help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0791
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Udagawa, J.
Right arrow Articles by Otani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udagawa, J.
Right arrow Articles by Otani, H.
Endocrinology Vol. 147, No. 2 647-658
Copyright © 2006 by The Endocrine Society

The Role of Leptin in the Development of the Cerebral Cortex in Mouse Embryos

Jun Udagawa, Ryuju Hashimoto, Hiroaki Suzuki, Toshihisa Hatta, Yusuke Sotomaru, Kyoji Hioki, Yukiko Kagohashi, Tatsuji Nomura, Yasuhiro Minami and Hiroki Otani

Department of Developmental Biology (J.U., R.H., T.H., Y.K., H.O.), Faculty of Medicine, Shimane University, Izumo 693-8501, Japan; Department of Oral and Maxillofacial Surgery (H.S.), Kobe University Graduate School of Medicine, Kobe 650-0017, Japan; Central Institute for Experimental Animals (Y.S., K.H., T.N.), Kawasaki 216-0001, Japan; Department of Food Science (Y.K.), Shimane Women’s College, Matsue 690-0044, Japan; and Department of Genome Sciences (Y.M.), Faculty of Medical Sciences, Kobe University, Graduate School of Medicine, Kobe 650-0017, Japan

Address all correspondence and requests for reprints to: Jun Udagawa, Department of Developmental Biology, Faculty of Medicine, Shimane University, Izumo 693-8501, Japan. E-mail: jun{at}med.shimane-u.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin is detected in the sera, and leptin receptors are expressed in the cerebrum of mouse embryos, suggesting that leptin plays a role in cerebral development. Compared with the wild type, leptin-deficient (ob/ob) mice had fewer cells at embryonic day (E) 16 and E18 and had fewer 5-bromo-2'-deoxyuridine+ cells at E14 and E16 in the neuroepithelium. Intracerebroventricular leptin injection in E14 ob/ob embryos increased the number of neuroepithelium cells at E16. In cultured neurosphere cells, leptin treatment increased Hes1 mRNA expression and maintained neural progenitors. Astrocyte differentiation was induced by low-dose (0.1 µg/ml) but not high-dose (1 µg/ml) leptin. High-dose leptin decreased Id mRNA and increased Ngn1 mRNA in neurosphere cells. The neuropeptide Y mRNA level in the cortical plate was lower in ob/ob than the wild type at E16 and E18. These results suggest that leptin maintains neural progenitors and is related to glial and neuronal development in embryos.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
LEPTIN, WHICH IS secreted from adipocytes, decreases appetite and increases energy expenditure in adults (1, 2, 3, 4) by acting on the arcuate nucleus (ARH) in the hypothalamus, in which leptin receptors (Ob-Rs) are highly expressed (5, 6, 7). Leptin exhibits these functions by activating ARH neurons that express anorexigenic peptides, proopiomelanocortin and cocaine- and amphetamine-related transcript, and suppressing ARH neurons that express orexigenic peptides, neuropeptide Y (NPY) and agouti-related gene product (5, 6, 7). In humans, fetal plasma leptin concentration has correlation with birth weight, birth length, and head circumference, but maternal leptin concentration has negative correlation with fetal growth (8, 9). In transgenic skinny mice that overexpress leptin after birth, maternal leptin concentration was increased and fetal body weight was less than in nontransgenic mice (10, 11). These reports suggest that both fetal leptin and maternal leptin are related to fetal development.

Brain weight and total brain protein content were reduced in juvenile and adult ob/ob (leptin-deficiency) and db/db (lack of long form of leptin receptor) mice, compared with the wild-type (C57BL/6) mice (12, 13, 14). Brain DNA content was also reduced in ob/ob mice, compared with the wild type (15). In the hypothalamus, the neural projection from ARH was disrupted in ob/ob mice, and the ip injection of leptin in juvenile ob/ob mice rescued the development of ARH projections (16). These reports suggest that leptin affects the proliferation and differentiation of neural cells, at least postnatally. In the cerebrum, cortical brain volume was reduced in adult ob/ob mice, compared with the wild type (12). The ob/ob and db/db mice exhibit reduced locomotor activity and impairment of cognitive function (13, 17), and the cerebral cortex is involved in the locomotor and cognitive functions in rodents (18, 19, 20).

Leptin receptor mRNA was expressed in the mouse embryonic cerebral cortex (21) and detected in the sera of mouse embryos (22), suggesting that leptin plays a role in embryonic cerebrocortical development. In this study, we examined the roles of leptin in the maintenance, proliferation, and differentiation of neuroepithelial cells as well as in the differentiation of neurons in the embryonic cerebral cortex, by both comparing brains of ob/ob embryos against those of a wild type (C57BL/6J) and intracerebroventricular injection of leptin to ob/ob embryos with an exo utero development system (23, 24, 25). We also examined the effect of leptin on neurosphere cells originating from the mouse embryonic cerebrum.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
We purchased pregnant ICR mice from the Central Institute of Laboratory Animals (Kawasaki, Japan). In these mice, fertilized eggs of leptin-deficient (ob/ob) or wild-type (C57BL/6J) mice had been transplanted, and the day of transplantation was defined as embryonic day (E) 0. C57BL/6J and BKS.Cg-m+/+ Leprdb (db/+) mice were purchased from Clea Japan (Tokyo, Japan) and were mated from 1700 to 0800 h. We defined 0:00 of the day when a vaginal plug was observed as E0.

We maintained these mice at 22–24 C under a 12-h light, 12-h dark cycle at the Institute of Animal Experiment of Shimane University. Food and water were available ad libitum. All animal studies were approved by the Ethics Committee for Animal Experimentation of Shimane University, and the animals were handled according to the institutional guidelines.

The pregnant mice were injected with 5-bromo-2'-deoxyuridine (BrdU; 100 mg/kg) ip. Three hours later, ob/ob and wild-type (C57BL/6J) embryos at E14, E16, and E18 were obtained from ICR surrogate mothers, which were killed by ether anesthetization. Embryos were also killed by ether anesthetization. We measured crown-rump length (CRL) and body weight of nine or more embryos in total from two or more litters at each of E14 to E18. We also measured the total brain weight in ob/ob and wild-type embryos from two or more ICR transplantation litters at E16 and E18. E14 db/db (BKS.Cg-+ Leprdb/+ Leprdb) embryos from db/+ mothers were distinguished from +/+ (BKS.Cg-m +/m +) or db/+ embryos by the size of cDNA fragment of Ob-Rb mRNA in RT-PCR (26). The brains of embryos were embedded in OCT compounds and stored at –80 C until use as frozen sections. For the paraffin sections, the brains were fixed in 10% formalin solution containing 70% methanol at 4 C overnight, dehydrated with methanol, and embedded in paraffin.

Exo utero surgery and microinjection of leptin
Exo utero surgery was performed as described previously (23). Briefly, pregnant mice were anesthetized with pentobarbital (60 mg/kg), and the abdominal wall and uterus were incised. Fifty nanograms of leptin were injected into the lateral ventricle of E14 ob/ob embryos in the right uterine horn using a 40-µm-diameter micropipette, whereas the vehicle [1 mM sodium citrate in PBS (pH 7.4)] was injected in control ob/ob embryos in the left uterine horn of the same dam. The embryonic brain was obtained at E16 and embedded in paraffin as described above.

Intracerebroventricular injection of 1 µg leptin exhibits the function in food intake and metabolic rates in neonates and adults (27, 28, 29). Fifty nanograms of leptin for an E14 embryo is equivalent to 1 µg for an adult mouse because the embryonic brain at E14 weighed approximately one twentieth that of the adult.

Serum leptin concentration
We measured the pooled serum leptin concentration in ICR-transplanted ob/ob embryos and nontransplanted wild-type (C57BL/6J) embryos at each of E14, E16, and E18. The serum leptin concentration was measured by RIA with a leptin RIA kit (Linco Research, St. Charles, MO).

Immunohistochemistry in the brain
We performed immunohistochemistry with mouse monoclonal antinestin (1:200, Rat 401, Developmental Studies Hybridoma Bank), anti-Tuj1 (neuron-specific class III ß-tubulin) (1:200, Covance, Berkeley, CA), and anti-BrdU (1:1000, BD PharMingen, San Diego, CA) antibodies, and rabbit polyclonal antileptin receptor long form (Ob-Rb) (1:100, Linco Research) and anti-single-stranded DNA (ssDNA) (1:400, DakoCytomation, Carpinteria, CA) antibodies. Nestin is an intermediate filament protein selectively expressed in the neural stem cells (NSCs) and neural progenitor cells (NPCs) in the brain (30, 31) and ssDNA is specific for apoptotic cells (32).

A coronal frozen section of the brain was cut at a thickness of 10 µm and fixed with acetone at –20 C for 10 min, incubated with 10% goat serum for 1 h at room temperature, and incubated with anti-Ob-Rb antibody and either antinestin or anti-Tuj1 antibody at 4 C overnight. The same section was then incubated with biotinylated goat antirabbit IgG (Vector Laboratories, Burlingame, CA) and Alexa Fluor 546-labeled goat antimouse IgG antibodies (Molecular Probes, Inc., Eugene, OR) and incubated with fluorescein isothiocyanate (FITC)-conjugated ExtrAvidin (Sigma, St. Louis, MO). The sections were observed by a confocal laser microscopy (FLUOVIEW FV300, Olympus, Tokyo, Japan). The brain sections of E14 db/db and +/+ (BKS.Cg-m +/m +) embryos were treated in the same way as described above and incubated with anti-Ob-Rb antibody at 4 C overnight and with Histofine simple stain mouse MAX PO (rabbit) (Nichirei, Tokyo, Japan) for 30 min at room temperature.

For BrdU immunostaining, coronal paraffin sections of the brain were cut at a thickness of 5 µm and treated with methanol containing 0.3% hydrogen peroxide for 30 min to inactivate intrinsic peroxidase. The section was treated with 0.05% trypsin and 0.1% CaCl2 solution at 37 C for 3 min 30 sec and then with 2 N HCl at room temperature for 30 min. We used the M.O.M. immunostaining kit (Vector Laboratories) for BrdU immunostaining. Staining was performed according to the protocol provided with the kit.

For ssDNA immunostaining (33), a coronal paraffin section of the brain was treated with 20 µg/ml proteinase K at 37 C for 20 min and incubated with anti-ssDNA at 4 C overnight. The section was incubated with ENVISION+ System HRP rabbit (DakoCytomation). We used liquid diaminobenzidine chromogen (DakoCytomation) for chromogenic reaction. Nuclei in the sections were counterstained with hematoxylin.

Semiquantitative study on the cells in the cerebral cortex
The numbers of cells in the neuroepithelium (NE), intermediate zone (IZ), and cortical plate (CP) of a hemisphere in the cerebral cortex were counted blindly as described previously with random and systematic sampling (24, 34, 35). Coronal sections with a thickness of 5 µm were sampled from E14 to E18 transplanted wild-type and ob/ob embryos and stained by Nissl’s staining. Four or more embryos from two or more litters were used for the cell counts. We counted the total cell number in the volume delimited as follows: 1) rostrocaudally, between the section at the rostral end of the corpus callosum and the section at the interventricular foramen in E16 and E18 brains, or between the section in which the corticostriatal sulcus is first observed in the rostral end and the section at the interventricular foramen in E14 brains and 2) mediolaterally, between the perpendicular lines that come in contact with the medial and lateral edges of the lateral ventricle. Every 18th coronal section for E14 and E16 brains and every 30th for E18 brains were chosen. In embryos microinjected during exo utero surgery, every 12th section was chosen. Six to eight sections were counted in each embryonic brain. A one-sided 20-µm grid (in the NE at E14, the NE, IZ, and CP at E16 and the NE at E18) or 50-µm grid (in the IZ and CP at E18) was superimposed on a photograph of the cerebral cortex, and the cells within the box were counted. In total, we used about 100 boxes for the NE at E14 embryos; 250 boxes for each of the NE, IZ, and CP at E16; and 200 boxes for the NE and 70 boxes for each of the IZ and CP at E18 per brain. The mean cell density in the boxes in each section was calculated and the total cell counts in each section were calculated by multiplying mean cell density by the area of the NE, IZ, or CP in each section. We multiplied the cell number in the section by the distance between the sections and totaled the cell numbers in the defined volume. This calculated value was corrected with the diameter of the nuclei and thickness of the section, and the total cell number in NE, IZ, and CP in the defined volume was estimated (24, 34, 35).

BrdU+ cells were estimated in the NE at E14 and E16 as described above, and the BrdU index was calculated.

To count apoptotic cells in the NE at E16 and E18, every sixth paraffin section stained by ssDNA immunostaining and Hechst 33258 was chosen. The total apoptotic cell number was estimated as described above.

Culture and immunocytochemistry of neurosphere cells
We purchased neurosphere cells isolated from murine E14 cerebral cortex (Stem Cell Technologies, Vancouver, Canada). These cells were maintained in the NeuroCult NSC proliferation medium (Stem Cell Technologies) containing 20 ng/ml epidermal growth factor (EGF; Stem Cell Technologies) at 37 C under 5% CO2.

Neurosphere cells were fixed with acetone and dried on silicon-coated slides. The cells were washed with PBS, treated with 0.3% Triton X-100 for 10 min, and incubated with 1% BSA for 30 min. They were incubated with mouse monoclonal antinestin (1:200) and rabbit polyclonal anti-Ob-Rb (1:100) antibodies, followed by Alexa Fluor 546-labeled antimouse IgG antibody and biotinylated antirabbit IgG antibody, and finally by FITC-conjugated ExtrAvidin.

Proliferation of neurosphere cells
We used the cell proliferation ELISA BioTrak system (Amersham Biosciences, Piscataway, NJ) to detect BrdU incorporation into the cells. Quadruplicated samples were prepared from each of the following groups.

Neurosphere cells (5 x 104 cells/ml) were cultured in a 96-well plastic plate in the NSC proliferation medium containing: 1) leptin (0.01–1 µg/ml) and/or NPY (0.01–1 µM) for 2 d; 2) leptin (0.01–1 µg/ml) and/or NPY (0.01–1 µM) for 1 or 2 d, followed by EGF (20 ng/ml) administration for an additional day; or 3) EGF with leptin (0.01–1 µg/ml) or EGF with NPY (0.01–1 µM) for 1 d.

We examined BrdU incorporation into these cells by ELISA after 3 h of exposure to BrdU (10 nM).

These doses (0.01–1 µg/ml) of leptin and NPY (0.01–1 µM) exhibit neuronal function in vitro (36, 37, 38, 39).

Differentiation assay and clonal analysis of leptin-treated neurosphere cells
Neurosphere cells were plated on Lab-Tek II CC2 chamber slides (8 wells, Nalge Nunc, Rochester, NY) at 1000 cells/chamber with leptin (0.1 µg/ml)-added NSC proliferation medium for 2 d. The cells were cultured in EGF (20 ng/ml)-contained medium for 6 d and cultured in NeuroCult differentiation medium for additional 6 d. The cells were incubated with mouse monoclonal anti-Tuj1 (1:500), rabbit polyclonal antiglial fibrillary acidic protein (GFAP) (1:2000, DakoCytomation) and mouse IgM anti-O4 (1:100) antibodies and followed by the incubation with biotinylated antimouse IgG, antirabbit IgG, and antimouse IgM antibodies, respectively (Vector Laboratories). We used the VECSTATIN immunostaining kit (Vector Laboratories). Diaminobenzidine was used for chromogenic reaction and nuclei in the sections were counterstained with hematoxylin. More than 500 cells were counted in the leptin-treated and control groups (n = 3, respectively) and the proportion of Tuj1+, GFAP+, and O4+ cells was calculated.

Clonal analysis was performed as described previously (40, 41). Single neurosphere cells were plated on Lab-Tek II CC2 chamber slides (8 wells, Nalge Nunc) at 50 cells/chamber. These cells were cultured for 2 d in leptin (0.1 or 1 µg/ml)-added NSC proliferation medium. The cells were cultured in EGF (20 ng/ml)-contained medium for 8 d and cultured in NeuroCult differentiation medium for additional 7 d. The cells were incubated with mouse monoclonal anti-Tuj1, rabbit polyclonal anti-GFAP, and mouse IgM anti-O4 antibodies followed by the incubation with Alexa 633-labeled antimouse IgG (Molecular Probes), Cy3-labeled antirabbit IgG (Chemicon, Temecula, CA), biotinylated antimouse IgM (Vector Laboratories) antibodies, and finally FITC-conjugated ExtrAvidin. Tuj1+, GFAP+, and/or O4+ clones were counted under a confocal laser microscopy. The ratio of viable colony number to plated cell number was counted and the proportion of Tuj1+, GFAP+, and/or O4+ clones was calculated in the leptin-treated and control groups (n = 3, respectively).

Probe synthesis
Total RNA was extracted from the mouse brain using TRI reagent (Molecular Research Center, Cincinnati, OH), and fragments of mouse Ob-R and NPY cDNAs were made by RT-PCR with Ready-To-Go RT-PCR beads (Amersham Biosciences). To generate 429- and 331-bp PCR products characteristic of the Ob-R and NPY mRNA sequences, the primers used were 5'-AGAGCCAAACTCAACTACGCTCTT-3' (+661 to +684) and 5'-TCCAACACTAGTCAGAATTTTGGG-3' (+1089 to +1066; GenBank U42467) and 5'-AGCAGAGGACATGGCCAGAT-3' (+123 to +142) and 5'-TTAAACACACATATATACAACAAC-3' (+453 to +430; GenBank AF273768), respectively. The PCR product was purified and cloned into pBluescript II SK(+) using a PCR-Script Amp SK(+) cloning kit (Toyobo, Osaka, Japan). The positive clone insert was verified by DNA sequencing with T7 and T3 primers using an ABI PRISM BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems, Foster City, CA). To generate antisense and sense 35S-labeled riboprobes for NPY mRNA, the plasmid was linearized with SacI and KpnI and subjected to in vitro transcription with T7 and T3 RNA polymerases, respectively.

Quantitative real-time PCR (QRT-PCR)
Total RNA of the brains of three or more ob/ob and wild-type embryos from two or three litters at each of E16 and E18 was extracted using TRI Reagent (Molecular Research Center). For reverse transcription reaction, 200 ng RNA were applied using the Ready-To-Go RT-PCR beads. The primers for NPY mRNA were 5'-AGCAGAGGACATGGCCAGAT-3' (+123 to +142) and 5'-AATCAGTGTCTCAGGGCTGGAT-3' (+222 to +201; GenBank AF273768). Primers and the SYBR GREEN PCR master mix (Applied Biosystems, Warrington, UK) were added to the reverse transcription mixture, and the ratio of the NPY mRNA expression level to the amount of 18S rRNA was examined with ABI PRISM 7000 (Applied Biosystems, Foster City, CA).

Total RNA was extracted from neurosphere cells that were cultured on 75-cm2 flasks at a density of 1 x 105 cells/ml in the NSC proliferation medium with 0, 0.1, and 1 µg/ml of leptin for 1 d (n = 3). The expression level of the hairy and enhancer of split (Hes) 1, Hes5, inhibitor of differentiation (Id) 2, Id4, Neurogenin (Ngn) 1, Ngn2, neurogenic differentiation(NeuroD), mammalian achaete-scute complex homolog-like 1 (Mash1) and 4 bone morphogenetic protein (BMP) 4 mRNAs to that of 18S rRNA was examined as described above. Primers were as follows (F, forward; R, reverse): Hes1 F, AGAAAGATAGCTCCCGGCAT; R, TCGTTCATGCACTCGCTGAA; Hes5 F, AACACAGCAAAGCCTTCGCCG; R, TGGAAGTGGTAAAGCAGCTTC; Id2 F, CAAAGGTGGAGCGTGAATTCCAGG; R, CACAGCATTCAGTAGGCTCGTGTC; Id4 F, GCGATATGAACGACTGCTAC; R, TCTCAGCAAAGCAGGGTGAG.; Ngn1 F: ATGCCTGCCCCTTTGGAGACCT; R, TGTAGCCTGGCACAGTCCTCCT; Ngn2 F, CCGGGTCAGACGTGGACTACT; R, GGCGGGAGAAGGATGGGAAGA; NeuroD F, ATCTGCCAACCGCCAGCGCTTCCTT; R, TTGACGTGGAAGACGTGGGAGCTGT; Mash1 F, CTCGTCCTCTCCGGAACTGATG; R, ATGCTCCCGGAGGGTGGCAAAA; BMP4 F, ATTCTCTGGGATGCTGCTGAGG; R, CCGAGCCAACACTGTGAGGAGT.

The cDNAs were verified by DNA sequencing with respective primers using an ABI PRISM BigDye terminator cycle sequencing ready reaction kit (Applied Biosystems USA).

In situ hybridization
The section was fixed with 4% paraformaldehyde for 20 min at room temperature, treated with 20 µg/ml of proteinase K for 7 min at 30 C, and fixed with 4% paraformaldehyde again. It was acetylated in 0.1 M triethanol amine and 0.25% acetic anhydride for 10 min at room temperature and dehydrated with ethanol. The riboprobes for NPY mRNA were diluted with hybridization solution [50 mM dithiothreitol, 0.5 mg/ml poly ribo A, 10% dextran sulfate, 50 µg/ml of yeast tRNA, 0.3 M NaCl, 10 mM Trisma base, 10 mM NaH2PO4, 5 mM NaEDTA, 0.2% Ficoll 400, 0.2% polyvinyl pyrrolidone, 50% formamide, and 0.25 mM adenosine-5'-O-(1-thio triphosphate)] and applied to each slide, and the sections were incubated at 60 C overnight. The slide was washed twice with 50% formamide, 2x saline sodium citrate (SSC), and 20 mM 2-mercaptoethanol at 60 C for 30 min and twice with 4x SSC, 20 mM Tris, and 1 mM EDTA (STE) at 37 C for 10 min. The section was treated with RNase A (10 µg/ml) in STE at 37 C for 30 min. It was then washed once with STE containing 20 mM 2-mercaptoethanol at 37 C for 30 min; twice with 50% formamide, 2x SSC, and 20 mM 2-mercaptoethanol at 60 C for 45 min; and once with distilled water. It was then dehydrated with ethanol and dried. The section was developed and observed under a dark field.

Differentiation of P19 embryonic carcinoma (P19EC) cells and Northern blot analysis
P19EC cells were grown in MEM, {alpha}MEM (Sigma) with 10% (vol/vol) fetal calf serum (42). P19EC cells were induced to be differentiated with retinoic acid (RA) essentially as described previously (43).

Total RNAs from differentiated P19EC cells were prepared by using Isogen (Wako, Osaka, Japan). For RNA blot analysis, 10 µg of total RNA were electrophoresed on 1% agarose formaldehyde gels and transferred onto nylon membranes. Probe DNAs (~0.4 kb) were prepared from pBS II SK(+)-Ob-R and NPY by digestion with SmaI and SacII, labeled with {alpha}-32PdCTP using the MultiPrime labeling kit (Amersham), and hybridized as described previously (44, 45). Specific activity was approximately 1 x 106 cpm/ng for all of the probe DNAs.

Statistical analysis
We used an ANOVA and Fisher’s post hoc test to analyze the cell counts in the cerebral cortex, BrdU labeling index in the NE, proliferation activity of the neurosphere cells, and expression of NPY mRNAs with QRT-PCR. Scheffé’s post hoc test was used for the clonal analysis and analysis of Hes, Ids, Ngns, NeuroD, Mash1, and BMP4 mRNA expression in neurosphere cells because sample sizes were different among experimental groups. Student’s t test was used for analysis of the differentiation assay.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CRL, body weight, and total brain weight
There were no significant differences in CRL, body weight, or total brain weight between ob/ob and wild-type (C57BL/6J) embryos at E14, E16, or E18 (Table 1Go) or between litters, according to ANOVA (data not shown).


View this table:
[in this window]
[in a new window]
 
TABLE 1. CRL, body weight, and total brain weight in ob/ob and wild-type embryos

 
Serum leptin concentration
In normal development, leptin was detected in the mouse embryonic serum at a concentration of approximately 1 ng/ml during E14 to E18 (Table 2Go). Leptin was not detected in the serum of the ob/ob embryos from ICR surrogate mothers (see Materials and Methods) at E14, E16, or E18 (Table 2Go). This result indicates that maternal leptin did not pass through the placenta and that the ob/ob embryos were deficient in leptin in the embryonic stages.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Serum leptin concentration in mouse embryos

 
Expression of leptin receptors in the cerebral cortex and cultured cells
Ob-Rb was detected by the present anti-Ob-Rb antisera in the NE and CP of +/+ (BKS.Cg-m +/m +) embryos at E14 (Fig. 1CGo) but not in those of db/db embryos (Fig. 1DGo); therefore, this antibody is specific to Ob-Rb. Nestin was coexpressed with Ob-Rb in the NE at E14 (Fig. 1Go, E–G), and Tuj1 was coexpressed with Ob-Rb in the CP at E18 wild-type (C57BL/6J) embryos (Fig. 1Go, H–J). Neurosphere cells coexpressed nestin and Ob-Rb (Fig. 1Go, K–M). Treatment of aggregated P19EC cells with RA results in their differentiation into neuronal cells (43). After RA treatment for 6 d, most cells are neurons with elaborate axons and dendrites (43, 45). Ob-R mRNA expression was observed as a single band (~3 kb) by Northern blot analysis in P19EC cells before RA treatment (0 d) and continued to be observed at 6 d after RA treatment (Fig. 1AGo).



View larger version (73K):
[in this window]
[in a new window]
 
FIG. 1. Ob-R (A) and NPY (B) mRNA expression during RA-induced neuronal differentiation of P19EC cells and Ob-Rb expression in the cerebral cortex (C–J) and neurosphere cells (K and L). Total RNA was prepared from P19EC cells treated with RA for 0, 2, 4, and 6 d, separated by 1% agarose formaldehyde gels, transferred onto nylon membranes, and hybridized with radiolabeled probes for Ob-R mRNA (A) and NPY mRNA (B). Ob-R mRNA expression was observed in P19EC cells from d 0, when P19EC cells were undifferentiated, to d 6, when P19EC cells were differentiated into neurons (A). NPY mRNA was expressed in P19EC cells before RA treatment (0 d) and had disappeared by 2 and 4 d of RA treatment. However, it had become reinduced by 6 d of RA treatment, when P19EC cells were differentiated into neurons (B). The filters were stained with methylene blue to show 18S and 28S ribosomal RNAs. Ob-Rb was expressed in the NE and CP of +/+ (BKS.Cg-m +/m +) embryos (C), but not in those of db/db embryos (D), at E14 in vivo. Fluorescent double stainings of coronal sections of the neocortex were made for Ob-Rb (green) and nestin (red) at E14 (E–G), and Ob-Rb (green) and Tuj1 (red) at E18 (H–J) in wild-type (C57BL/6J) embryos. Ob-Rb and nestin were coexpressed in the NE at E14, and Ob-Rb and Tuj1 were coexpressed in the CP at E18. Ob-Rb (green) and nestin (red) were coexpressed in neurosphere cells (K–M). These results indicate that NSCs and/or NPCs as well as neurons express Ob-Rb. Scale bars, 100 µm (C–J), and 10 µm (K–M).

 
Cell proliferation and cell death in the cerebral cortex
At E18, the NE of the cerebral cortex was thinner in the ob/ob embryos than wild type (Fig. 2Go, A and B). At E16 and E18 but not E14, the ob/ob had significantly fewer cells in the NE than the wild type did (P < 0.01 and 0.05) (Fig. 2Go, C–E). At E18, ob/ob had significantly fewer cells in the CP than the wild type did (P < 0.05). The BrdU index in the NE was significantly lower in the ob/ob than wild type at E14 (Fig. 3Go, A, B, and E) and E16 (Fig. 3Go, C, D, and F) (P < 0.05). There was no significant difference between ob/ob and the wild type in the number of apoptotic cells in the NE at E16 or E18 (data not shown).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 2. The cell numbers in the cerebral cortex. The NE in the cerebral cortex was thinner in ob/ob (A) than wild type (B). Cell numbers in the NE did not differ between ob/ob and wild-type embryos at E14 (C), but there were fewer cells in ob/ob than the wild type at E16 (D) (n = 4). There were fewer cells in the NE and CP in ob/ob than the wild type at E18 (E) (n = 4). The number of cells in the NE at E16 increased by leptin injection at E14 in ob/ob embryos (F) (n = 4). Scale bar, 200 µm. *, P < 0.05; **, P < 0.01.

 


View larger version (51K):
[in this window]
[in a new window]
 
FIG. 3. The number of BrdU+ cells in the NE of the cerebral cortex. Coronal sections of the cerebral cortex in ob/ob (A) and wild-type (B) embryos at E14 and in ob/ob (C) and wild type (D) at E16. There were fewer BrdU+ cells in ob/ob embryos than in the wild type at both E14 (E) and E16 (F). Scale bar, 100 µm. *, P < 0.05. n = 4 (E14 ob/ob); n = 3 (E14 wild type; and E16 ob/ob and wild type).

 
Intracerebroventricular injection of 50 ng of leptin to E14 ob/ob embryos increased the number of cells in the NE at E16 (P < 0.01), whereas leptin did not change the cell count in the IZ or CP (Fig. 2FGo). Although the cell number tended to be lower in leptin-treated ob/ob (Fig. 2DGo) than wild-type embryos (Fig. 2FGo), this is probably due to the stress of exo utero surgery.

Effects of leptin and NPY on proliferation activity of neurosphere cells
Leptin treatment for 2 d increased BrdU incorporation into neurosphere cells from E14 cerebral cortex cultured in medium containing no EGF (P < 0.05) (Fig. 4AGo). The EGF-responsive proliferation of neurosphere cells was enhanced by leptin pretreatment (0.1 and 1 µg/ml) for 1 (Fig. 4BGo) and 2 d (Fig. 4CGo) (P < 0.01 and 0.05). There was no synergistic effect on the proliferation of neurosphere cells when leptin and EGF were added simultaneously (data not shown). Without EGF, NPY did not increase BrdU incorporation into neurosphere cells (data not shown), but a synergistic effect was observed on the proliferation of neurosphere cells by the simultaneous administration of NPY and EGF (P < 0.01) (Fig. 4DGo).



View larger version (42K):
[in this window]
[in a new window]
 
FIG. 4. BrdU incorporation into neurosphere cells. Incorporation increased slightly by leptin treatment for 2 d in medium containing no EGF (A). Leptin pretreatment for 1 (B) and 2 (C) d increased the responsiveness of EGF-dependent proliferation. NPY had an additive effect with EGF on the proliferation of neurosphere cells (D). EGF concentration was 20 ng/ml. *, P < 0.05; **, P < 0.01. n = 4.

 
Clonal analysis and differentiation assay of leptin-treated neurosphere cells
In clonal analysis, leptin increased the ratio of viable colony number to plated cell number in a dose-dependent manner (P < 0.01) (Fig. 5AGo). The proportion of GFAP+/O4+ progenitor colonies was higher and that of O4+ colonies was lower in cells treated with a low dose of leptin (0.1 µg/ml) than in control cells (P < 0.05) (Fig. 5Go, B, C, and E). The proportions of multipotent progenitor colonies tended to be increased, and that of Tuj1+/O4+ progenitor colonies were not altered by the low-dose treatment (Fig. 5Go, D and E). In the differentiation assay, low-dose leptin significantly increased the proportion of astrocytes (P < 0.01) (Fig. 5Go, F–H) but did not affect the proportions of neurons and oligodendrocytes (data not shown). In clonal analysis, high-dose leptin (1 µg/ml) did not alter the proportion of any progenitor colony (Fig. 5EGo).



View larger version (38K):
[in this window]
[in a new window]
 
FIG. 5. Clonal analysis and differentiation assay of neurosphere cells. In clonal analysis, the ratio of colony number to plated cell number was increased by leptin pretreatment in a dose-dependent manner (A). Fluorescent staining of the differentiated cells revealed the proportion of the O4+ (green) colonies (B) was smaller (E) and that of GFAP+ (blue)/O4+ colonies (C) was larger (E) by low-dose leptin. The proportion of Tuj1+ (red)/GFAP+/O4+ multipotent progenitor colonies (D) tended to be increased by low-dose leptin administration (P = 0.06) (E). The proportion of GFAP+ astrocytes was increased by low-dose leptin treatment in the differentiation assay (F–H). Scale bar, 50 µm. *, P < 0.05; **, P < 0.01. n = 3 or 4.

 
The mRNA expression of basic helix-loop-helix (bHLH) factors in leptin-treated neurosphere cells
Hes and Id are bHLH factors (46). Hes1 and Hes5 each play an important role in the maintenance of NSCs (46, 47, 48). Id2 and Id4 blocked both neuronal differentiation and oligodendrocyte formation and promoted the proliferation of cortical progenitors (46). Ngn1, Ngn2, and NeuroD are known as proneural bHLH factors (46). By QRT-PCR analysis, the Hes1 mRNA expression level was higher in the leptin-treated neurosphere cells than control cells (P < 0.05), and this expression increased in a dose-dependent manner (Fig. 6AGo). Id2 and Id4 mRNA expression levels were lower in neurosphere cells treated by high-dose leptin (1 µg/ml) than those treated by low-dose leptin (0.1 µg/ml) (P < 0.05) (Fig. 6Go, B and C). The Ngn1 mRNA expression level was higher in neurosphere cells dosed with 1 µg/ml of leptin than in the control and low-dose-treated neurosphere cells (P < 0.05) (Fig. 6DGo). There was no significant difference in Ngn2 or NeuroD mRNA expression levels between the leptin-treated and control neurosphere cells, although both tended to be increased by 1 µg/ml leptin treatment (P < 0.1) (Fig. 6Go, E and F). Leptin treatment did not affect the mRNA expression level of Mash1, a proneural bHLH factor (46), or BMP4 (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIG. 6. The mRNA expression of bHLH proteins in neurosphere cells. QRT-PCR revealed that high-dose (1 µg/ml) and low-dose (0.1 µg/ml) leptin significantly increased Hes1 mRNA expression (A). Id2 (B) and Id4 (C) mRNA expression was significantly lower in high-dose than low-dose leptin-treated cells. Ngn1 mRNA expression (D) was significantly higher in high-dose leptin-treated cells than control cells. Ngn2 (E) and NeuroD (F) mRNA expression tended to increase in high-dose leptin-treated cells (P < 0.10). *, P < 0.05; **, P < 0.01. n = 3–5.

 
The expression of NPY mRNA in the brain and P19EC cells
By QRT-PCR analysis, the NPY mRNA expression level in the total brain was higher at E18 than E16 in wild-type embryos (P < 0.01) (Fig. 7AGo). It was lower in the ob/ob embryos than the wild type at both E16 and E18 (P < 0.01) (Fig. 7AGo). By in situ hybridization, NPY mRNA expression was observed mainly in the CP of the cerebrum at E16 and E18, and this expression was weaker in ob/ob embryos than the wild type (Fig. 7Go, B–E).



View larger version (70K):
[in this window]
[in a new window]
 
FIG. 7. The expression of NPY mRNA in the brain. QRT-PCR revealed that NPY mRNA expression in the total brain was lower at E16 than E18 and lower in ob/ob than the wild type at both E16 and E18 (A). NPY mRNA expression in the CP was weaker in ob/ob (B) than the wild type (C) at E16 and was limited to the inner layer in ob/ob mice (D), compared with the wild type at E18 (E). Scale bar, 100 µm. *, P < 0.01. n = 3 (E16 ob/ob); n = 6 (E16 wild type); n = 7 (E18 ob/ob and wild type).

 
The NPY probe detected a single band (~0.5 kb) by Northern blot analysis during the differentiation of P19EC cells (Fig. 1BGo). NPY mRNA expression was observed in P19EC cells before RA treatment (0 d), disappeared at 2 d, and was induced again 6 d after RA treatment upon neuronal differentiation (Fig. 1BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Maintenance, proliferation, and differentiation of NSCs and NPCs
Brain DNA content, as well as brain weight and total brain protein content, was reduced in ob/ob mice, compared with their lean counterparts, and leptin injection into juvenile ob/ob mice increased brain DNA (13, 15), indicating the increase in cell number by leptin. Multipotent NSCs may be a target of leptin because these cells exist in even the adult cerebral cortex (49). Leptin was detected in the sera of wild-type embryos (Table 2Go), and both NE at E14 (Fig. 1GGo) and neurosphere cells from E14 mouse cerebral cortex (Fig. 1MGo), both of which include NSCs and NPCs, coexpressed Ob-Rb and nestin. Compared with wild-type (C57BL/6J) mice, in ob/ob the BrdU index in the NE was reduced at E14 and E16 (Fig. 3Go), there were fewer cells in the NE at E16 and E18 (Fig. 2Go, D and E), and the NE layer was thinner at E18 (Fig. 2Go, A and B). Leptin supplementation at E14 rescued the reduced number of cells in the NE at E16 in ob/ob embryos (Fig. 2FGo). These findings support the contention that leptin increases proliferation activity in the NE.

The present cell proliferation analyses by ELISA in neurosphere cells from E14 mouse cerebral cortex showed that: 1) leptin enhanced EGF-responsive proliferation of neurosphere cells (Fig. 4Go, B and C); 2) the increase in proliferative activity by leptin was slight without EGF (Fig. 4AGo); and 3) the simultaneous administration of leptin and EGF had no synergistic effect on proliferation activity (data not shown). These findings in cultured cells suggest that leptin maintains either the cells’ EGF responsiveness or the number of EGF-responsive cells rather than promoting proliferation.

The present clonal analysis supported the contention that leptin maintained neurosphere cells because leptin increased the ratio of viable colony number to plated cell number in a dose-dependent manner (Fig. 5AGo). Low-dose leptin (0.1 µg/ml) significantly increased the proportion of GFAP+/O4+ progenitor colonies, significantly decreased that of O4+ progenitor colonies, and tended to increase the proportion of multipotent progenitor colonies (P = 0.06) (Fig. 5Go, B–E). These results suggest that low-dose leptin preferentially maintains astrocytes/oligodendrocytes and multipotent progenitor cells. This is consistent with the result in the differentiation assay that low-dose leptin treatment significantly increased the proportion of astrocytes (Fig. 5Go, F–H) without significant decreases in the proportions of neurons and oligodendrocytes (data not shown).

High-dose leptin, while maintaining a larger number of viable colonies (Fig. 5AGo), did not alter the proportion of colonies of each progenitor (Fig. 5EGo), suggesting that high-dose leptin maintained all types of NPCs. Hes1 and Hes5 are Notch effectors in mammalian neuronal differentiation (50), block neurogenesis, and increase the proportion of mitotically active cortical progenitors (46). Hes1-expressing cells are maintained as NSCs in the embryonic telencephalon (51). The increased expression of Hes1 mRNA in leptin-treated neurosphere cells (Fig. 6AGo) suggests that leptin maintains the NSCs and NPCs by inducing Hes1. The reduced number of cells in the CP of ob/ob embryos at E18 (Fig. 2EGo) may be attributable to the reduction of NSCs and NPCs at earlier stages than E17 because neocortical cytogenesis continued from E11 to E17 and because postmitotic cells, which exist in NE from E14 to E16, reached the CP at E18 (52, 53, 54). Ob-Rb belongs to a family of IL-6-related cytokine receptors, and leptin signal is thought to be transmitted mainly by Janus kinase (JAK)/signal transducer and activator of transcription (STAT)3 pathway (7). Leukemia inhibitory factor is a member of IL-6-related cytokines, led to activation of STAT3 (55), and increased the number of NSCs (24, 56). Leptin may exhibit the maintenance effect on NSCs and NPCs through the activation of JAK/STAT3 pathway.

The subventricular zone enlarges during the peak of gliogenesis (postnatal 5 to 20 d) in the mouse forebrain, and astrocytes and oligodendrocytes are generated from subventricular zone postnatally (57). The serum leptin concentration peaked in 10-d-old mice (58). The present in vitro study showed that low-dose leptin preferentially maintained astrocyte/oligodendrocyte progenitor cells in clonal analysis and increased the proportion of astrocytes in the differentiation assay (Fig. 5Go, B and C). These results suggest that leptin has a maintenance effect on the glial progenitor cells in the embryonic and neonatal brains. Hes1 can drive glial-restricted progenitor cells to an astrocyte cell fate at the expense of oligodendrocyte differentiation (59). The increased expression of Hes1 in the present study (Fig. 6AGo) may have caused the astrocyte differentiation in leptin-treated neurosphere cells (Fig. 5Go, E–H). However, high-dose leptin did not promote astrocyte differentiation (Fig. 5EGo). The inhibition of Id2 and Id4 expression by high-dose leptin treatment (Fig. 6Go, B and C) may offset the driving force to astrocyte differentiation in leptin-treated neurosphere cells. Id2 and Id4 each sequester both OLIG and E2A proteins, which bind to promoter regions in the oligodendroglial gene, inhibit oligodendrocyte development, and enhance commitment to the astrocytic fate (60).

The expression of NPY mRNA was lower in ob/ob than wild-type embryos at E16 and E18 (Fig. 7AGo). The reduced proliferative activity in ob/ob embryos might also be caused by a low amount of NPY because NPY had an additive effect with EGF on the proliferative activity of neurosphere cells (Fig. 4DGo). This is consistent with a report that NPY acted on multipotent neuronal precursor in the olfactory epithelium and promoted proliferation of neuronal precursors (61). Because leptin and NPY had no synergistic effect on the proliferation of neurosphere cells (data not shown), these two factors may not have a cross-talk in the maintenance of NSCs and/or NPCs. This contention is not contradictory to the previous reports that NPY activates the ERK 1/2 subgroup of MAPKs (61), whereas leptin activates the JAK-STAT pathway (7).

Differentiation of neurons
Yura et al. (62) reported that the nutritional status in the fetus was related to neonatal leptin surge, neuronal development, and obesity. Offspring with fetal undernutrition exhibited a premature onset of neonatal leptin surge and develops pronounced weight gain and adiposity (62). The premature leptin surge led to accelerated weight gain with a high-fat diet and offspring with fetal undernutrition (exhibited an impaired response to acute peripheral leptin administration with impaired leptin transport to the brain as well as an increased density of hypothalamic nerve terminals (62). Bouret et al. (16) reported that leptin promoted the development of the neural projection in the hypothalamus in postnatal mice. These reports suggest that the intrauterine circumstances alter the onset of postnatal leptin surge and postnatal leptin surge affects hypothalamic development; however, the role of leptin in embryonic neuronal development is still unknown.

Terminally postmitotic neurons migrate into the CP, and migratory cohorts are added in succession to the CP’s most superficial level (53). Ob-Rb was already expressed in the CP at E14 (Fig. 1Go, C–E). At E18, this expression was strong (Fig. 1Go H) and Tuj1+ neurons in the CP expressed Ob-Rb (Fig. 1JGo). In P19EC cells, NPY mRNA expression disappeared once after RA treatment, but it was induced again when the cells were differentiated into neurons (Fig. 1BGo). NPY mRNA was expressed in the inner layer of the CP, which contained neurons that had migrated earlier, and the expression area was tangentially wider at E18 than E16 (Fig. 7Go, B–E). Taken together, these results suggest that well-differentiated neurons expressed NPY mRNA in the embryonic cerebral cortex. NPY mRNA expression was lower in the brain (Fig. 7AGo) and weaker in the CP in ob/ob than wild-type embryos at E16 and E18 (Fig. 7Go, B–E).

Leptin may promote the differentiation of neurons into NPY-expressing ones in the embryonic stage. According to the present QRT-PCR, NPY mRNA expression in the brain of ob/ob embryos at E16 was restored to the level of wild type [the average value of NPY mRNA/18S was 0.140 (n = 6)] (Fig. 7AGo) by intracerebroventricular injection of 200 ng leptin at E14 [the values were 0.127 and 0.159 in leptin-injected ob/ob embryos (n = 2), and 0.079, 0.085, and 0.051 in vehicle-injected ob/ob embryos (n = 3)]. In the adult mature hypothalamus, the functions of leptin and NPY in appetite and energy expenditure are opposite to each other, and leptin inhibits the expression of NPY (7). This mature leptin-NPY axis may not be established in the embryonic cerebral cortex. This would be consistent with a previous report that leptin injection did not decrease NPY expression in the neonatal mouse hypothalamus (63). In the immature brain, leptin may play a role in the functional differentiation of neurons. Such a role is supported by the present QRT-PCR data that 1 µg/ml leptin treatment significantly increased Ngn1 mRNA expression (Fig. 6DGo) because Ngn1 is expressed in newly committed neuronal progenitors and immature neurons and plays a role in neurogenesis together with Ngn2 (64). Leptin treatment tended to increase Ngn2 and NeuroD mRNA expression in neurosphere cells (Fig. 6Go, D–F). Leptin did not increase the proportion of Tuj1+ progenitor cells (Fig. 5EGo) but may promote the differentiation of neuronal restricted progenitor cells into neurons. Leptin treatment of juvenile ob/ob mice restored brain weight and protein content but did not restore neurodegeneration or the expression of synaptobrevin in the neocortex (13). Brain DNA content was increased by leptin injection to juvenile ob/ob mice but was not normalized to the level of lean mice (15). The present study suggests that exposure to leptin in the embryonic or early postnatal stage may be required to rescue these abnormalities.

Leptin has effects on other brain regions than the neocortex and hypothalamus. In the adults, leptin receptor is expressed in the hippocampus, and leptin facilitates hippocampal synaptic plasticity and inhibits hippocampal epileptiform-like activity (21, 65, 66). Neuronal soma size was smaller in the cingulate cortex of ob/ob mice than that of wild type (12). The cingulate girus is involved in emotion and sensory, motor, and cognitive processes (67, 68, 69, 70). Impairment of the anterior cingulate causes the motor deficit, akinetic mutism, and apathy (69, 71), and the ob/ob mice has low locomotor activity (13). In E18 ob/ob embryos, pyknosis was caused in the cingulate cortex (72). Leptin may be related to the development of the hippocampus and the cingulate cortex and may affect the memory and cognitive function.

In summary, this study has suggested that leptin maintains neural stem and progenitor cells and is related to neuronal and glial development in the mouse embryonic brain.


    Acknowledgments
 
We thank Ms. Y. Takeda for the histological preparation.


    Footnotes
 
This work was supported by a grant from the Japan Society for the Promotion of Science.

The authors have no conflict of interest.

First Published Online November 10, 2005

Abbreviations: ARH, Arcuate nucleus; bHLH, basic helix-loop-helix; BMP, bone morphogenetic protein; BrdU, 5-bromo-2'-deoxyuridine; CP, cortical plate; CRL, crown-rump length; E, embryonic day; EGF, epidermal growth factor; F, forward; FITC, fluorescein isothiocyanate; GFAP, glial fibrillary acidic protein; Hes, hairy and enhancer of split; Id, inhibitor of differentiation; IZ, intermediate zone; JAK, Janus kinase; Mash1, mammalian achaete-scute complex homolog-like 1; NE, neuroepithelium; NeuroD, neurogenic differentiation; Ngn, Neurogenin; NPC, neural progenitor cell; NPY, neuropeptide Y; NSC, neural stem cell; Ob-R, leptin receptor; P19EC, P19 embryonic carcinoma; QRT-PCR, quantitative real-time PCR; R, reverse; RA, retinoic acid; SSC, saline sodium citrate; ssDNA, single-stranded DNA; STAT, signal transducer and activator of transcription; STE, 4x SSC, 20 mM Tris, and 1 mM EDTA.

Received June 28, 2005.

Accepted for publication November 1, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Zhang Y, Proenka R, Maffei M, Barone M, Leopold L 1994 Positional cloning of the mouse obese gene and its human homologue. Nature 412:425–432
  2. Campfield LA, Smith FJ, Guisez Y, Devos R, Burn P 1995 Recombinant mouse OB protein: evidence for a peripheral signal linking adiposity and central neural networks. Science 269:546–549[Abstract/Free Full Text]
  3. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait JM 1995 Weight reducing effect of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  4. Pelleymounter MA, Cullen MJ, Baker MB, Winters D, Boone T, Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269:540–543[Abstract/Free Full Text]
  5. Spiegelman BM, Flier JS 2001 Obesity and the regulation of energy balance. Cell 104:531–543[CrossRef][Medline]
  6. Zigman JM, Elmoquist JK 2003 From anorexia to obesity-the yin and yang of body weight control. Endocrinology 144:4149–4156
  7. Ahima RS, Osei SY 2004 Leptin signaling. Physiol Behav 81:223–241[CrossRef][Medline]
  8. Ong KK, Ahmed M, Sherriff A, Woods KA, Watts A, Golding J, Dunger DB, The Alspac Study Team 1999 Cord blood leptin is associated with size at birth and predicts infancy weight gain in humans. J Clin Endocrinol Metab 84:1145–1148[Abstract/Free Full Text]
  9. Lepercq J, Challier JC, Guerre-Millo M, Cauzac M, Vidal H, Mouzon SH 2001 Prenatal leptin production: evidence that fetal adipose tissue produces leptin. J Clin Endocrinol Metab 86:2409–2413[Abstract/Free Full Text]
  10. Ogawa Y, Masuzaki H, Hosoda K, Aizawa-Abe M, Suga J, Suda M, Ebihara K, Iwai H, Matsuoka N, Satoh N, Odaka H, Kasuga H, Fujisawa Y, Inoue G, Nishimura H, Yoshimasa Y, Nakao K 1999 Increased glucose metabolism and insulin sensitivity in transgenic skinny mice overexpressing leptin. Diabetes 48:1822–1829[Abstract]
  11. Sagawa N, Yura S, Itoh H, Mise H, Kakui K, Korita D, Takemura M, Nuamah MA, Ogawa Y, Masuzaki H, Nakao K, Fujii S 2002 Role of leptin in pregnancy—a review. Placenta 16:S80–S86
  12. Bereiter DA, Jeanrenaud B 1979 Altered neuroanatomical organization in the central nervous system of the genetically obese (ob/ob) mouse. Brain Res 165:249–260[CrossRef][Medline]
  13. Ahima RS, Bjorbæk C, Osei S, Flier JS 1999 Regulation of neuronal and glial proteins by leptin: implication for brain development. Endocrinology 140:2755–2762[Abstract/Free Full Text]
  14. Vannucci SJ, Gibbs EM, Simpson IA 1997 Glucose utilization and glucose transporter proteins GLU-1 and GLU-3 in brains of diabetic (db/db) mice. Am J Physiol 272:E267–E274
  15. Steppan CM, Swick AG 1999 A role of leptin in brain development. Biochem Biophys Res Commun 256:600–602[CrossRef][Medline]
  16. Bouret SG, Draper SJ, Simerly RB 2004 Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 304:108–110[Abstract/Free Full Text]
  17. Harvey J 2003 Novel actions of leptin in the hippocampus. Ann Med 35:197–206[CrossRef][Medline]
  18. Zilles K, Wree A 1995 Cortex: areal and laminar structure. In: Paxinos G, ed. The rat nervous system. 2nd ed. San Diego: Academic Press; 649–685
  19. Issacson RL, McClearn GE 1978 The influence of brain damage on locomotor behavior of mice selectively bred for high or low activity in the open field. Brain Res 150:559–567[CrossRef][Medline]
  20. Rosen GD, Waters NS, Galaburda AM, Denenberg VH 1995 Behavioral consequences of neonatal injury of the neocortex. Brain Res 685:177–189
  21. Udagawa J, Hatta T, Naora H, Otani H 2000 Expression of the long form of leptin receptor (Ob-Rb) mRNA in the brain of mouse embryos and newborn mice. Brain Res 868:251–258[CrossRef][Medline]
  22. Yamashita H, Shao J, Ishizuka T, Klepcyk PJ, Muhlenkamp P, Qiao L, Hoggard N, Friedman JE 2001 Leptin administration prevents spontaneous gestational diabetes in heterozygous Leprdb/+ mice: effects on placental leptin and fetal growth. Endocrinology 142:2888–2897[Abstract/Free Full Text]
  23. Hatta T, Tanaka O, Otani H 1994 Contribution of RGD sequence to neuronal migration in developing cerebral cortex. Neuroreport 5:2261–2264[Medline]
  24. Hatta T, Moriyama K, Nakashima T, Taga T, Otani H 2002 The role of gp130 in cerebral cortical development: in vivo functional analysis in a mouse exo utero system. J Neurosci 22:5516–5524[Abstract/Free Full Text]
  25. Hatta T, Matsumoto A, Otani H 2004 Application of the mouse exo utero development system in the study of developmental biology and teratology. Congenit Anom Kyoto 44:2–8[Medline]
  26. Lee GH, Proenca R, Montez JM, Carroll KM, Darvishzadeh JG, Lee JI, Friedman JM 1996 Abnormal splicing of the leptin receptor in diabetic mice. Nature 379:632–635[CrossRef][Medline]
  27. Hwa JJ, Ghibaudi L, Compton D, Fawzi AB, Strader CD 1996 Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice. Horm Metab Res 28:659–663[Medline]
  28. Mistry AM, Swick A, Romsos DR 1997 Leptin rapidly lowers food intake and elevates metabolic rates in lean and ob/ob mice. J Nutr 127:2065–2072[Abstract/Free Full Text]
  29. Mistry AM, Swick A, Romsos DR 1999 Leptin alters metabolic rates before acquisition of its anorectic effect in developing neonatal mice. Am J Physiol 277:R742–R747
  30. Lendahl U, Zimmerman LB, McKay DG 1990 CNS stem cells express a new class of intermediate filament protein. Cell 60:585–595[CrossRef][Medline]
  31. Liu Y, Wu Y, Lee JC, Xue H, Pevny LH, Kaprielian Z, Rao MS 2002 Oligodendrocyte and astrocyte development in rodents: an in situ and immunohistological analysis during embryonic development. Glia 40:25–43[CrossRef][Medline]
  32. Maeda M, Sugiyama T, Akai F, Jikihara I, Hayashi Y, Takagi H 1998 Single stranded DNA as an immunocytochemical marker for apoptotic change of ischemia in the gerbil hippocampus. Neurosci Lett 240:69–72[CrossRef][Medline]
  33. Habib H, Hatta T, Udagawa J, Zhang L, Yoshimura Y, Otani H 2005 Fetal jaw movement affects condylar cartilage development. J Dent Res 84:474–479[Abstract/Free Full Text]
  34. Abercrombie M 1946 Estimation of nuclear population from microtome sections. Anat Rec 94:239–247[CrossRef]
  35. Satriotomo I, Miki T, Itoh M, Ameno K, Ijiri I, Takeuchi Y 2000 Short-term ethanol exposure alters calbindin D28k and glial fibrillary acidic protein immunoreactivity in hippocampus of mice. Brain Res 879:55–64[CrossRef][Medline]
  36. Quintela M, Sefiaris R, Heiman ML, Casanueva FF, Dieguez C 1997 Leptin inhibits in vitro hypothalamic somatostatin secretion and somatostatin mRNA levels. Endocrinology 138:5641–5644[Abstract/Free Full Text]
  37. Dicou E, Attoub S, Gressens P 2001 Neuroprotective effects of leptin in vivo and in vitro. Neuroreport 12:3947–3951[CrossRef][Medline]
  38. Dhillo WS, Small CJ, Stanley SA, Jethwa PH, Seal LJ, Murphy KJ, Ghatei MA, Bloom SR 2002 Hypothalamic interactions between neuropeptide Y, agouti-related protein, cocaine- and amphetamine-regulated transcript and {alpha}-melanocyte-stimulating hormone in vitro in male rats. J Neuroendocrinol 14:725–730[CrossRef][Medline]
  39. Burcelin R, Thorens B, Glauser M, Gaillard RC, Pralong FP 2003 Gonadotropin-releasing hormone secretion from hypothalamic neurons: stimulation by insulin and potentiation by leptin. Endocrinology 144:4484–4491[Abstract/Free Full Text]
  40. Tropepe V, Sibilia M, Ciruna BG, Rossant J, Wagner EF, Van der Kooy D 1999 Distinct neural stem cells proliferate in response to EGF and FGF in the developing mouse telencephalon. Dev Biol 208:166–188[CrossRef][Medline]
  41. Chang MY, Park CH, Son H, Lee YS, Lee SH 2004 Developmental stage-dependent self-regulation of embryonic cortical precursor cell survival and differentiation by leukemia inhibitory factor. Cell Death Differ 11:985–996[CrossRef][Medline]
  42. McBurney MW, Jones-Villeneuve EMV, Edwards MKS, Anderson PJ 1982 Control of muscle neuronal differentiation in a cultured embryonal carcinoma cell line. Nature 299:165–167[CrossRef][Medline]
  43. Rudnicki M, McBurney MW 1987 Teratocarcinomas and embryonic stem cells: a practical approach. Oxford, UK: IRL Press
  44. Minami Y, Kono T, Yamada K, Kobayash, N, Kawahara A, Perlmutter RM, Taniguchi, T 1993 Association of p56lck with IL-2 receptor ß chain is critical for the IL-2-induced activation of p56lck. EMBO J 12:759–768[Medline]
  45. Oishi I, Takeuchi S, Hashimoto R, Nagabukuro A, Ueda T, Liu Z-J, Hatta T, Akira S, Matsuda Y, Yamamura H, Otani H, and Minami Y 1999 Spatio-temporally regulated expression of receptor tyrosine kinases, mRor1, mRor2, during mouse development: implications in development and function of the nervous system. Genes Cells 4:41–56[Abstract]
  46. Ross SE, Greenberg ME, Stiles CD 2003 Basic helix-loop-helix factors in cortical development. Neuron 39:13–25[CrossRef][Medline]
  47. Artavanis-Tsakonas S, Rand MD, Lake RJ 1999 Notch signaling: cell fate control and signal integration in development. Science 284:770–776[Abstract/Free Full Text]
  48. Hitoshi S, Alexon T, Tropepe V, Donoviel D, Elia AJ, Nye JS, Conlon RA, Mak TW, Bernstein A, Van der Kooy D 2002 Notch pathway molecules are essential for the maintenance, but not the generation, of mammalian neural stem cells. Genes Dev 16:846–858[Abstract/Free Full Text]
  49. Lois C, Alvarez-Buylla A 1993 Proliferating subventricular zone cells in the adult mammalian forebrain can differentiate into neurons and glia. Proc Natl Acad Sci USA 90:2074–2077[Abstract/Free Full Text]
  50. Ohtsuka T, Ishibashi M, Gradwohl G, Nakanishi S, Guillemot F, Kageyama R 1999 Hes1 and Hes5 as notch effectors in mammalian neuronal differentiation. EMBO J 18:2196–2207[CrossRef][Medline]
  51. Ohtsuka T, Sakamoto M, Guillemot F, Kageyama R 2001 Roles of the basic helix-loop-helix genes Hes1 and Hes5 in expansion of neural stem cells of the developing brain. J Biol Chem 276:30467–30474[Abstract/Free Full Text]
  52. Caviness Jr VS, Sidman RL 1973 Time of origin of corresponding cell classes in the cerebral cortex of normal and reeler mutant mice: an autoradiographic analysis. J Comp Neurol 148:141–152[CrossRef][Medline]
  53. Caviness Jr VS 1982 Neocortical histogenesis in normal and reeler mice: a developmental study based upon [3H] thymidine autoradiography. Dev Brain Res 4:293–302[CrossRef]
  54. Takahashi T, Goto T, Miyama S, Nowakowski RS, Caviness Jr VS 1999 Sequence of neuron origin and neocortical laminar fate: relation to cell cycle of origin in the developing murine cerebral wall. J Neurosci 19:10357–10371[Abstract/Free Full Text]
  55. Taga T, Kishimoto T 1997 GP130 and the interleukin-6 family of cytokines. Annu Rev Immunol 15:797–819[CrossRef][Medline]
  56. Pitman M, Emery B, Binder M, Wang S, Butzkueven H, Kilpatrick TJ 2004 LIF receptor signaling modulates neural stem cell renewal. Mol Cell Neurosci 27:255–266[Medline]
  57. Baumann N, Pham-Dinh D 2001 Biology of oligodendrocyte and myelin in the mammalian central nervous system. Physiol Rev 81:871–927[Abstract/Free Full Text]
  58. Ahima RS, Prabakaran D, Flier JS 1998 Postnatal leptin surge and regulation of circadian rhythm of leptin by feeding. J Clin Invest 101:1020–1027[Medline]
  59. Wu Y, Liu Y, Levine EM, Rao MS 2003 Hes1 but not Hes5 regulates an astrocyte versus oligodendrocyte fate choice in glial restricted precursors. Dev Dyn 226:675–689[CrossRef][Medline]
  60. Samanta J, Kessler JA 2004 Interactions between ID and OLIG proteins mediate the inhibitory effects of BMP4 on oligodendroglial differentiation. Development 131:4131–4142[Abstract/Free Full Text]
  61. Hansel DE, Eipper BA, Ronnett GV 2001 Neuropeptide Y functions as a neuroproliferative factor. Nature 410:940–944[CrossRef][Medline]
  62. Yura S, Itoh H, Sagawa N, Yamamoto H, Masuzaki H, Nakao K, Kawamura M, Takemura M, Kakui K, Ogawa Y, Fujii S 2005 Role of premature leptin surge in obesity resulting from intrauterine undernutrition. Cell Metab 1:371–378[CrossRef][Medline]
  63. Ahima RS, Hileman SM 2000 Postnatal regulation of hypothalamic neuropeptide expression by leptin: implication for energy balance and body weight regulation. Regul Pept 92:1–7[CrossRef][Medline]
  64. Schuurmans C, Guillemot F 2002 Molecular mechanisms underlying cell fate specification in the developing telencephalon. Curr Opin Neurobiol 12:26–34[CrossRef][Medline]
  65. Sharley LJ, Irving AJ, Harvey J 2001 Leptin enhances NMDA receptor function and modulates hippocampal synaptic plasticity. J Neurosci 21:RC186
  66. Sharley LJ, O’Malley D, Irving AJ, Ashford MLJ, Harvey J 2002 Leptin inhibits epileptiform-like activity in rat hippocampal neurons via PI 3-kinase driven activation of BK channels. J Physiol 545:933–944[Abstract/Free Full Text]
  67. Vogt BA, Finch DM, Olson CR 1992 Functional heterogeneity in cingulate cortex: the anterior executive and posterior evaluative regions. Cereb Cortex 2:435–443[Free Full Text]
  68. Devinsky O, Morrell MJ, Vogt BA 1995 Contributions of anterior cingulate cortex to behaviour. Brain 118:279–306[Abstract/Free Full Text]
  69. Tekin S, Cummings JL 2002 Frontal-subcortical neuronal circuits and clinical neuropsychiatry an update. J Psychosom Res 53:647–654[CrossRef][Medline]
  70. Sewards TV, Sewards MA 2003 Representations of motivational drives in mesial cortex, medial thalamus, hypothalamus and midbrain. Brain Res Bull 61:25–49[CrossRef][Medline]
  71. Dellen AV, Deacon R, York D, Blakemore C, Hannan AJ 2001 Anterior cingulate cortical transplantation in transgenic Huntington’s disease mice. Brain Res Bull 56:313–318[CrossRef][Medline]
  72. Udagawa J, Nimura M, Kagohashi Y, Otani HLeptin deficiency causes the pycnotic change in the fetal cingulate cortex. Congenit Anom Kyoto, in press



This article has been cited by other articles:


Home page
BrainHome page
H. Hsuchou, Y. He, A. J. Kastin, H. Tu, E. N. Markadakis, R. C. Rogers, P. B. Fossier, and W. Pan
Obesity induces functional astrocytic leptin receptors in hypothalamus
Brain, April 1, 2009; 132(4): 889 - 902.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. C. Cottrell, R. L. Cripps, J. S. Duncan, P. Barrett, J. G. Mercer, A. Herwig, and S. E. Ozanne
Developmental changes in hypothalamic leptin receptor: relationship with the postnatal leptin surge and energy balance neuropeptides in the postnatal rat
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2009; 296(3): R631 - R639.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
W. Pan, H. Hsuchou, Y. He, A. Sakharkar, C. Cain, C. Yu, and A. J. Kastin
Astrocyte Leptin Receptor (ObR) and Leptin Transport in Adult-Onset Obese Mice
Endocrinology, June 1, 2008; 149(6): 2798 - 2806.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
S. G. Bouret
Crossing the Border: Developmental Regulation of Leptin Transport to the Brain
Endocrinology, March 1, 2008; 149(3): 875 - 876.
[Full Text] [PDF]


Home page
EndocrinologyHome page
C. V. Mobbs
Fathead: The Gain in Brain Falls Mainly with Leptin Wane
Endocrinology, February 1, 2006; 147(2): 645 - 646.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Udagawa, J.
Right arrow Articles by Otani, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Udagawa, J.
Right arrow Articles by Otani, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals