream start site. Inspection of the genomic sequences upstream of exon 1* indicates that the transcriptional start site lies within an initiator element with no TATA box present upstream. No consensus PPREs were observed in the intronic sequences between exon 1 and exon 1*, but two potential C/EBP sites were identified at –87* and –701*.

Exon1*-containing transcripts are detectable only in adipose tissues and cells
RT-PCR analysis (Fig. 3Go) of mRNA extracted from murine tissues previously shown to express MC2-R shows that whereas exon 1 can be detected in all the expressing tissues (adrenal, fat, fetal testis), it is much less strongly expressed in brown and white adipose tissue. Exon 1* can be detected only in adipose tissues and cells, indicating that the novel promoter is active only in these cell types.


Figure 3
View larger version (54K):
[in this window]
[in a new window]
 
FIG. 3. Expression of MC2-R from exon 1* is adipocyte specific. RT-PCR analysis of murine tissues and cells expressing MC2-R was performed using a reverse primer spanning the exon 4/5 boundary and forward primers specific for exon 1 (top panel) and exon 1* (middle panel). The lower panel shows GAPDH levels as a comparison. BAT, Brown adipose tissue; WAT, white adipose tissue.

 
Sequences within the first intron of the murine MC2-R act as a late-onset promoter during differentiation of 3T3-L1 cells
To demonstrate that the region of DNA upstream of exon 1* could act as a promoter a region containing 910 bp of the upstream promoter down to the end of exon 1* was subcloned into the reporter vector pGL3 (creating the construct pMC2-R[–2340*/+146*]GL3), and this construct was stably introduced into 3T3-L1 cells. In an analysis of a time course of differentiation of the resultant polyclonal cell line, it can be seen that although there is a small increase in luciferase expression in the early stages of differentiation between d 0 and 8, the main increase in expression occurs after d 8, peaking around d 10 and very sharply declining after that point (Fig. 4AGo). This shows that this DNA fragment can behave as a promoter with kinetics consistent with the late onset of transcriptional initiation observed in the RT-PCR analysis (Fig. 2CGo). The observed delay between the up-regulation of MC2-R message and the promoter activity may be a consequence of the greater sensitivity of the Q-PCR assay. An electroporation-based transient transfection assay was then used to confirm this result and compare the activity of this genomic fragment with the activity of the upstream promoter between d 6 and 13 of a differentiation time course. The downstream promoter construct pMC2-R[–2340*/+146*]GL3 was activated with transient kinetics between d 8 and 12, peaking on d 10, whereas the upstream promoter construct pMC2-R[–1805/+105]GL3 was inactive at all time points.


Figure 4
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 4. The genomic region upstream of exon 1* acts as a late-onset promoter during 3T3-L1 differentiation. A, A polyclonal 3T3-L1 cell line stably harboring pMC2-R[–2340*/+146*]GL3 was differentiated, and luciferase extracts were made for up to 17 d. The luciferase activity, normalized to protein concentration at each time point, is shown. B, 3T3-L1 cells were electroporated with the promoter construct pMC2-R[–2340*/+146*]GL3 (solid line) or the upstream promoter construct pMC2-R[–1805/+105]GL3 (dotted line) over a time course of differentiation 48 h before the time point when the cells were harvested and luciferase assays performed. The relative luciferase activity, normalized to renilla, is shown. In the cartoons of the constructs used (not to scale), exon 1 is shown as a gray box and exon 1* as a black box. RLU, Relative light units. These experiments were conducted three to five times and the data shown as the mean ± SE. Data were compared with empty vector pGL3, *, P < 0.05.

 
A C/EBP site at –87* is necessary for the activity of the downstream promoter
A 5' deletion series of the pMC2-R[–2340*/+146*]GL3 promoter construct was created to delineate the promoter regions required for this late activation of expression. The deletion series was transiently introduced into differentiating 3T3-L1 cells by electroporation, and luciferase activity was assayed on d 10 (Fig. 5Go). Deleting from –2340* to –147* failed to inactivate the promoter in these cells, indicating that sequences between –147* and +146* are capable of acting as a late-onset promoter during adipogenesis. This region contains a 9/10 match for a consensus C/EBP site [RTTGCGYAAY where R is A or G and Y is C or T (22)] between –87* and –78* (ATTGAGCAAC), and the introduction of two mutations into this site (shown previously to impair the ability to bind C/EBP proteins ((22) and data not shown) in the minimal promoter construct pMC2-R[–147*/+146*]GL3, pMC2-R[–483*/+146*]GL3 and the full-length construct pMC2-R[–2340*/+146*]GL3 reduced luciferase expression from all constructs to background levels (Fig. 6Go).


Figure 5
View larger version (17K):
[in this window]
[in a new window]
 
FIG. 5. 5' deletions to –147 do not inactivate the downstream promoter in d 10 3T3-L1 cells. Differentiating 3T3-L1 cells were electroporated on d 8 with pGL3, the upstream promoter construct pMC2-R[–1805/–105]GL3, the genomic fragment containing the downstream promoter pMC2-R[–2340*/+146*]GL3 and 5' deletions created from it and harvested on d 10. Luciferase was measured in cell extracts and normalized to renilla. Cartoons of the promoter constructs are shown to the left of the figure (not to scale). Exon 1 is shown as a gray box and exon 1* as a black box. RLU, Relative light units. This experiment was conducted three times and the data shown as the mean ± SE.

 

Figure 6
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 6. The C/EBP site at –87* is required for the downstream promoter activity in d 10 3T3-L1 cells. The C/EBP site at –87 was mutated from ATTGAGCAAC (wt) to ATAGAGCTAC (mut) in pMC2-R[–2340*/+146*]GL3, pMC2-R[–483*/+146*]GL3, and pMC2-R[–147*/+146*]GL3, and these constructs, together with their wild-type counterparts, were electroporated into 3T3-L1 cells on d 8 and harvested on d 10. Luciferase was measured and the results are shown normalized to renilla. Cartoons of the promoter constructs are shown to the left of the figure (not to scale), with exon 1* shown as a black box. The C/EBP site at –87* is denoted by a gray bar in wild-type constructs and the mutant constructs have a cross through the site. RLU, Relative light units. This experiment was conducted three times and the data shown as the mean ± SE. Data were compared between wild-type and mutant constructs, *, P < 0.05.

 
EMSA analysis (Fig. 7AGo) of the C/EBP site at –87 shows that the site binds complexes in preadipocytes, d 3 adipocytes, and d 10 adipocyte nuclear extracts, which are supershifted by antibodies against C/EBP factors. Days 3 and 10 extracts contain C/EBP{alpha}, which is not detectable in preadipocytes, whereas all extracts contain C/EBPß. Inclusion of antibodies against both C/EBP{alpha} and C/EBPß (lanes 4, 8, 12, and 16) leaves behind a complex that may contain C/EBP{delta}. This has been observed in differentiated 3T3-L1 cells previously (23). The consensus C/EBP site binds the same complexes but appears to be a higher affinity site, and a 50-fold molar excess of this oligonucleotide is sufficient to compete the factors binding to the –87* site (data not shown). To demonstrate C/EBP binding to the promoter in vivo, ChIP analysis was performed on d 10 3T3-L1 cells. Cross-linked and sonicated DNA from these cells was immunoprecipitated with antibodies against either C/EBP{alpha} or -ß, and after removal of the proteins, the DNA was amplified by PCR using primers spanning the C/EBP site. Figure 7BGo shows that whereas preimmune serum is unable to precipitate the MC2-R promoter, both C/EBP{alpha} and -ß bind to this region of the promoter in d 10 adipocytes (Fig. 7BGo, upper panel). The coding exon, exon 5, was amplified only when using the input DNA sample, showing the specificity of the immunoprecipitation (Fig. 7BGo, lower panel).


Figure 7
View larger version (62K):
[in this window]
[in a new window]
 
FIG. 7. C/EBP{alpha} and -ß bind to the site at –87* in 3T3-L1 adipocyte nuclear extracts in vitro and in vivo. A, EMSA analysis of nuclear extracts from 3T3-L1 cells (lanes 1–4, preadipocyte; lanes 5–8, d 3 adipocytes; lanes 9–16, d 10 adipocytes) was performed to analyze protein binding to the –87 C/EBP site (lanes 1–12) and a consensus C/EBP site (lanes 13–16). C/EBP{alpha} and -ß antibodies (Ig) were used to supershift the DNA/protein complexes individually ({alpha}: lanes 2, 6, 10, 14; ß: lanes 3, 7, 11, 15) or together (lanes 4, 8, 12, 16). The specific complexes and supershifts (arrowed) are indicated on the right of the figure. Rabbit preimmune serum (pre) was used as a negative control (lanes 1, 5, 9, and 13). B, ChIP analysis was performed on d 10 3T3-L1 cells. Genomic DNA was cross-linked to proteins, sheared, and immunoprecipitated with C/EBP{alpha} and -ß antibodies. After reversal of the cross-linking and deproteinizing, PCR was performed on the immunoprecipitated DNA using primers flanking the –87* C/EBP site (upper panel) and specific for exon 5 (lower panel) and the products were visualized after gel electrophoresis next to a size marker. The –ve control was rabbit preimmune serum and the +ve control was 10% of input DNA. Antibodies (Ig) to C/EBP{alpha} and -ß were used for ChIP. The sizes of the bands in the marker lane are indicated on the right of the figure.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The majority of adipocytes in vivo are terminally differentiated, and murine adipocytes have been shown to respond to ACTH both in vivo and in vitro. Because there is no good MC2-R antibody available, ACTH responsiveness is the only test of MC2-R expression. These data, and our own unpublished observations, indicate that MC2-R must be expressed in these cells, whereas we demonstrated by RT-PCR analysis (Fig. 1AGo) that the previously identified promoter is not active at late times during differentiation. Kubo et al. (24) described an alternate 5' end to MC2-R mRNA in murine adipose tissue. Our analysis shows that the MC2-R transcripts observed at late times during 3T3-L1 differentiation also initiate from a transcriptional start site within the first intron of the murine gene, although the 5' end we report here, found in all clones sequenced, is 11 bp upstream of that found in their major transcript and corresponds to a less abundant transcript in their report. Their failure to detect any transcripts containing exon 1 confirms our observations that the 5' promoter is active only in cells undergoing the early stages of adipogenesis (Figs. 1AGo and 3Go). MC2-R expression has been noted in the early stages of adipogenesis of human stem cells (25) but not in terminally differentiated human adipocytes (26, 27). Kubo et al. noted that there is no equivalent of exon 1* in the human gene, which may explain these apparently contradictory observations.

In this study we demonstrated that the genomic region between exons 1 and 1* has the property of a promoter displaying kinetics of late activation during 3T3-L1 differentiation and that even though sequences 5' to –147* may be important for the magnitude of induction, sequence(s) downstream of this point are sufficient for this delayed activity. Inspection of this sequence reveals the presence of a C/EBP site, at –87*, which is found in the promoters of several genes activated during adipogenesis such as aP2 (28, 29), leptin (30), phosphoenolpyruvate carboxykinase (31), and GLUT4 (28). The C/EBPs are a family of basic leucine zipper transcription factors that homo- and heterodimerize, and two members in particular, C/EBP{alpha} and -ß, have been shown to have important roles in differentiation (for reviews see Refs. 32 , 33). C/EBPß is immediately up-regulated upon induction of differentiation of preadipocytes. Both PPAR{gamma} and C/EBP{alpha} have C/EBP sites in their promoters, and these are initially activated by C/EBPß. The subsequent up-regulation of C/EBP{alpha} then leads to a sustained expression of both PPAR{gamma} and C/EBP{alpha}, whereas C/EBPß levels fall during differentiation (34, 35, 36). The EMSA analysis indicates that there is an up-regulation of C/EBP{alpha} on differentiation, but it is notable that there is still an excess of C/EBPß binding in d 10 extracts. This observation, similar to those reported for C/EBP complexes binding to the GLUT4 C/EBP site in d 10 3T3-L1 adipocytes (37), suggests that C/EBPß, either as a homodimer or heterodimer with C/EBP{alpha} (or other family isoforms), may also transactivate the promoter. It has been shown that the promoters of the insulin receptor and aP2 (34) are differentially responsive to C/EBP isoforms, and perhaps the excess of C/EBPß, compared with C/EBP{alpha}, at least as judged by Fig. 7AGo, is not necessarily indicative of the identity of the factor responsible for the activation of the downstream promoter.

The finding that there is a switch in promoter usage during 3T3-L1 differentiation is very surprising and has not been reported for other genes activated during adipogenesis. Differentiating 3T3-L1 cells rapidly up-regulate the production of PPAR{gamma}2 and C/EBP{alpha}, and these transcription factors remain elevated and active throughout differentiation (Ref. 15 and reviewed in Refs. 38 and 39 , and data not shown). On this basis, it would be expected that both upstream and downstream promoters would be activated shortly after induction of differentiation and remain active at all subsequent times. Our data therefore indicate that both promoters are likely to be specifically repressed by as-yet-unknown mechanisms, the 5' promoter after d 3 and the 3' promoter before d 8 and possibly after d 12, judging by the transient nature of its activation. Several genes, such as leptin, aP2, and phosphoenolpyruvate carboxykinase, have both C/EBP and PPAR{gamma} binding sites in their promoter regions, and the cooperation between C/EBP{alpha} and PPAR{gamma} in establishing adipocyte differentiation may be a consequence of their ability to synergize in inducing adipocyte gene expression, although this has yet to be demonstrated (40). On the contrary, overexpression of PPAR{gamma}2 and treatment with the PPAR{gamma} ligand thiazolidinedione was shown to inhibit C/EBP{alpha}-driven transcription of the leptin promoter, and C/EBP{alpha} overexpression was shown to inhibit thiazolidinedione-induced transcription of the aP2 promoter (40). These studies, although performed in nonadipocyte cell lines, nevertheless indicate the potential for antagonism between C/EBP{alpha} and PPAR{gamma} that may underlie the switch in promoter usage we have shown in this study.

It is interesting to speculate on the potential consequences of switching promoter usage during differentiation, considering that there appears to be no requirement to do so, at least in terms of the abundance and activity of the primary transactivators PPAR{gamma}2 and C/EBP{alpha}. The 5' UTRs of the MC2-R messages are unusually long (up to 468 nt including exon 1 and 500 nt including exon 1*) and contain several upstream open reading frames (9), features that have been shown to play a role in translational control (41, 42). These upstream open reading frames are terminated before the coding sequence in exon 5 and thus are not expected to alter the amino acid sequence of the MC2-R or its function. Terminal differentiation of cells, such as adipocytes, is usually accompanied by decreased proliferation and the general inhibition of protein synthesis (43, 44). Some genes, however, escape from this inhibition and typically possess long 5' UTRs, which allow cap-independent translation via internal ribosomal entry sites (45). One consequence of switching promoter usage in the MC2-R gene is the synthesis of mRNAs with different 5' ends, and this may confer a differential translatability during terminal differentiation of adipocytes. Experiments are underway to investigate this possibility.

The expression of the murine MC2-R gene is under exquisite control. We previously reported the repression of the 5' promoter in steroidogenic factor-1-positive mouse testicular Leydig cells (3), and we show here that this promoter is active in fetal but not adult murine testes. We further demonstrate that during adipogenesis there is a switch in promoter usage from the 5' promoter to a 3' promoter, the activity of which is restricted to adipose cells. It appears therefore that both the 5' and 3' promoters are tissue specific and differentiation state dependent. In summary, the data we have presented indicate that the murine MC2-R gene is subject to complex tissue-specific, differentiation state-dependent, and developmental control. The mechanisms regulating these controls, and in particular the unique promoter switch during 3T3-L1 differentiation, are currently under investigation.


    Acknowledgments
 
We thank Art Bakmanidis for help with preparation of the figures. The sequence of exon 1* has been entered into Genbank with the accession no. DQ294344.


    Footnotes
 
This work was supported by the Research Advisory Board of St Bartholomew’s and The Royal London Charitable Foundation.

Author disclosure summary: L.A.N., A.J.L.C., P.J.O., and P.J.K. have nothing to declare.

First Published Online September 21, 2006

Abbreviations: C/EBP, CCAAT/enhancer binding protein; ChIP, chromatin immunoprecipitation; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GSP, gene-specific primer; MC2-R, melanocortin 2 receptor; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase; UTR, untranslated region.

Received June 27, 2006.

Accepted for publication September 11, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Simpson ER, Waterman MR 1983 Regulation by ACTH of steroid hormone biosynthesis in the adrenal cortex. Can J Biochem Cell Biol 61:692–707[Medline]
  2. Boston BA, Cone RD 1996 Characterization of melanocortin receptor subtype expression in murine adipose tissues and in the 3T3-L1 cell line. Endocrinology 137:2043–2050[Abstract]
  3. Cammas FM, Pullinger GD, Barker S, Clark AJ 1997 The mouse adrenocorticotropin receptor gene: cloning and characterization of its promoter and evidence for a role for the orphan nuclear receptor steroidogenic factor 1. Mol Endocrinol 11:867–876[Abstract/Free Full Text]
  4. White JE, Engel FL 1958 Lipolytic action of corticotropin on rat adipose tissue in vitro. J Clin Invest 37:1556–1563[Medline]
  5. Ramachandran J, Lee V 1976 Divergent effects of adrenocorticotropin and melanotropin on isolated rat and rabbit adipocytes. Biochim Biophys Acta 428:339–346[Medline]
  6. Norman D, Isidori AM, Frajese V, Caprio M, Chew SL, Grossman AB, Clark AJ, Michael BG, Fabbri A 2003 ACTH and {alpha}-MSH inhibit leptin expression and secretion in 3T3-L1 adipocytes: model for a central-peripheral melanocortin-leptin pathway. Mol Cell Endocrinol 200:99–109[CrossRef][Medline]
  7. O’Shaughnessy PJ, Fleming LM, Jackson G, Hochgeschwender U, Reed P, Baker PJ 2003 Adrenocorticotropic hormone directly stimulates testosterone production by the fetal and neonatal mouse testis. Endocrinology 144:3279–3284[Abstract/Free Full Text]
  8. Kubo M, Ishizuka T, Kijima H, Kakinuma M, Koike T 1995 Cloning of a mouse adrenocorticotropin receptor-encoding gene. Gene 153:279–280[CrossRef][Medline]
  9. Noon LA, Bakmanidis A, Clark AJL, O’Shaughnessy PJ, King PJ, Identification of a novel MC2-R splice variant in murine adipocytes: implications for post-transcriptional control of expression during adipogenesis. J Mol Endocrinol, in press
  10. Shimizu C, Kubo M, Saeki T, Matsumura T, Ishizuka T, Kijima H, Kakinuma M, Koike T 1997 Genomic organization of the mouse adrenocorticotropin receptor. Gene 188:17–21[CrossRef][Medline]
  11. Naville D, Jaillard C, Barjhoux L, Durand P, Begeot M 1997 Genomic structure and promoter characterization of the human ACTH receptor gene. Biochem Biophys Res Commun 230:7–12[CrossRef][Medline]
  12. Marchal R, Naville D, Durand P, Begeot M, Penhoat A 1998 A steroidogenic factor-1 binding element is essential for basal human ACTH receptor gene transcription. Biochem Biophys Res Commun 247:28–32[CrossRef][Medline]
  13. Naville D, Penhoat A, Durand P, Begeot M 1999 Three steroidogenic factor-1 binding elements are required for constitutive and cAMP-regulated expression of the human adrenocorticotropin receptor gene. Biochem Biophys Res Commun 255:28–33[CrossRef][Medline]
  14. Gregoire FM, Smas CM, Sul HS 1998 Understanding adipocyte differentiation. Physiol Rev 78:783–809[Abstract/Free Full Text]
  15. Tontonoz P, Hu E, Spiegelman BM 1994 Stimulation of adipogenesis in fibroblasts by PPAR{gamma}2, a lipid-activated transcription factor. Cell 79:1147–1156[CrossRef][Medline]
  16. Freytag SO, Paielli DL, Gilbert JD 1994 Ectopic expression of the CCAAT/enhancer-binding protein {alpha} promotes the adipogenic program in a variety of mouse fibroblastic cells. Genes Dev 8:1654–1663[Abstract/Free Full Text]
  17. Noon LA, Clark AJ, King PJ 2004 A peroxisome proliferator-response element in the murine mc2-r promoter regulates its transcriptional activation during differentiation of 3T3-L1 adipocytes. J Biol Chem 279:22803–22808[Abstract/Free Full Text]
  18. Whiteside ST, Visvanathan KV, Goodbourn S 1992 Identification of novel factors that bind to the PRD I region of the human ß-interferon promoter. Nucleic Acids Res 20:1531–1538[Abstract/Free Full Text]
  19. Fowkes RC, Sidhu KK, Sosabowski JK, King P, Burrin JM 2003 Absence of pituitary adenylate cyclase-activating polypeptide-stimulated transcription of the human glycoprotein {alpha}-subunit gene in LßT2 gonadotrophs reveals disrupted cAMP-mediated gene transcription. J Mol Endocrinol 31:263–278[Abstract]
  20. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  21. Dignam JD, Lebovitz RM, Roeder RG 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  22. Osada S, Yamamoto H, Nishihara T, Imagawa M 1996 DNA binding specificity of the CCAAT/enhancer-binding protein transcription factor family. J Biol Chem 271:3891–3896[Abstract/Free Full Text]
  23. Moreno-Aliaga MJ, Matsumura F 1999 Endrin inhibits adipocyte differentiation by selectively altering expression pattern of CCAAT/enhancer binding protein-{alpha} in 3T3-L1 cells. Mol Pharmacol 56:91–101[Abstract/Free Full Text]
  24. Kubo M, Shimizu C, Kijima H, Nagai S, Koike T 2004 Alternate promoter and 5'-untranslated exon usage of the mouse adrenocorticotropin receptor gene in adipose tissue. Endocr J 51:25–30[CrossRef][Medline]
  25. Smith SR, Gawronska-Kozak B, Janderova L, Nguyen T, Murrell A, Stephens JM, Mynatt RL 2003 Agouti expression in human adipose tissue: functional consequences and increased expression in type 2 diabetes. Diabetes 52:2914–2922[Abstract/Free Full Text]
  26. Kiwaki K, Levine JA 2003 Differential effects of adrenocorticotropic hormone on human and mouse adipose tissue. J Comp Physiol [B] 173:675–678[CrossRef][Medline]
  27. Chhajlani V 1996 Distribution of cDNA for melanocortin receptor subtypes in human tissues. Biochem Mol Biol Int 38:73–80[Medline]
  28. Christy RJ, Yang VW, Ntambi JM, Geiman DE, Landschulz WH, Friedman AD, Nakabeppu Y, Kelly TJ, Lane MD 1989 Differentiation-induced gene expression in 3T3-L1 preadipocytes: CCAAT/enhancer binding protein interacts with and activates the promoters of two adipocyte-specific genes. Genes Dev 3:1323–1335[Abstract/Free Full Text]
  29. Herrera R, Ro HS, Robinson GS, Xanthopoulos KG, Spiegelman BM 1989 A direct role for C/EBP and the AP-I-binding site in gene expression linked to adipocyte differentiation. Mol Cell Biol 9:5331–5339[Abstract/Free Full Text]
  30. Hwang CS, Mandrup S, MacDougald OA, Geiman DE, Lane MD 1996 Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein {alpha}. Proc Natl Acad Sci USA 93:873–877[Abstract/Free Full Text]
  31. Shoshani T, Benvenisty N, Trus M, Reshef L 1991 Cis-regulatory elements that confer differential expression upon the rat gene encoding phosphoenolpyruvate carboxykinase in kidney and liver. Gene 101:279–283[CrossRef][Medline]
  32. Darlington GJ, Ross SE, MacDougald OA 1998 The role of C/EBP genes in adipocyte differentiation. J Biol Chem 273:30057–30060[Free Full Text]
  33. Ramji DP, Foka P 2002 CCAAT/enhancer-binding proteins: structure, function and regulation. Biochem J 365:561–575[Medline]
  34. Wu Z, Rosen ED, Brun R, Hauser S, Adelmant G, Troy AE, McKeon C, Darlington GJ, Spiegelman BM 1999 Cross-regulation of C/EBP{alpha} and PPAR{gamma} controls the transcriptional pathway of adipogenesis and insulin sensitivity. Mol Cell 3:151–158[CrossRef][Medline]
  35. Rosen ED, Hsu CH, Wang X, Sakai S, Freeman MW, Gonzalez FJ, Spiegelman BM 2002 C/EBP{alpha} induces adipogenesis through PPAR{gamma}: a unified pathway. Genes Dev 16:22–26[Abstract/Free Full Text]
  36. Tang QQ, Zhang JW, Daniel LM 2004 Sequential gene promoter interactions of C/EBPß, C/EBP{alpha}, and PPAR{gamma} during adipogenesis. Biochem Biophys Res Commun 319:235–239[CrossRef][Medline]
  37. Jain R, Police S, Phelps K, Pekala PH 1999 Tumour necrosis factor-{alpha} regulates expression of the CCAAT-enhancer-binding proteins (C/EBPs) {alpha} and ß and determines the occupation of the C/EBP site in the promoter of the insulin-responsive glucose-transporter gene in 3T3-L1 adipocytes. Biochem J 338(Pt 3):737–743
  38. Brun RP, Kim JB, Hu E, Altiok S, Spiegelman BM 1996 Adipocyte differentiation: a transcriptional regulatory cascade. Curr Opin Cell Biol 8:826–832[CrossRef][Medline]
  39. Mandrup S, Lane MD 1997 Regulating adipogenesis. J Biol Chem 272:5367–5370[Free Full Text]
  40. Hollenberg AN, Susulic VS, Madura JP, Zhang B, Moller DE, Tontonoz P, Sarraf P, Spiegelman BM, Lowell BB 1997 Functional antagonism between CCAAT/enhancer binding protein-{alpha} and peroxisome proliferator-activated receptor-{gamma} on the leptin promoter. J Biol Chem 272:5283–5290[Abstract/Free Full Text]
  41. Kozak M 1991 An analysis of vertebrate mRNA sequences: intimations of translational control. J Cell Biol 115:887–903[Abstract/Free Full Text]
  42. Suzuki Y, Ishihara D, Sasaki M, Nakagawa H, Hata H, Tsunoda T, Watanabe M, Komatsu T, Ota T, Isogai T, Suyama A, Sugano S 2000 Statistical analysis of the 5' untranslated region of human mRNA using "Oligo-Capped" cDNA libraries. Genomics 64:286–297[CrossRef][Medline]
  43. Krichevsky AM, Metzer E, Rosen H 1999 Translational control of specific genes during differentiation of HL-60 cells. J Biol Chem 274:14295–14305[Abstract/Free Full Text]
  44. de Haro C, Mendez R, Santoyo J 1996 The eIF-2{alpha} kinases and the control of protein synthesis. FASEB J 10:1378–1387[Abstract]
  45. Gerlitz G, Jagus R, Elroy-Stein O 2002 Phosphorylation of initiation factor-2{alpha} is required for activation of internal translation initiation during cell differentiation. Eur J Biochem 269:2810–2819[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/12/6019    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Noon, L. A.
Right arrow Articles by King, P. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Noon, L. A.
Right arrow Articles by King, P. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals