| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Activates the Human Prolactin Gene Promoter via Nuclear Factor-
B Signaling
Endocrine Science Research Group (S.F., M.W., A.D.A., J.R.E.D.), University of Manchester, Manchester M13 9PT, United Kingdom; Centre for Cell Imaging (C.V.H., D.G.S., G.N., M.R.H.W.), School of Biological Sciences, University of Liverpool, Liverpool L69 7ZB, United Kingdom; and Molecular Physiology Group (S.S., J.J.M.), University of Edinburgh Medical School, Edinburgh EH16 4TJ, Scotland, United Kingdom
Address all correspondence and requests for reprints to: Prof. Julian Davis, Endocrine Science Research Group School of Biological Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, United Kingdom. E-mail: julian.davis{at}manchester.ac.uk; or Prof. Michael White, School of Biological Sciences, Centre for Cell Imaging, University of Liverpool, Liverpool L69 7ZB, United Kingdom. E-mail: m.white{at}liverpool.ac.uk.
| Abstract |
|---|
|
|
|---|
activates prolactin gene transcription in pituitary GH3 cells stably expressing luciferase under control of 5 kb of the human prolactin promoter. Similar regulation of the endogenous rat prolactin gene by TNF-
in GH3 cells was confirmed using real-time PCR. Luminescence microscopy revealed heterogeneous dynamic response patterns of promoter activity in individual cells. In GH3 cells treated with TNF-
, Western blot analysis showed rapid inhibitory protein
B (I
B
) degradation and phosphorylation of p65. Confocal microscopy of cells expressing fluorescence-labeled p65 and I
B
fusion proteins showed transient cytoplasmic-nuclear translocation and subsequent oscillations in p65 localization and confirmed I
B
degradation. This was associated with increased nuclear factor
B (NF-
B)-mediated transcription from an NF-
B-responsive luciferase reporter construct. Disruption of NF-
B signaling by expression of dominant-negative variants of I
B kinases or truncated I
B
abolished TNF-
activation of the prolactin promoter, suggesting that this effect was mediated by NF-
B. TNF-
signaling was found to interact with other endocrine signals to regulate prolactin gene expression and is likely to be a major paracrine modulator of lactotroph function. | Introduction |
|---|
|
|
|---|
TNF-
is a cytokine that plays a role in a variety of biological processes, including cell proliferation, differentiation, and apoptosis. Furthermore, it can activate transcription factors such as nuclear factor
B (NF-
B) and activator protein-1 (13). NF-
B transcription factors consist of homodimers or heterodimers assembled from subunits including, p50, p52, p65, c-Rel, and Rel B (14), and are involved in the regulation of many genes (15). In the cytoplasm, NF-
B is bound by inhibitory
B proteins (I
B proteins) that block its nuclear localization domain (14). Activation of I
B kinases IKK
and IKKß (16) leads to phosphorylation of I
Bs, which targets them for rapid degradation by the proteasome (17). The released NF-
B dimers can then translocate to the nucleus and regulate target gene transcription.
TNF-
is expressed in multiple tissues, including brain and pituitary (18). In the pituitary, expression of TNF-
has been found in the intermediate lobe and in somatotroph cells (19). The presence of TNF-
receptors in the pituitary cells has also been reported in vitro and in vivo (20, 21), suggesting that TNF-
might well play a role as an autocrine or paracrine regulator.
Studies on the effect of TNF-
on the secretion of pituitary hormones have revealed an effect on ACTH, GH, TSH, and prolactin release (12, 22). The results regarding the effect on prolactin are conflicting. Using mouse hemipituitaries, Milenkovic et al. (23) showed no effect, whereas others using dispersed primary rat pituitary cells showed an decrease (24, 25) or an increase (26, 27) in prolactin release after TNF-
treatment.
Here we report that TNF-
is a potent activator of prolactin promoter activity in pituitary cells, with a biphasic effect over 624 h. Heterogeneous patterns of response in individual cells led to the observed averaged population response. The effect of TNF-
is associated with activation of NF-
B and could be blocked by coexpressing dominant-negative isoforms of components of the NF-
B signaling pathway. The effects of TNF-
were amplified by simultaneous treatment with a range of other hormonal stimuli, suggesting a physiological role as a major modulator of other signaling pathways in determining physiological outcome.
| Materials and Methods |
|---|
|
|
|---|
, IKKß, and NF-
B essential modulator (NEMO)/IKK
were a gift from Dr. N. Inohara (University of Michigan, Ann Arbor, MI) (28). The expression plasmid for truncated I
B
(missing the 40 NH2-terminal amino acids) was a kind gift from Dr. E. Costello (University of Liverpool, Liverpool, UK), and the wild-type IKKß was from Dr. C. Paya (Mayo Clinic, Rochester, NY) (29). The pNF-
B-luciferase (luc) plasmid was from Stratagene (La Jolla, CA). The fluorescent cytomegalovirus (CMV)-I
B
-enhanced green fluorescent protein (EGFP), NF-I
B
-EGFP, and CMV-p65-dsRedXP fusions protein vectors were described previously (30, 31).
Cell culture and luciferase assays
The construction of the GH3/hPrl-luc cell line was described previously (32). Cells were maintained in DMEM with pyruvate/glutamax (Invitrogen, Paisley, UK) and the addition of 10% fetal calf serum (Harlan Sera-Lab, Crawley Down, UK). Except for TNF-
and FGF-2 (Merck Biosciences, Nottingham, UK), all other reagents were obtained from Sigma (Poole, UK).
For transient transfections, 1.2 x 106 GH3 cells were grown in 10-cm dishes for 24 h and then transfected using Fugene 6 (Roche Molecular Biochemicals, Mannheim, Germany) according to the protocol of the manufacturer. For cotransfection studies, the total amount of DNA used was held constant by addition of empty expression vector. After 24 h, cells were trypsinized and seeded onto 24-well plates.
For luciferase assays, 105 cells per well were grown in 24-well plates, serum starved for 24 h, and then stimulated as indicated. Cells were washed twice with ice-cold PBS and lysates (25 mM Tris/PO4, 10 mM MgCl2, 5 mM EDTA, 15% glycerol, 0.1% Triton X-100, and 0.1 mg/ml BSA) were prepared. The luciferase activity was measured using a Berthold Mithras 960 luminometer (Berthold Technologies, Redbourn, UK). Four to eight replicates were analyzed for each treatment group, and experiments were performed at least three times. Results are shown as mean ± SD fold induction of at least three independent experiments. For statistical analysis, P values were calculated using Students t test.
Real-time PCR
For real-time PCR analysis, GH3 cells were grown in 25-cm2 flasks (
5 x 106 cells), serum starved for 24 h, and then stimulated with 10 ng/ml TNF-
for the indicated times. Cells were harvested by trypsinization and washed twice in ice-cold PBS. Total RNA was isolated using the QIAGEN (Hilden, Germany) RNAeasy kit, and cDNA was generated with the Omniscript RT system (QIAGEN). Quantitative real-time PCR using the Stratagene Mx3000 P thermocycler and the SYBRgreen Jump Start Taq Ready Mix (Sigma) was performed as follows: 10 min at 95 C, followed by 40 cycles of 15 sec at 95 C, 1 min at 56 C, and 30 sec at 72 C. The following primers were used: cyclophilin, TTTTCGCCGCTTGCTGCAGAC and CACCCTGGCACATGAATCC-TGGA; prolactin, AGCCAAGTGTCAGCCCG-GAAAG and TGGCCTTGGCAATAAACTCACGA. This resulted in amplicons of 217 and 227 bp, respectively. The dissociation curves of used primer pairs showed a single peak, and samples after PCR reactions had a single DNA band of the expected size in an agarose gel. Cyclophilin was used as a housekeeping gene for normalization. Data are shown as average ± SD of three independent experiments.
Real-time luminescence imaging
GH3/hPrl-luc cells (105) were seeded onto 35-mm glass coverslip-based dishes (Iwaki, Tokyo, Japan), cultured in 10% fetal calf serum, and then serum starved for 24 h before imaging. Luciferin (final concentration, 1 mM; Bio-Synth, Staad, Switzerland) was added at least 10 h before the start of the experiment, and the cells were transferred to the stage of a Zeiss (Welwyn Garden City, UK) Axiovert 100M in a dark room. The cells on the stage were maintained at 37 C in a Zeiss incubator M with 5% CO2-95% air. Bright-field images were taken before and after luminescence imaging to allow localization of the cells. Luminescence images were obtained using a Fluar x20, 0.75 numerical aperture, dry objective and captured using a photon-counting charge-coupled device camera (Orca II; Hamamatsu Photonics, Welwyn Garden City, UK). Sequential images, integrated over 30 min, were taken using 4 x 4 binning and acquired using Kinetic Imaging software AQM6 (Andor, Belfast, UK). TNF-
at 10 ng/ml was added directly to the dish immediately before commencing the experiment.
Analysis was performed using Kinetic Imaging software AQM6. Regions of interest were drawn around each single cell, and total photon counts for individual cell areas were integrated over 30 min intervals. Mean intensity data were collected after the average instrument dark count (corrected for the number of pixels being used) was subtracted from the luminescence signal.
Data were analyzed using the Cluster peak detection algorithm (33) to detect significant peaks [>12 (background + 2 SD)] in luciferase activity. Additional data analysis was performed with Excel (Microsoft, Seattle, WA) and SPSS statistics package (SPSS, Chicago, IL).
Western blotting
GH3 cells were seeded in 60-mm dishes at a density of 2 x 106 cells in 6 ml and serum starved for 24 h before stimulation. Separate dishes were stimulated with 10 ng/ml TNF-
for the indicated times. Cells were washed with ice-cold PBS and lysed with ice-cold lysis buffer [1% SDS, 10% glycerol, 1% b-mercaptoethanol, and 62.5 mM Tris-HCl (pH 6.8)] containing a protease and phosphatase inhibitor cocktail (Sigma). Samples were collected, heated at 100 C for 5 min, and sonicated for 10 sec. Proteins were separated by electrophoresis on SDS-polyacrylamide (7.5%) gels and electrotransferred onto nitrocellulose. Nonspecific binding sites were blocked with 5% dried skimmed milk in 0.05% Tween 20 supplemented Tris-buffered saline (TTBS) [25 mM Tris-HCl (pH 8.0) and 150 mM NaCl]. Nitrocellulose membranes were incubated overnight at 4 C with either phospho-p65, p65, or I
B
monoclonal antibodies (Cell Signaling Technologies, Beverly, MA). The membranes were then washed extensively in TTBS and incubated with goat antirabbit IgG conjugated to horseradish peroxidase for 1 h at room temperature, followed by extensive washing in TTBS. Positive immunoreactive bands were detected by chemiluminescence using SuperSignal West Pico according to the instructions of the manufacturer (Pierce, Rockford, IL).
Detection of transcription factor activation
GH3 cells were seeded in 60-mm dishes at a density of 2 x 106 cells in 6 ml and serum starved for 24 h before stimulation. Separate dishes were stimulated with 10 ng/ml TNF-
for the indicated times. A TransAM NF-
B p65 Chemi transcription factor assay kit (Activemotif, Rixensart, Belgium) was used according to the instructions of the manufacturer. Briefly, the kit comprised a 96-well plate with immobilized NF-
B consensus binding site oligonucleotide. Cells were lysed with 100 µl of the provided lysis buffer, and 10 µl of lysed sample was used per well. Activated NF-
B from the whole-cell extracts specifically bound to the oligonucleotide and was detected using an antibody against the p65 subunit. A secondary antibody conjugated to horseradish peroxidase provided a chemiluminescent readout. Jurkat nuclear extract was used as a positive control (data not shown), and a blank well was run for background luminescence subtraction. All reactions were performed in duplicate, and results are shown as the average ± SEM of two independent experiments.
Real-time fluorescence imaging
GH3 cells (2 x 105) were seeded onto 35-mm glass-based dishes (Iwaki) and cultured in 10% fetal calf serum. After 24 h, cells were transiently transfected with CMV-p65-dsRedXP and either CMV-I
Ba-EGFP or NF-I
Ba-EGFP, driven by five tandem repeats of a consensus NF-
B binding site (30) using Fugene 6. Cells were imaged 24 h after transfection on a Zeiss Axiovert 200 equipped with an XL incubator (maintained at 37 C, 5% CO2, in humid conditions) through a x63 objective (numerical aperture, 1.4; Zeiss). Excitation of EGFP was performed using an argon ion laser at 488 nm. Emitted light was captured through a 505550 nm bandpass filter from a 545 nm dichroic mirror. dsRedXP fluorescence was excited using a helium-neon laser (543 nm) and detected through a 560 nm long-pass filter. Images were taken every 5 min. Data were captured and analyzed using LSM510 software.
| Results |
|---|
|
|
|---|
activates the human prolactin promoter
in the transcriptional regulation of pituitary prolactin expression, we have used GH3 cells stably expressing luciferase under the control of a 5000 bp fragment of the human prolactin promoter (32). This promoter is activated by TNF-
in a dose-dependent manner, with maximal effects seen at 2 ng/ml (P < 0.05), with significantly greater induction at 24 h compared with 6 h (Fig. 1A
, confirming the specificity of this response and that it was not an artifact due to cryptic response elements in the reporter vector (Fig. 1A
, GH3 cells were treated with TNF-
, and total RNA was prepared and subjected to real-time PCR analysis. These experiments revealed that the endogenous rat prolactin gene is activated by TNF-
in a similar manner to the human prolactin promoter reporter gene construct, with a similar magnitude and time course of response (Fig. 1C
|
, and Cluster analysis of the transcriptional response in single cells was performed (n = 116 cells from seven experiments for TNF-
treatment; n = 75 cells from four experiments for resting conditions). Microscopic analysis of whole fields of cells confirmed the biphasic response pattern observed using luminometry (Fig. 2A
treatment that could be classified into three predominant patterns: an early peak, a late peak, or more than one peak in promoter activity. Examples of individual cells showing the three typical patterns observed are shown in Fig. 2
treatment between 0 and 14 h (termed period 1) for 41 ± 4% of the cells (compared with 20 ± 8% under resting conditions); at 2034 h after addition of TNF-
(termed period 2), 59 ± 7% of cells showed a pulse in transcription (compared with 20 ± 4% control). A total of 16 ± 5% of TNF-
treated cells (compared with 55 ± 8% control) showed no peak during the whole experiment (Fig. 2B
treatment is due to activation of more cells rather than due to a simultaneous graded increase of expression levels in all cells.
|
activates the NF-
B signaling pathway in GH3 cells
B, we first wanted to establish whether TNF-
can activate NF-
B in pituitary GH3 cells. Western blot analysis for p65, phospho-p65, and I
B
was performed with lysates from GH3 cells treated with TNF-
for 02 h (Fig. 3A
led to a rapid transient increase in phosphorylation of p65 that lasted for approximately 30 min and was followed by a decrease below basal levels. Degradation of I
B
was observed after 2030 min with subsequent recovery to pretreatment level after 2 h. Using a DNA/protein interaction assay for p65, we found an increase in complex formation using lysates from GH3 cells treated with TNF-
for 3060 min (Fig. 3B
B
degradation and p65 phosphorylation after TNF-
stimulation was associated with transcriptional activation, GH3 cells were transiently transfected with a reporter construct containing five repeats of the NF-
B consensus binding sequence linked to the luciferase gene (pNF-
B-luc). Treatment of these cells with TNF-
caused a time-dependent (Fig. 3C
is indeed able to stimulate gene transcription via activation of the NF-
B signaling pathway in GH3 cells. We then transiently transfected GH3 cells with expression vectors encoding p65-dsRedXP and I
B
-EGFP under the control of the strong human CMV (30, 31) and used dual-fluorescence time-lapse imaging to observe and quantitate dynamic changes in the nuclear/cytoplasmic localization ratio of p65 and the level of cytoplasmic I
B
in single transfected cells. TNF-
treatment led to rapid degradation of I
B
and nuclear translocation of p65 (Fig. 3D
B
-EGFP (driven by five tandem repeats of a consensus NF-
B binding motif, as described previously (Ref.31)], alongside CMV-p65-dsRedXP. Addition of TNF-
to the medium led to a rapid decrease in cytoplasmic I
B
, reaching a minimum after 1 h and subsequent recovery to pretreatment levels after approximately 2 h. The degradation of I
B
was accompanied by a transient nuclear translocation of p65 as before (Fig. 3
|
activation of the prolactin promoter is mediated by the NF-
B signaling pathway
B signaling pathway (Fig. 4
B in cyclin D1 transcription (36). Cotransfection of wild-type IKKß led to an increase in basal expression levels from the prolactin promoter but no change in fold induction (Fig. 4A
completely and slightly decreased basal expression (Fig. 4B
(16) or truncated I
B
(
I
B
) also abolished the increase in transcription after TNF-
treatment but had no effect on basal expression levels (Fig. 4
also had no effect on basal levels and had a reduced inhibitory effect on the response to TNF-
(Fig. 4E
stimulation of the prolactin promoter is mediated via the NF-
B pathway.
|
interacts with other signaling pathways to modulate prolactin gene expression
is a potent stimulus of the human prolactin promoter, we analyzed its interactions with other physiologically important positive or negative regulators of prolactin gene expression such as FGF-2 and glucocorticoids (9, 37). GH3/Prl-luc cells were treated with FGF-2, dexamethasone, or estradiol, alone or in combination with TNF-
(Fig. 5
and FGF-2 in combination led to an additional increase in promoter activation (Fig. 5A
act independently and use different signaling pathways. This is further supported by the fact that, whereas TNF-
was able to induce expression of luciferase from the pNF-
B-luc reporter construct, FGF-2 was not (data not shown), indicating that FGF-2, unlike TNF-
, does not activate NF-
B.
|
B signaling in a variety of systems (39, 40). In GH3/hPrl-luc cells, treatment with 10 nM dexamethasone had no effect on luciferase activity after 6 h but decreased gene expression by about 50% after 24 h. When given in combination with TNF-
, dexamethasone completely abolished the TNF-
induction of the human prolactin promoter not only after 24 h but also after 6 h (Fig. 5B
B-luc reporter construct dexamethasone failed completely to repress TNF-
activation (Fig. 5B
induction of this promoter in other cells such as HeLa cells (39).
Whereas previous studies have revealed an estrogen response element in the rat prolactin promoter, studies on the human prolactin promoter so far have not shown major effects of estrogen (9, 41). Treatment of GH3/hPrl-luc cells with 10 nM estradiol alone or in combination with 10 ng/ml TNF-
had no effect on the activity of the human prolactin promoter after 6 h. After 24 h, estradiol gave a consistent but small 1.5-fold induction, but, in combination with 10 ng/ml TNF-
, estradiol led to a synergistic 2- to 3-fold increase in gene activation (Fig. 5C
).
| Discussion |
|---|
|
|
|---|
activates the human prolactin gene promoter in GH3 pituitary cells and significantly modulates the effects of other important physiological regulators of prolactin expression, such as estrogen, FGF-2, and glucocorticoids. Cotransfection studies with dominant-negative proteins of the NF-
B signaling pathway have shown that this regulation is mediated via NF-
B.
Prolactin gene expression is regulated by various hypothalamic factors, but, in recent studies, an increasing number of intrapituitary factors have also been identified as important regulators (11). Here we show for the first time that, in pituitary GH3 cells, the cytokine TNF-
is able to activate the prolactin promoter in a dose- and time-dependent manner and also that expression of the endogenous rat prolactin gene is similarly stimulated by TNF-
. Because prolactin is thought to play a role in the stress response, our data, together with findings showing expression of TNF-
(18, 19) and its receptors (20, 21) in the pituitary, suggest that TNF-
might be an important paracrine or autocrine factor involved in the modulation of prolactin expression. Studies of TNF-
effects on prolactin using primary pituitary cells have so far focused on hormone secretion and have shown conflicting results (23, 24, 25, 26, 27). The discrepancy in these studies is most likely due to differences in the experimental design and model systems used. A recent study on primary lactotrophs from female rats showed an apoptotic effect of TNF-
(42) but used much higher (50 ng/ml) concentrations than we have used (210 ng/ml). Using flow cytometry, we have seen no evidence of increased apoptosis in GH3 cells with 10 ng/ml TNF-
for periods up to 30 h (data not shown). However, the effect of TNF-
on prolactin gene expression in primary cell cultures or in vivo remains the subject of additional investigation.
We and others have found that gene promoter activity in clonal pituitary cell lines is highly dynamic and variable among different individual cells, with rapid fluctuations in transcriptional activity in resting cells as well as in hormone-treated cells (32, 43). This is a phenomenon also found in normal pituitary cells using microinjection of reporter plasmids (44) or transfection with recombinant adenoviruses (34). Here we show that stimulation of GH3/hPrl-luc cells with TNF-
is accompanied by heterogeneous changes in prolactin promoter activity, with increased proportions of cells displaying transient peaks or pulses in transcription, with the overall effect that more cells become transcriptionally active. The cells in our study were a clonal cell line, as opposed to a mixed population of cells seen in the normal pituitary gland: thus, the heterogeneity we have seen arises from different transcriptional patterns among individual cells in a single cell population. All of the cells in the population can express the transgene but at varying levels, so that some cells exhibiting very low levels of gene expression at a given time may then become transcriptionally active at different rates and time points after a stimulus.
There are two theoretical mechanisms to regulate transcription from a gene promoter. Transcriptional enhancers might increase the probability that a promoter is active, meaning that genes are either "off" or "on" (binary behavior), or they might increase the rate of gene transcription modulating a continuous range of activity (45, 46). Studies in yeast suggest that a promoter can adopt either binary or graded behavior depending on the signaling pathway involved (47). The data we report here would favor a stochastic (or binary) model of gene transcription, because we have found an increased number of transcriptionally active cells after the stimulation with TNF-
rather than a simultaneous graded increase in promoter activity in all cells. Furthermore, the cells showed transient peaks of activity with a substantial number of cells showing more than one peak rather than constant transcription levels, underlining the stochastic nature of this process. These stochastic changes in transcription phenotype in single cells are most likely caused by the relative instability of transcription complexes. This would be consistent with recent findings of dynamic recruitment and release of transcription regulators to chromatin (48, 49). Stochastic patterns of transcription may be physiologically important in determining the way in which cells integrate their patterns of response to combinations of physiological regulators (50).
TNF-
can activate transcription factors such as activator protein-1 and NF-
B, which may override the apoptotic pathways (13). Stimulation of NF-
B activates the IKK signal- some that phosphorylates I
B and NF-
B proteins, leading to ubiquitination and degradation of I
B and subsequent translocation of free NF-
B dimers to the nucleus (14, 17). In agreement with this, we found rapid phosphorylation and transient nuclear translocation of p65 as well as degradation of cytoplasmic I
Ba in TNF-
-stimulated GH3 cells. In agreement with our previous studies in other cell types (30), we observed highly damped oscillations in the level of nuclear NF-
B, which had a period of about 90 min. These cycles of NF-
B translocation have been associated with cycles of reactivation of NF-
B (measured by Ser536 phosphorylation) that maintain NF-
B-dependent gene expression. As described in other cell types (30), the use of a consensus NF-
B promoter in front of the I
B
-EGFP reporter led to oscillations in cytoplasmic EGFP fluorescence level and an increase in p65 oscillation period (data not shown). Indeed, using NF-
B-responsive reporter gene constructs, we showed that NF-
B translocation and I
B
degradation is accompanied by dose- and time-dependent increase in NF-
B-mediated transcription. These findings are supported by a previous study showing increased protein/DNA complex formation in EMSAs using nuclear extracts from GH3 cells treated with TNF-
(51). Together, our evidence strongly suggests that TNF-
is able to activate the NF-
B signaling pathway in GH3 cells.
Activity of the IKK complex is crucial for the activation of NF-
B (16). Disruption of its activity by expression of dominant-negative variants of IKK
or IKKß has been used in previous studies to show NF-
B involvement in transcriptional regulation of the cyclin D1 gene (36). Here we found that expression of dominant-negative IKKs abolished induction of the prolactin promoter activity by TNF-
in GH3 cells, suggesting that the TNF-
effect specifically is mediated by NF-
B. This is further supported by our finding that expression of a truncated form of I
B
(
I
B
) that cannot be phosphorylated/degraded (and therefore abolishes NF-
B activation by preventing its translocation to the nucleus) also blocks activation of the prolactin promoter by TNF-
. Forskolin and FGF-2 regulation of the prolactin promoter were independent of NF-
B. This was expected from previous reports showing that regulation by FGF-2 involves a Rac1-, phospholipase C
-, protein kinase C
-, and ERK-dependent mechanism (52), whereas forskolin increases intracellular cAMP levels to activate PKA.
Our results show that TNF-
not only activates the human prolactin promoter but also interacts with other well-known regulators of prolactin expression. Simultaneous treatment of GH3/hPrl-luc cells with TNF-
and FGF-2 led to a significant additive effect on promoter activation. FGF-2 did not activate NF-
B in pituitary GH3 cells, and therefore independent activation of distinct signaling pathways may explain the additional effect. Dexamethasone blocked activation of the prolactin promoter by TNF-
. The repressive effect of glucocorticoids on the expression of prolactin involves interaction between Pit-1 and glucocorticoid receptor (GR), but binding of GR to DNA is not required (38). The loss of activation by TNF-
in the presence of dexamethasone could therefore be explained by either loss of NF-
B transactivation due to negative cross-talk with GR or by independent glucocorticoid repression of the prolactin promoter overriding the TNF-
activation. In contrast to results in other cell types (39), dexamethasone did not alter transcriptional activation of a reporter gene construct containing five NF-
B response elements by TNF-
in GH3 cells, arguing against a direct effect of GR on NF-
B signaling pathways in these cells and suggesting that this effect was characteristic of the prolactin promoter but not of a consensus NF-
B promoter. Bioinformatic analysis has revealed two potential NF-
B binding sites at 1300/1309 and 3810/3819 bp in the human prolactin promoter, but preliminary experiments suggest that they may not be involved in these effects of TNF-
(data not shown), suggesting that a more complex mechanism may be involved, as shown for other genes such as IL-6 and cyclooxygenase-2 (53, 54, 55). NF-
B regulation of prolactin might therefore involve other factors, and the discrepancy in dexamethasone repression seen here may be explained by GR blocking interaction of NF-
B with some yet unknown factor. Understanding of this interesting behavior requires additional, more detailed study.
Despite the effect of estrogen on the rat prolactin promoter (41) and the well-known in vivo effect on prolactin production in man, previous studies have shown little or no estrogen effect on human prolactin promoter activity (9, 41). Here we show a small but consistent activation of the prolactin promoter by estrogen after 24 h but not after 6 h. Interestingly, compared with treatment with either TNF-
or estrogen alone, stimulation of GH3/hPrl-luc cells with a combination of both stimuli led to a synergistic large increase in promoter activity. Recent studies have demonstrated molecular cross-talk between estrogen receptor (ER) and NF-
B (52). Most studies have found inhibition of NF-
B signaling by ER and suggested a series of molecular mechanisms for this antagonism, including direct inhibition of DNA binding, effects of the ER on I
B processing, or interference with coactivator recruitment (56). Synergistic interaction between estrogen and NF-
B signaling appears to be unusual but has been shown previously for the serotonin 5-HT1A receptor promoter (57). It will be interesting to determine the molecular mechanisms by which ER and NF-
B may differentially cross-regulate their effects in different cell types and at different promoters. This interaction between TNF-
and estrogen is likely to be biologically important, given the major role of estrogen in normal pituitary physiology and possibly in pituitary adenoma formation.
In conclusion, we have shown for the first time that TNF-
can activate the human prolactin promoter and that this effect is mediated by NF-
B. TNF-
and TNF-
receptors are produced locally in the pituitary gland (18, 19, 20, 21), suggesting that this effect could be important in vivo. We show that other important physiological regulators of prolactin expression, such as estrogen, interact with TNF-
to give rise to synergistic regulation of prolactin expression. Together, these data suggest that TNF-
and NF-
B regulation of the prolactin gene is likely to be important for pituitary physiology in vivo.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online October 27, 2005
Abbreviations: CMV, Cytomegalovirus; EGFP, enhanced green fluorescent protein; ER, estrogen receptor; FGF-2, fibroblast growth factor-2; GR, glucocorticoid receptor; h, human; I
B, inhibitory protein
B; IKK, I
B kinase; luc, luciferase; NEMO, NF-
B essential modulator; NF-
B, nuclear factor
B; Prl, prolactin.
Received July 29, 2005.
Accepted for publication October 14, 2005.
| References |
|---|
|
|
|---|
. Histol Histopathol 15:13031325[Medline]
B: ten years after. Cell 87:1320[CrossRef][Medline]
B transcription factors. Oncogene 18:68536866[CrossRef][Medline]
B? Trends Cell Biol 10:129133[CrossRef][Medline]
B: a lesson in family values. Cell 80:529532[CrossRef][Medline]
(TNF-
) in the rat brain and pituitary in response in different models of systemic immune challenge. J Neuropathol Exp Neurol 58:6177[Medline]
in macrophages of heart, liver, kidney, and in the pituitary gland. Cell Tissue Res 285:3949[CrossRef][Medline]
: specific binding sites in rodent brain and pituitary gland. Eur Cytokine Netw 4:377381[Medline]
inhibits the hormonal response of the pituitary gland to hypothalamic releasing factors. Endocrinology 127:101106
increases release of arachidonate and prolactin from rat anterior pituitary cells. Endocrinology 128:27912798
on prolactin secretion from rat anterior pituitary and dopamine release from the hypothalamus: comparison with the effect of interleukin-1ß. Endocrinol Jpn 38:357361[Medline]
B kinase ß (IKKß) activation [corrected]. J Biol Chem 278:3856638570
B kinase and NF-
B in T lymphocytes. J Biol Chem 274:2292322931
B signaling control the dynamics of gene expression. Science 306:704708
B signalling and transcription in single living cells. J Cell Sci 115:11371148
B pathway in Swiss 3T3 cells. J Cell Biol 166:661672
B signalling is inhibited by glucocorticoid receptor and STAT6 via distinct mechanisms. J Cell Sci 116:24952503
B by allosteric effects on the glucocorticoid receptor DNA binding domain. J Biol Chem 279:5005050059
induces apoptosis of lactotropes from female rats. Endocrinology 143:36113617
B in GH3 pituitary cells. Mol Cell Endocrinol 106:915[CrossRef][Medline]
B activates IL-6 expression through cooperation with c-Jun and IL6-AP1 site, but is independent of its IL6-NF
B regulatory site in autocrine human multiple myeloma cells. Cancer Biol Ther 3:10071017[Medline]
B and CCAT/enhancer-binding protein-ß (C/EBP-ß) regulate the IL-6 promoter in autocrine human prostate cancer cells. Prostate 61:354370[CrossRef][Medline]
B induced COX2 expression following hypertonic stress. J Biol Chem 279:1635416359
B. Trends Endocrinol Metab 16:4652[CrossRef][Medline]
B and estrogen. Mol Endocrinol 15:543552This article has been cited by other articles:
![]() |
L. Ashall, C. A. Horton, D. E. Nelson, P. Paszek, C. V. Harper, K. Sillitoe, S. Ryan, D. G. Spiller, J. F. Unitt, D. S. Broomhead, et al. Pulsatile Stimulation Determines Timing and Specificity of NF-{kappa}B-Dependent Transcription Science, April 10, 2009; 324(5924): 242 - 246. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Semprini, S. Friedrichsen, C. V. Harper, J. R. McNeilly, A. D. Adamson, D. G. Spiller, N. Kotelevtseva, G. Brooker, D. G. Brownstein, A. S. McNeilly, et al. Real-Time Visualization of Human Prolactin Alternate Promoter Usage in Vivo Using a Double-Transgenic Rat Model Mol. Endocrinol., April 1, 2009; 23(4): 529 - 538. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Utreras, A. Futatsugi, P. Rudrabhatla, J. Keller, M. J. Iadarola, H. C. Pant, and A. B. Kulkarni Tumor Necrosis Factor-{alpha} Regulates Cyclin-dependent Kinase 5 Activity during Pain Signaling through Transcriptional Activation of p35 J. Biol. Chem., January 23, 2009; 284(4): 2275 - 2284. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Adamson, S. Friedrichsen, S. Semprini, C. V. Harper, J. J. Mullins, M. R. H. White, and J. R. E. Davis Human Prolactin Gene Promoter Regulation by Estrogen: Convergence with Tumor Necrosis Factor-{alpha} Signaling Endocrinology, February 1, 2008; 149(2): 687 - 694. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |