help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2005-0967
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/2/773    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Friedrichsen, S.
Right arrow Articles by Davis, J. R. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Friedrichsen, S.
Right arrow Articles by Davis, J. R. E.
Right arrowPubmed/NCBI databases
*Substance via MeSH
Endocrinology Vol. 147, No. 2 773-781
Copyright © 2006 by The Endocrine Society

Tumor Necrosis Factor-{alpha} Activates the Human Prolactin Gene Promoter via Nuclear Factor-{kappa}B Signaling

Sönke Friedrichsen, Claire V. Harper, Sabrina Semprini, Michael Wilding, Antony D. Adamson, Dave G. Spiller, Glyn Nelson, John J. Mullins, Michael R. H. White and Julian R. E. Davis

Endocrine Science Research Group (S.F., M.W., A.D.A., J.R.E.D.), University of Manchester, Manchester M13 9PT, United Kingdom; Centre for Cell Imaging (C.V.H., D.G.S., G.N., M.R.H.W.), School of Biological Sciences, University of Liverpool, Liverpool L69 7ZB, United Kingdom; and Molecular Physiology Group (S.S., J.J.M.), University of Edinburgh Medical School, Edinburgh EH16 4TJ, Scotland, United Kingdom

Address all correspondence and requests for reprints to: Prof. Julian Davis, Endocrine Science Research Group School of Biological Sciences, University of Manchester, Oxford Road, Manchester M13 9PT, United Kingdom. E-mail: julian.davis{at}manchester.ac.uk; or Prof. Michael White, School of Biological Sciences, Centre for Cell Imaging, University of Liverpool, Liverpool L69 7ZB, United Kingdom. E-mail: m.white{at}liverpool.ac.uk.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pituitary function has been shown to be regulated by an increasing number of intrapituitary factors, including cytokines. Here we show that the important cytokine TNF-{alpha} activates prolactin gene transcription in pituitary GH3 cells stably expressing luciferase under control of 5 kb of the human prolactin promoter. Similar regulation of the endogenous rat prolactin gene by TNF-{alpha} in GH3 cells was confirmed using real-time PCR. Luminescence microscopy revealed heterogeneous dynamic response patterns of promoter activity in individual cells. In GH3 cells treated with TNF-{alpha}, Western blot analysis showed rapid inhibitory protein {kappa}B (I{kappa}B{alpha}) degradation and phosphorylation of p65. Confocal microscopy of cells expressing fluorescence-labeled p65 and I{kappa}B{alpha} fusion proteins showed transient cytoplasmic-nuclear translocation and subsequent oscillations in p65 localization and confirmed I{kappa}B{alpha} degradation. This was associated with increased nuclear factor {kappa}B (NF-{kappa}B)-mediated transcription from an NF-{kappa}B-responsive luciferase reporter construct. Disruption of NF-{kappa}B signaling by expression of dominant-negative variants of I{kappa}B kinases or truncated I{kappa}B{alpha} abolished TNF-{alpha} activation of the prolactin promoter, suggesting that this effect was mediated by NF-{kappa}B. TNF-{alpha} signaling was found to interact with other endocrine signals to regulate prolactin gene expression and is likely to be a major paracrine modulator of lactotroph function.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
THE HUMAN PROLACTIN gene (hPrl) is located on the short arm of chromosome 6 (1) and consists of five coding exons within a region of 10 kb. It is expressed in lactotroph cells in the anterior pituitary but is also expressed in the endometrium (2, 3) and myometrium (4) of the uterus and in lymphoid cells (5, 6). In pituitary cells, prolactin gene expression is regulated in response to multiple hormonal signals by an extensive 5'-flanking region extending 5000 bp upstream from the transcriptional start site, containing multiple binding sites for Pit-1 (7, 8, 9, 10). Prolactin mRNA transcribed in extrapituitary tissues contains an additional noncoding exon 1a, and expression is regulated by an alternate upstream promoter. Pituitary prolactin expression in vivo is regulated by dopamine and other hypothalamic factors such as TRH and by an increasing number of intrapituitary factors (11). In addition to growth factors, such as fibroblast growth factor-2 (FGF-2) or epidermal growth factor, and other proteins, such as galanin, recent evidence has shown that cytokines are also expressed in the pituitary gland and are likely to act as important paracrine or autocrine regulators of pituitary function (11, 12).

TNF-{alpha} is a cytokine that plays a role in a variety of biological processes, including cell proliferation, differentiation, and apoptosis. Furthermore, it can activate transcription factors such as nuclear factor {kappa}B (NF-{kappa}B) and activator protein-1 (13). NF-{kappa}B transcription factors consist of homodimers or heterodimers assembled from subunits including, p50, p52, p65, c-Rel, and Rel B (14), and are involved in the regulation of many genes (15). In the cytoplasm, NF-{kappa}B is bound by inhibitory {kappa}B proteins (I{kappa}B proteins) that block its nuclear localization domain (14). Activation of I{kappa}B kinases IKK{alpha} and IKKß (16) leads to phosphorylation of I{kappa}Bs, which targets them for rapid degradation by the proteasome (17). The released NF-{kappa}B dimers can then translocate to the nucleus and regulate target gene transcription.

TNF-{alpha} is expressed in multiple tissues, including brain and pituitary (18). In the pituitary, expression of TNF-{alpha} has been found in the intermediate lobe and in somatotroph cells (19). The presence of TNF-{alpha} receptors in the pituitary cells has also been reported in vitro and in vivo (20, 21), suggesting that TNF-{alpha} might well play a role as an autocrine or paracrine regulator.

Studies on the effect of TNF-{alpha} on the secretion of pituitary hormones have revealed an effect on ACTH, GH, TSH, and prolactin release (12, 22). The results regarding the effect on prolactin are conflicting. Using mouse hemipituitaries, Milenkovic et al. (23) showed no effect, whereas others using dispersed primary rat pituitary cells showed an decrease (24, 25) or an increase (26, 27) in prolactin release after TNF-{alpha} treatment.

Here we report that TNF-{alpha} is a potent activator of prolactin promoter activity in pituitary cells, with a biphasic effect over 6–24 h. Heterogeneous patterns of response in individual cells led to the observed averaged population response. The effect of TNF-{alpha} is associated with activation of NF-{kappa}B and could be blocked by coexpressing dominant-negative isoforms of components of the NF-{kappa}B signaling pathway. The effects of TNF-{alpha} were amplified by simultaneous treatment with a range of other hormonal stimuli, suggesting a physiological role as a major modulator of other signaling pathways in determining physiological outcome.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Plasmids
Plasmids expressing the transdominant-negative IKK{alpha}, IKKß, and NF-{kappa}B essential modulator (NEMO)/IKK{gamma} were a gift from Dr. N. Inohara (University of Michigan, Ann Arbor, MI) (28). The expression plasmid for truncated I{kappa}B{alpha} (missing the 40 NH2-terminal amino acids) was a kind gift from Dr. E. Costello (University of Liverpool, Liverpool, UK), and the wild-type IKKß was from Dr. C. Paya (Mayo Clinic, Rochester, NY) (29). The pNF-{kappa}B-luciferase (luc) plasmid was from Stratagene (La Jolla, CA). The fluorescent cytomegalovirus (CMV)-I{kappa}B{alpha}-enhanced green fluorescent protein (EGFP), NF-I{kappa}B{alpha}-EGFP, and CMV-p65-dsRedXP fusions protein vectors were described previously (30, 31).

Cell culture and luciferase assays
The construction of the GH3/hPrl-luc cell line was described previously (32). Cells were maintained in DMEM with pyruvate/glutamax (Invitrogen, Paisley, UK) and the addition of 10% fetal calf serum (Harlan Sera-Lab, Crawley Down, UK). Except for TNF-{alpha} and FGF-2 (Merck Biosciences, Nottingham, UK), all other reagents were obtained from Sigma (Poole, UK).

For transient transfections, 1.2 x 106 GH3 cells were grown in 10-cm dishes for 24 h and then transfected using Fugene 6 (Roche Molecular Biochemicals, Mannheim, Germany) according to the protocol of the manufacturer. For cotransfection studies, the total amount of DNA used was held constant by addition of empty expression vector. After 24 h, cells were trypsinized and seeded onto 24-well plates.

For luciferase assays, 105 cells per well were grown in 24-well plates, serum starved for 24 h, and then stimulated as indicated. Cells were washed twice with ice-cold PBS and lysates (25 mM Tris/PO4, 10 mM MgCl2, 5 mM EDTA, 15% glycerol, 0.1% Triton X-100, and 0.1 mg/ml BSA) were prepared. The luciferase activity was measured using a Berthold Mithras 960 luminometer (Berthold Technologies, Redbourn, UK). Four to eight replicates were analyzed for each treatment group, and experiments were performed at least three times. Results are shown as mean ± SD fold induction of at least three independent experiments. For statistical analysis, P values were calculated using Student’s t test.

Real-time PCR
For real-time PCR analysis, GH3 cells were grown in 25-cm2 flasks (~5 x 106 cells), serum starved for 24 h, and then stimulated with 10 ng/ml TNF-{alpha} for the indicated times. Cells were harvested by trypsinization and washed twice in ice-cold PBS. Total RNA was isolated using the QIAGEN (Hilden, Germany) RNAeasy kit, and cDNA was generated with the Omniscript RT system (QIAGEN). Quantitative real-time PCR using the Stratagene Mx3000 P thermocycler and the SYBRgreen Jump Start Taq Ready Mix (Sigma) was performed as follows: 10 min at 95 C, followed by 40 cycles of 15 sec at 95 C, 1 min at 56 C, and 30 sec at 72 C. The following primers were used: cyclophilin, TTTTCGCCGCTTGCTGCAGAC and CACCCTGGCACATGAATCC-TGGA; prolactin, AGCCAAGTGTCAGCCCG-GAAAG and TGGCCTTGGCAATAAACTCACGA. This resulted in amplicons of 217 and 227 bp, respectively. The dissociation curves of used primer pairs showed a single peak, and samples after PCR reactions had a single DNA band of the expected size in an agarose gel. Cyclophilin was used as a housekeeping gene for normalization. Data are shown as average ± SD of three independent experiments.

Real-time luminescence imaging
GH3/hPrl-luc cells (105) were seeded onto 35-mm glass coverslip-based dishes (Iwaki, Tokyo, Japan), cultured in 10% fetal calf serum, and then serum starved for 24 h before imaging. Luciferin (final concentration, 1 mM; Bio-Synth, Staad, Switzerland) was added at least 10 h before the start of the experiment, and the cells were transferred to the stage of a Zeiss (Welwyn Garden City, UK) Axiovert 100M in a dark room. The cells on the stage were maintained at 37 C in a Zeiss incubator M with 5% CO2-95% air. Bright-field images were taken before and after luminescence imaging to allow localization of the cells. Luminescence images were obtained using a Fluar x20, 0.75 numerical aperture, dry objective and captured using a photon-counting charge-coupled device camera (Orca II; Hamamatsu Photonics, Welwyn Garden City, UK). Sequential images, integrated over 30 min, were taken using 4 x 4 binning and acquired using Kinetic Imaging software AQM6 (Andor, Belfast, UK). TNF-{alpha} at 10 ng/ml was added directly to the dish immediately before commencing the experiment.

Analysis was performed using Kinetic Imaging software AQM6. Regions of interest were drawn around each single cell, and total photon counts for individual cell areas were integrated over 30 min intervals. Mean intensity data were collected after the average instrument dark count (corrected for the number of pixels being used) was subtracted from the luminescence signal.

Data were analyzed using the Cluster peak detection algorithm (33) to detect significant peaks [>12 (background + 2 SD)] in luciferase activity. Additional data analysis was performed with Excel (Microsoft, Seattle, WA) and SPSS statistics package (SPSS, Chicago, IL).

Western blotting
GH3 cells were seeded in 60-mm dishes at a density of 2 x 106 cells in 6 ml and serum starved for 24 h before stimulation. Separate dishes were stimulated with 10 ng/ml TNF-{alpha} for the indicated times. Cells were washed with ice-cold PBS and lysed with ice-cold lysis buffer [1% SDS, 10% glycerol, 1% b-mercaptoethanol, and 62.5 mM Tris-HCl (pH 6.8)] containing a protease and phosphatase inhibitor cocktail (Sigma). Samples were collected, heated at 100 C for 5 min, and sonicated for 10 sec. Proteins were separated by electrophoresis on SDS-polyacrylamide (7.5%) gels and electrotransferred onto nitrocellulose. Nonspecific binding sites were blocked with 5% dried skimmed milk in 0.05% Tween 20 supplemented Tris-buffered saline (TTBS) [25 mM Tris-HCl (pH 8.0) and 150 mM NaCl]. Nitrocellulose membranes were incubated overnight at 4 C with either phospho-p65, p65, or I{kappa}B{alpha} monoclonal antibodies (Cell Signaling Technologies, Beverly, MA). The membranes were then washed extensively in TTBS and incubated with goat antirabbit IgG conjugated to horseradish peroxidase for 1 h at room temperature, followed by extensive washing in TTBS. Positive immunoreactive bands were detected by chemiluminescence using SuperSignal West Pico according to the instructions of the manufacturer (Pierce, Rockford, IL).

Detection of transcription factor activation
GH3 cells were seeded in 60-mm dishes at a density of 2 x 106 cells in 6 ml and serum starved for 24 h before stimulation. Separate dishes were stimulated with 10 ng/ml TNF-{alpha} for the indicated times. A TransAM NF-{kappa}B p65 Chemi transcription factor assay kit (Activemotif, Rixensart, Belgium) was used according to the instructions of the manufacturer. Briefly, the kit comprised a 96-well plate with immobilized NF-{kappa}B consensus binding site oligonucleotide. Cells were lysed with 100 µl of the provided lysis buffer, and 10 µl of lysed sample was used per well. Activated NF-{kappa}B from the whole-cell extracts specifically bound to the oligonucleotide and was detected using an antibody against the p65 subunit. A secondary antibody conjugated to horseradish peroxidase provided a chemiluminescent readout. Jurkat nuclear extract was used as a positive control (data not shown), and a blank well was run for background luminescence subtraction. All reactions were performed in duplicate, and results are shown as the average ± SEM of two independent experiments.

Real-time fluorescence imaging
GH3 cells (2 x 105) were seeded onto 35-mm glass-based dishes (Iwaki) and cultured in 10% fetal calf serum. After 24 h, cells were transiently transfected with CMV-p65-dsRedXP and either CMV-I{kappa}Ba-EGFP or NF-I{kappa}Ba-EGFP, driven by five tandem repeats of a consensus NF-{kappa}B binding site (30) using Fugene 6. Cells were imaged 24 h after transfection on a Zeiss Axiovert 200 equipped with an XL incubator (maintained at 37 C, 5% CO2, in humid conditions) through a x63 objective (numerical aperture, 1.4; Zeiss). Excitation of EGFP was performed using an argon ion laser at 488 nm. Emitted light was captured through a 505–550 nm bandpass filter from a 545 nm dichroic mirror. dsRedXP fluorescence was excited using a helium-neon laser (543 nm) and detected through a 560 nm long-pass filter. Images were taken every 5 min. Data were captured and analyzed using LSM510 software.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
TNF-{alpha} activates the human prolactin promoter
To evaluate the role of TNF-{alpha} in the transcriptional regulation of pituitary prolactin expression, we have used GH3 cells stably expressing luciferase under the control of a 5000 bp fragment of the human prolactin promoter (32). This promoter is activated by TNF-{alpha} in a dose-dependent manner, with maximal effects seen at 2 ng/ml (P < 0.05), with significantly greater induction at 24 h compared with 6 h (Fig. 1AGo). GH3 cell lines expressing luciferase under the control of a 500-bp GH promoter fragment showed no response to TNF-{alpha}, confirming the specificity of this response and that it was not an artifact due to cryptic response elements in the reporter vector (Fig. 1AGo, inset). Detailed time course experiments showed a clear biphasic response of transcription, with a transient plateau between 6 and 12 h (P < 0.05 after 2 h) and a second plateau reached by 24 h (Fig. 1BGo). To test whether the endogenous rat prolactin gene is also activated by TNF-{alpha}, GH3 cells were treated with TNF-{alpha}, and total RNA was prepared and subjected to real-time PCR analysis. These experiments revealed that the endogenous rat prolactin gene is activated by TNF-{alpha} in a similar manner to the human prolactin promoter reporter gene construct, with a similar magnitude and time course of response (Fig. 1CGo).



View larger version (11K):
[in this window]
[in a new window]
  		FIG. 1. Dose- and time-dependent activation of the prolactin promoter by TNF-{alpha}. GH3/hPrl-luc cells were serum starved for 24 h. Cells were then treated with the indicated doses of TNF-{alpha} for 6 h ({diamondsuit}) and 24 h ({square}) (A) or with 10 ng/ml TNF-{alpha} ({diamondsuit}) or not ({square}) for the indicated time periods (B). Inset in A, GH3 cells expressing luciferase under the control of 5000 bp of the hPrl or 500 bp of the hGH promoter were treated with TNF-{alpha} for 6 h. Basal expression levels for the hPrl promoter construct under these conditions were 5–10 times higher than for the hGH promoter. Cells were lysed, and luciferase activity was measured by luminometry. C, GH3 cells were treated as above with TNF-{alpha} for the indicated times. Cells were harvested, and RNA was prepared and subjected to real-time PCR analysis. Data were normalized using expression of the housekeeping gene cyclophilin. Results shown are the means ± SD from at least three independent experiments; *, P < 0.05.

 
Dynamics of transcriptional response in single cells
Previous work has shown that gene promoter activity in individual living cells is highly unstable and frequently pulsatile (32, 34, 35). Therefore, to analyze the contribution of single cells to the overall population response that was seen using analysis by luminometry, GH3/Prl-luc cells were imaged for 48 h either in resting conditions or after stimulation with TNF-{alpha}, and Cluster analysis of the transcriptional response in single cells was performed (n = 116 cells from seven experiments for TNF-{alpha} treatment; n = 75 cells from four experiments for resting conditions). Microscopic analysis of whole fields of cells confirmed the biphasic response pattern observed using luminometry (Fig. 2AGo). Single-cell analysis revealed a heterogeneous response of individual cells to the TNF-{alpha} treatment that could be classified into three predominant patterns: an early peak, a late peak, or more than one peak in promoter activity. Examples of individual cells showing the three typical patterns observed are shown in Fig. 2Go, C–E. Cluster analysis of the single-cell data showed a significant peak in transcription after TNF-{alpha} treatment between 0 and 14 h (termed period 1) for 41 ± 4% of the cells (compared with 20 ± 8% under resting conditions); at 20–34 h after addition of TNF-{alpha} (termed period 2), 59 ± 7% of cells showed a pulse in transcription (compared with 20 ± 4% control). A total of 16 ± 5% of TNF-{alpha} treated cells (compared with 55 ± 8% control) showed no peak during the whole experiment (Fig. 2BGo). Significant peaks in both time periods were observed in 30 ± 3% (compared with 4 ± 1%) of the cells. These data suggest that the increase in transcription after TNF-{alpha} treatment is due to activation of more cells rather than due to a simultaneous graded increase of expression levels in all cells.



View larger version (30K):
[in this window]
[in a new window]
  		FIG. 2. Real-time luminescence imaging showed heterogeneous transcriptional responses in individual cells after TNF-{alpha} treatment. GH3/hPrl-luc cells were cultured in 35-mm glass coverslip culture dishes, serum starved for 24 h, and then imaged for 48 h after stimulation with 10 ng/ml TNF-{alpha} ({diamondsuit}) or not ({square}). A, The mean of the total photon counts obtained from a whole microscopic field of cells (~20 per field): shaded areas indicate the two time periods used to categorize cells into different patterns of expression. B, Single-cell transcriptional responses with or without TNF-{alpha} stimulation were classified into four groups using Cluster analysis software. The groups were defined as cells showing no significant response, all cells showing significant responses in period 1, all cells showing significant responses in period 2, and cells showing significant responses in both periods. Data shown are means ± SD from four or seven independent experiments. C–E, Examples of single cells representing the predominant response patterns observed.

 
TNF-{alpha} activates the NF-{kappa}B signaling pathway in GH3 cells
To test whether the activation of the prolactin promoter could be mediated by NF-{kappa}B, we first wanted to establish whether TNF-{alpha} can activate NF-{kappa}B in pituitary GH3 cells. Western blot analysis for p65, phospho-p65, and I{kappa}B{alpha} was performed with lysates from GH3 cells treated with TNF-{alpha} for 0–2 h (Fig. 3AGo). There was no change in the level of total p65, but treatment with TNF-{alpha} led to a rapid transient increase in phosphorylation of p65 that lasted for approximately 30 min and was followed by a decrease below basal levels. Degradation of I{kappa}B{alpha} was observed after 20–30 min with subsequent recovery to pretreatment level after 2 h. Using a DNA/protein interaction assay for p65, we found an increase in complex formation using lysates from GH3 cells treated with TNF-{alpha} for 30–60 min (Fig. 3BGo). To show that I{kappa}B{alpha} degradation and p65 phosphorylation after TNF-{alpha} stimulation was associated with transcriptional activation, GH3 cells were transiently transfected with a reporter construct containing five repeats of the NF-{kappa}B consensus binding sequence linked to the luciferase gene (pNF-{kappa}B-luc). Treatment of these cells with TNF-{alpha} caused a time-dependent (Fig. 3CGo) and dose-dependent (data not shown) increase in luciferase activity (P < 0.05 at 2 h and later). These data indicate that TNF-{alpha} is indeed able to stimulate gene transcription via activation of the NF-{kappa}B signaling pathway in GH3 cells. We then transiently transfected GH3 cells with expression vectors encoding p65-dsRedXP and I{kappa}B{alpha}-EGFP under the control of the strong human CMV (30, 31) and used dual-fluorescence time-lapse imaging to observe and quantitate dynamic changes in the nuclear/cytoplasmic localization ratio of p65 and the level of cytoplasmic I{kappa}B{alpha} in single transfected cells. TNF-{alpha} treatment led to rapid degradation of I{kappa}B{alpha} and nuclear translocation of p65 (Fig. 3DGo). Subsequent oscillations in the level of nuclear p65 were seen in approximately 60% of cells (11 of 18 cells) with a period of about 90 min (Fig. 3EGo), similar to those reported in other cell lines (31). We repeated these experiments using NF-I{kappa}B{alpha}-EGFP (driven by five tandem repeats of a consensus NF-{kappa}B binding motif, as described previously (Ref.31)], alongside CMV-p65-dsRedXP. Addition of TNF-{alpha} to the medium led to a rapid decrease in cytoplasmic I{kappa}B{alpha}, reaching a minimum after 1 h and subsequent recovery to pretreatment levels after approximately 2 h. The degradation of I{kappa}B{alpha} was accompanied by a transient nuclear translocation of p65 as before (Fig. 3Go, F and G).



View larger version (29K):
[in this window]
[in a new window]
  		FIG. 3. Analysis of NF-{kappa}B activation by TNF-{alpha} in GH3 cells. GH3 cells were serum starved for 24 h before stimulation with 10 ng/ml TNF-{alpha} for the indicated times. A, Endogenous p65, phospho-p65, and I{kappa}B{alpha} levels were assessed by Western blotting cell extracts using anti-p65, anti-phosho-p65, and anti-I{kappa}B{alpha} antibodies. B, DNA/protein interaction for p65 was analyzed in lysates from TNF-{alpha}-stimulated GH3 cells using a TransAM NF-{kappa}B p65 Chemi transcription factor assay kit. Results are shown as mean ± SEM of four replicates from two independent experiments. C, GH3 cells were transfected with the pNF-{kappa}B-luc reporter plasmid, serum starved for 24 h, and treated with 10 ng/ml TNF-{alpha} for the indicated times. Results are shown as means ± SD from at least three independent experiments. D, Time course showing coexpression of p65-dsRedXP and CMV-I{kappa}Ba-EGFP in cells stimulated with TNF-{alpha} at time zero. The movement of p65 is presented as the ratio of nuclear to cytoplasmic fluorescent signal. The I{kappa}Ba signal was normalized to resting levels at time zero. E, Examples of single cells showing oscillatory movement of p65 after TNF-{alpha} stimulation. F and G, GH3 cells were transfected with p65-dsRedXP and NF-I{kappa}B-EGFP and stimulated with TNF-{alpha}, and confocal images were taken every 5 min from living cells: quantitative results (F) and images of typical cells (G) are shown at 0–120 min after addition of TNF-{alpha}.

 
TNF-{alpha} activation of the prolactin promoter is mediated by the NF-{kappa}B signaling pathway
To test whether the observed activation of the human prolactin promoter is mediated via this pathway, we cotransfected the 5000 bp human prolactin promoter reporter construct into GH3 cells together with a well-characterized set of expression vectors encoding wild-type and dominant-negative components of the NF-{kappa}B signaling pathway (Fig. 4Go) that have been used previously to investigate the role of NF-{kappa}B in cyclin D1 transcription (36). Cotransfection of wild-type IKKß led to an increase in basal expression levels from the prolactin promoter but no change in fold induction (Fig. 4AGo). Conversely, dominant-negative IKKß abolished the induction by TNF-{alpha} completely and slightly decreased basal expression (Fig. 4BGo). Expression of dominant-negative NEMO/IKK{gamma} (16) or truncated I{kappa}B{alpha} ({Delta}I{kappa}B{alpha}) also abolished the increase in transcription after TNF-{alpha} treatment but had no effect on basal expression levels (Fig. 4Go, C and D). Dominant-negative IKK{alpha} also had no effect on basal levels and had a reduced inhibitory effect on the response to TNF-{alpha} (Fig. 4EGo). Cotransfection of these constructs did not alter activation of the prolactin promoter by FGF-2 or forskolin (Fig. 4FGo). Together, these data suggest that the TNF-{alpha} stimulation of the prolactin promoter is mediated via the NF-{kappa}B pathway.



View larger version (18K):
[in this window]
[in a new window]
  		FIG. 4. Cotransfection of dominant-negative components of the NF-{kappa}B signaling pathway with a human prolactin promoter-luciferase construct. Using GH3 cells the 5000 bp prolactin promoter-luc construct (1 µg) was cotransfected with the indicated amounts (0.1, 0.5, and 1 µg) of expression plasmid for wild-type (wt) IKKß, dominant-negative (dn) IKKß, dominant-negative IKK{alpha}, dominant-negative NEMO/IKK{gamma}, and a truncated I{kappa}B{alpha} ({Delta}I{kappa}B{alpha}). The total amount of DNA for each transfection was kept constant by addition of empty expression vector (A–E). For F, cells were transfected with 1 µg of 5000 bp prolactin promoter-luc construct and 1 µg dominant-negative IKKß, {Delta}I{kappa}B{alpha}, or dominant-negative NEMO. Cells were serum starved for 24 h and then treated for 6 h with 10 ng/ml TNF-{alpha} (A–E) or the indicated stimuli (F): 10 ng/ml FGF; 1 µM forskolin. Results are shown as means ± SD of at least three independent experiments; *, P < 0.05.

 
TNF-{alpha} interacts with other signaling pathways to modulate prolactin gene expression
Because TNF-{alpha} is a potent stimulus of the human prolactin promoter, we analyzed its interactions with other physiologically important positive or negative regulators of prolactin gene expression such as FGF-2 and glucocorticoids (9, 37). GH3/Prl-luc cells were treated with FGF-2, dexamethasone, or estradiol, alone or in combination with TNF-{alpha} (Fig. 5Go). Treatment of GH3/hPrl-luc cells with 10 ng/ml FGF-2 alone led to an approximately 2- and 8-fold increase in luciferase activity after 6 and 24 h, respectively. TNF-{alpha} and FGF-2 in combination led to an additional increase in promoter activation (Fig. 5AGo), suggesting that FGF-2 and TNF-{alpha} act independently and use different signaling pathways. This is further supported by the fact that, whereas TNF-{alpha} was able to induce expression of luciferase from the pNF-{kappa}B-luc reporter construct, FGF-2 was not (data not shown), indicating that FGF-2, unlike TNF-{alpha}, does not activate NF-{kappa}B.



View larger version (17K):
[in this window]
[in a new window]
  		FIG. 5. Combinatorial effect of TNF-{alpha} with FGF-2, dexamethasone, or estradiol on prolactin promoter activity. GH3/hPrl-luc cells were serum starved for 24 h and then stimulated for 6 or 24 h with FGF-2 (A; 10 ng/ml), dexamethasone (B; 10 nM), or estradiol (C; 1 nM) alone in combination with TNF-{alpha} (10 ng/ml) or TNF-{alpha} alone. Inset in B, GH3 cells were transfected with the pNF{kappa}B-luc reporter construct, serum starved for 24 h, and treated with TNF-{alpha} and/or dexamethasone for 6 h. Results are shown as means ± SD of at least three independent experiments; *, P < 0.05.

 
Glucocorticoids are known to decrease prolactin expression (9, 38) and have been shown to interact with NF-{kappa}B signaling in a variety of systems (39, 40). In GH3/hPrl-luc cells, treatment with 10 nM dexamethasone had no effect on luciferase activity after 6 h but decreased gene expression by about 50% after 24 h. When given in combination with TNF-{alpha}, dexamethasone completely abolished the TNF-{alpha} induction of the human prolactin promoter not only after 24 h but also after 6 h (Fig. 5BGo). In contrast, in GH3 cells transiently transfected with the pNF-{kappa}B-luc reporter construct dexamethasone failed completely to repress TNF-{alpha} activation (Fig. 5BGo, inset). This is in marked contrast to the inhibitory effect of GR stimulation on TNF-{alpha} induction of this promoter in other cells such as HeLa cells (39).

Whereas previous studies have revealed an estrogen response element in the rat prolactin promoter, studies on the human prolactin promoter so far have not shown major effects of estrogen (9, 41). Treatment of GH3/hPrl-luc cells with 10 nM estradiol alone or in combination with 10 ng/ml TNF-{alpha} had no effect on the activity of the human prolactin promoter after 6 h. After 24 h, estradiol gave a consistent but small 1.5-fold induction, but, in combination with 10 ng/ml TNF-{alpha}, estradiol led to a synergistic 2- to 3-fold increase in gene activation (Fig. 5CGo).


   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Here we have reported that TNF-{alpha} activates the human prolactin gene promoter in GH3 pituitary cells and significantly modulates the effects of other important physiological regulators of prolactin expression, such as estrogen, FGF-2, and glucocorticoids. Cotransfection studies with dominant-negative proteins of the NF-{kappa}B signaling pathway have shown that this regulation is mediated via NF-{kappa}B.

Prolactin gene expression is regulated by various hypothalamic factors, but, in recent studies, an increasing number of intrapituitary factors have also been identified as important regulators (11). Here we show for the first time that, in pituitary GH3 cells, the cytokine TNF-{alpha} is able to activate the prolactin promoter in a dose- and time-dependent manner and also that expression of the endogenous rat prolactin gene is similarly stimulated by TNF-{alpha}. Because prolactin is thought to play a role in the stress response, our data, together with findings showing expression of TNF-{alpha} (18, 19) and its receptors (20, 21) in the pituitary, suggest that TNF-{alpha} might be an important paracrine or autocrine factor involved in the modulation of prolactin expression. Studies of TNF-{alpha} effects on prolactin using primary pituitary cells have so far focused on hormone secretion and have shown conflicting results (23, 24, 25, 26, 27). The discrepancy in these studies is most likely due to differences in the experimental design and model systems used. A recent study on primary lactotrophs from female rats showed an apoptotic effect of TNF-{alpha} (42) but used much higher (50 ng/ml) concentrations than we have used (2–10 ng/ml). Using flow cytometry, we have seen no evidence of increased apoptosis in GH3 cells with 10 ng/ml TNF-{alpha} for periods up to 30 h (data not shown). However, the effect of TNF-{alpha} on prolactin gene expression in primary cell cultures or in vivo remains the subject of additional investigation.

We and others have found that gene promoter activity in clonal pituitary cell lines is highly dynamic and variable among different individual cells, with rapid fluctuations in transcriptional activity in resting cells as well as in hormone-treated cells (32, 43). This is a phenomenon also found in normal pituitary cells using microinjection of reporter plasmids (44) or transfection with recombinant adenoviruses (34). Here we show that stimulation of GH3/hPrl-luc cells with TNF-{alpha} is accompanied by heterogeneous changes in prolactin promoter activity, with increased proportions of cells displaying transient peaks or pulses in transcription, with the overall effect that more cells become transcriptionally active. The cells in our study were a clonal cell line, as opposed to a mixed population of cells seen in the normal pituitary gland: thus, the heterogeneity we have seen arises from different transcriptional patterns among individual cells in a single cell population. All of the cells in the population can express the transgene but at varying levels, so that some cells exhibiting very low levels of gene expression at a given time may then become transcriptionally active at different rates and time points after a stimulus.

There are two theoretical mechanisms to regulate transcription from a gene promoter. Transcriptional enhancers might increase the probability that a promoter is active, meaning that genes are either "off" or "on" (binary behavior), or they might increase the rate of gene transcription modulating a continuous range of activity (45, 46). Studies in yeast suggest that a promoter can adopt either binary or graded behavior depending on the signaling pathway involved (47). The data we report here would favor a stochastic (or binary) model of gene transcription, because we have found an increased number of transcriptionally active cells after the stimulation with TNF-{alpha} rather than a simultaneous graded increase in promoter activity in all cells. Furthermore, the cells showed transient peaks of activity with a substantial number of cells showing more than one peak rather than constant transcription levels, underlining the stochastic nature of this process. These stochastic changes in transcription phenotype in single cells are most likely caused by the relative instability of transcription complexes. This would be consistent with recent findings of dynamic recruitment and release of transcription regulators to chromatin (48, 49). Stochastic patterns of transcription may be physiologically important in determining the way in which cells integrate their patterns of response to combinations of physiological regulators (50).

TNF-{alpha} can activate transcription factors such as activator protein-1 and NF-{kappa}B, which may override the apoptotic pathways (13). Stimulation of NF-{kappa}B activates the IKK signal- some that phosphorylates I{kappa}B and NF-{kappa}B proteins, leading to ubiquitination and degradation of I{kappa}B and subsequent translocation of free NF-{kappa}B dimers to the nucleus (14, 17). In agreement with this, we found rapid phosphorylation and transient nuclear translocation of p65 as well as degradation of cytoplasmic I{kappa}Ba in TNF-{alpha}-stimulated GH3 cells. In agreement with our previous studies in other cell types (30), we observed highly damped oscillations in the level of nuclear NF-{kappa}B, which had a period of about 90 min. These cycles of NF-{kappa}B translocation have been associated with cycles of reactivation of NF-{kappa}B (measured by Ser536 phosphorylation) that maintain NF-{kappa}B-dependent gene expression. As described in other cell types (30), the use of a consensus NF-{kappa}B promoter in front of the I{kappa}B{alpha}-EGFP reporter led to oscillations in cytoplasmic EGFP fluorescence level and an increase in p65 oscillation period (data not shown). Indeed, using NF-{kappa}B-responsive reporter gene constructs, we showed that NF-{kappa}B translocation and I{kappa}B{alpha} degradation is accompanied by dose- and time-dependent increase in NF-{kappa}B-mediated transcription. These findings are supported by a previous study showing increased protein/DNA complex formation in EMSAs using nuclear extracts from GH3 cells treated with TNF-{alpha} (51). Together, our evidence strongly suggests that TNF-{alpha} is able to activate the NF-{kappa}B signaling pathway in GH3 cells.

Activity of the IKK complex is crucial for the activation of NF-{kappa}B (16). Disruption of its activity by expression of dominant-negative variants of IKK{alpha} or IKKß has been used in previous studies to show NF-{kappa}B involvement in transcriptional regulation of the cyclin D1 gene (36). Here we found that expression of dominant-negative IKKs abolished induction of the prolactin promoter activity by TNF-{alpha} in GH3 cells, suggesting that the TNF-{alpha} effect specifically is mediated by NF-{kappa}B. This is further supported by our finding that expression of a truncated form of I{kappa}B{alpha} ({Delta}I{kappa}B{alpha}) that cannot be phosphorylated/degraded (and therefore abolishes NF-{kappa}B activation by preventing its translocation to the nucleus) also blocks activation of the prolactin promoter by TNF-{alpha}. Forskolin and FGF-2 regulation of the prolactin promoter were independent of NF-{kappa}B. This was expected from previous reports showing that regulation by FGF-2 involves a Rac1-, phospholipase C{gamma}-, protein kinase C{delta}-, and ERK-dependent mechanism (52), whereas forskolin increases intracellular cAMP levels to activate PKA.

Our results show that TNF-{alpha} not only activates the human prolactin promoter but also interacts with other well-known regulators of prolactin expression. Simultaneous treatment of GH3/hPrl-luc cells with TNF-{alpha} and FGF-2 led to a significant additive effect on promoter activation. FGF-2 did not activate NF-{kappa}B in pituitary GH3 cells, and therefore independent activation of distinct signaling pathways may explain the additional effect. Dexamethasone blocked activation of the prolactin promoter by TNF-{alpha}. The repressive effect of glucocorticoids on the expression of prolactin involves interaction between Pit-1 and glucocorticoid receptor (GR), but binding of GR to DNA is not required (38). The loss of activation by TNF-{alpha} in the presence of dexamethasone could therefore be explained by either loss of NF-{kappa}B transactivation due to negative cross-talk with GR or by independent glucocorticoid repression of the prolactin promoter overriding the TNF-{alpha} activation. In contrast to results in other cell types (39), dexamethasone did not alter transcriptional activation of a reporter gene construct containing five NF-{kappa}B response elements by TNF-{alpha} in GH3 cells, arguing against a direct effect of GR on NF-{kappa}B signaling pathways in these cells and suggesting that this effect was characteristic of the prolactin promoter but not of a consensus NF-{kappa}B promoter. Bioinformatic analysis has revealed two potential NF-{kappa}B binding sites at –1300/–1309 and –3810/–3819 bp in the human prolactin promoter, but preliminary experiments suggest that they may not be involved in these effects of TNF-{alpha} (data not shown), suggesting that a more complex mechanism may be involved, as shown for other genes such as IL-6 and cyclooxygenase-2 (53, 54, 55). NF-{kappa}B regulation of prolactin might therefore involve other factors, and the discrepancy in dexamethasone repression seen here may be explained by GR blocking interaction of NF-{kappa}B with some yet unknown factor. Understanding of this interesting behavior requires additional, more detailed study.

Despite the effect of estrogen on the rat prolactin promoter (41) and the well-known in vivo effect on prolactin production in man, previous studies have shown little or no estrogen effect on human prolactin promoter activity (9, 41). Here we show a small but consistent activation of the prolactin promoter by estrogen after 24 h but not after 6 h. Interestingly, compared with treatment with either TNF-{alpha} or estrogen alone, stimulation of GH3/hPrl-luc cells with a combination of both stimuli led to a synergistic large increase in promoter activity. Recent studies have demonstrated molecular cross-talk between estrogen receptor (ER) and NF-{kappa}B (52). Most studies have found inhibition of NF-{kappa}B signaling by ER and suggested a series of molecular mechanisms for this antagonism, including direct inhibition of DNA binding, effects of the ER on I{kappa}B processing, or interference with coactivator recruitment (56). Synergistic interaction between estrogen and NF-{kappa}B signaling appears to be unusual but has been shown previously for the serotonin 5-HT1A receptor promoter (57). It will be interesting to determine the molecular mechanisms by which ER and NF-{kappa}B may differentially cross-regulate their effects in different cell types and at different promoters. This interaction between TNF-{alpha} and estrogen is likely to be biologically important, given the major role of estrogen in normal pituitary physiology and possibly in pituitary adenoma formation.

In conclusion, we have shown for the first time that TNF-{alpha} can activate the human prolactin promoter and that this effect is mediated by NF-{kappa}B. TNF-{alpha} and TNF-{alpha} receptors are produced locally in the pituitary gland (18, 19, 20, 21), suggesting that this effect could be important in vivo. We show that other important physiological regulators of prolactin expression, such as estrogen, interact with TNF-{alpha} to give rise to synergistic regulation of prolactin expression. Together, these data suggest that TNF-{alpha} and NF-{kappa}B regulation of the prolactin gene is likely to be important for pituitary physiology in vivo.


   Acknowledgments
 
We acknowledge the help of Angharad Bidder for assistance with preliminary imaging experiments and Andrea Norris for help with Cluster analysis. We thank N. Inohara, C. Paya, and E. Costello for the generous gift of plasmids.


   Footnotes
 
This work was supported by Wellcome Trust Programme Grant 067252 and through collaborations with Hamamatsu Photonics and Zeiss.

First Published Online October 27, 2005

Abbreviations: CMV, Cytomegalovirus; EGFP, enhanced green fluorescent protein; ER, estrogen receptor; FGF-2, fibroblast growth factor-2; GR, glucocorticoid receptor; h, human; I{kappa}B, inhibitory protein {kappa}B; IKK, I{kappa}B kinase; luc, luciferase; NEMO, NF-{kappa}B essential modulator; NF-{kappa}B, nuclear factor {kappa}B; Prl, prolactin.

Received July 29, 2005.

Accepted for publication October 14, 2005.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Owerbach D, Rutter WJ, Cooke NE, Martial JA, Shows TB 1981 The prolactin gene is located on chromosome 6 in humans. Science 212:815–816[Abstract/Free Full Text]
  2. DiMattia GE, Gellersen B, Duckworth ML, Friesen HG 1990 Human prolactin gene expression. The use of an alternative noncoding exon in decidua and the IM-9-P3 lymphoblast cell line. J Biol Chem 265:16412–16421[Abstract/Free Full Text]
  3. Wu WX, Brooks J, Glasier AF, McNeilly AS 1995 The relationship between decidualization and prolactin mRNA and production at different stages of human pregnancy. J Mol Endocrinol 14:255–261[Abstract]
  4. Gellersen B, Bonhoff A, Hunt N, Bohnet HG 1991 Decidual-type prolactin expression by the human myometrium. Endocrinology 129:158–168[Abstract]
  5. Pellegrini I, Lebrun JJ, Ali S, Kelly PA 1992 Expression of prolactin and its receptor in human lymphoid cells. Mol Endocrinol 6:1023–1031[Abstract]
  6. O’Neal KD, Montgomery DW, Truong TM, Yu-Lee LY 1992 Prolactin gene expression in human thymocytes. Mol Cell Endocrinol 87:R19–R23
  7. Nelson C, Albert VR, Elsholtz HP, Lu LI, Rosenfeld MG 1988 Activation of cell-specific expression of rat growth hormone and prolactin genes by a common transcription factor. Science 239:1400–1405[Abstract/Free Full Text]
  8. Lemaigre FP, Peers B, Lafontaine DA, Mathy-Hartert M, Rousseau GG, Belayew A, Martial JA 1989 Pituitary-specific factor binding to the human prolactin, growth hormone, and placental lactogen genes. DNA 8:149–159[Medline]
  9. Berwaer M, Monget P, Peers B, Mathy-Hartert M, Bellefroid E, Davis JR, Belayew A, Martial JA 1991 Multihormonal regulation of the human prolactin gene expression from 5000 bp of its upstream sequence. Mol Cell Endocrinol 80:53–64[CrossRef][Medline]
  10. Iverson RA, Day KH, d’Emden M, Day RN, Maurer RA 1990 Clustered point mutation analysis of the rat prolactin promoter. Mol Endocrinol 4:1564–1571[Abstract]
  11. Schwartz J 2000 Intercellular communication in the anterior pituitary. Endocr Rev 21:488–513[Abstract/Free Full Text]
  12. Ray D, Melmed S 1997 Pituitary cytokine and growth factor expression and action. Endocr Rev 18:206–228[Abstract/Free Full Text]
  13. Leong KG, Karsan A 2000 Signaling pathways mediated by tumor necrosis factor {alpha}. Histol Histopathol 15:1303–1325[Medline]
  14. Baeuerle PA, Baltimore D 1996 NF-{kappa}B: ten years after. Cell 87:13–20[CrossRef][Medline]
  15. Pahl HL 1999 Activators and target genes of Rel/NF-{kappa}B transcription factors. Oncogene 18:6853–6866[CrossRef][Medline]
  16. Israel A 2000 The IKK complex: an integrator of all signals that activate NF-{kappa}B? Trends Cell Biol 10:129–133[CrossRef][Medline]
  17. Thanos D, Maniatis T 1995 NF-{kappa}B: a lesson in family values. Cell 80:529–532[CrossRef][Medline]
  18. Nadeau S, Rivest S 1999 Regulation of the gene encoding tumor necrosis factor {alpha} (TNF-{alpha}) in the rat brain and pituitary in response in different models of systemic immune challenge. J Neuropathol Exp Neurol 58:61–77[Medline]
  19. Arras M, Hoche A, Bohle R, Eckert P, Riedel W, Schaper J 1996 Tumor necrosis factor-{alpha} in macrophages of heart, liver, kidney, and in the pituitary gland. Cell Tissue Res 285:39–49[CrossRef][Medline]
  20. Kobayashi H, Fukata J, Murakami N, Usui T, Ebisui O, Muro S, Hanaoka I, Inoue K, Imura H, Nakao K 1997 Tumor necrosis factor receptors in the pituitary cells. Brain Res 758:45–50[CrossRef][Medline]
  21. Wolvers DA, Marquette C, Berkenbosch F, Haour F 1993 Tumor necrosis factor-{alpha}: specific binding sites in rodent brain and pituitary gland. Eur Cytokine Netw 4:377–381[Medline]
  22. Arzt E, Pereda MP, Castro CP, Pagotto U, Renner U, Stalla GK 1999 Pathophysiological role of the cytokine network in the anterior pituitary gland. Front Neuroendocrinol 20:71–95[CrossRef][Medline]
  23. Milenkovic L, Rettori V, Snyder GD, Beutler B, McCann SM 1989 Cachectin alters anterior pituitary hormone release by a direct action in vitro. Proc Natl Acad Sci USA 86:2418–2422[Abstract/Free Full Text]
  24. Gaillard RC, Turnill D, Sappino P, Muller AF 1990 Tumor necrosis factor {alpha} inhibits the hormonal response of the pituitary gland to hypothalamic releasing factors. Endocrinology 127:101–106[Abstract]
  25. Theas MS, De Laurentis A, Lasaga M, Pisera D, Duvilanski BH, Seilcovich A 1998 Effect of lipopolysaccharide on tumor necrosis factor and prolactin release from rat anterior pituitary cells. Endocrine 8:241–245[CrossRef][Medline]
  26. Koike K, Hirota K, Ohmichi M, Kadowaki K, Ikegami H, Yamaguchi M, Miyake A, Tanizawa O 1991 Tumor necrosis factor-{alpha} increases release of arachidonate and prolactin from rat anterior pituitary cells. Endocrinology 128:2791–2798[Abstract]
  27. Yamaguchi M, Koike K, Yoshimoto Y, Ikegami H, Miyake A, Tanizawa O 1991 Effect of TNF-{alpha} on prolactin secretion from rat anterior pituitary and dopamine release from the hypothalamus: comparison with the effect of interleukin-1ß. Endocrinol Jpn 38:357–361[Medline]
  28. Tang ED, Inohara N, Wang CY, Nunez G, Guan KL 2003 Roles for homotypic interactions and transautophosphorylation in I{kappa}B kinase ß (IKKß) activation [corrected]. J Biol Chem 278:38566–38570[Abstract/Free Full Text]
  29. Trushin SA, Pennington KN, Algeciras-Schimnich A, Paya CV 1999 Protein kinase C and calcineurin synergize to activate I{kappa}B kinase and NF-{kappa}B in T lymphocytes. J Biol Chem 274:22923–22931[Abstract/Free Full Text]
  30. Nelson DE, Ihekwaba AE, Elliott M, Johnson JR, Gibney CA, Foreman BE, Nelson G, See V, Horton CA, Spiller DG, Edwards SW, McDowell HP, Unitt JF, Sullivan E, Grimley R, Benson N, Broomhead D, Kell DB, White MR 2004 Oscillations in NF-{kappa}B signaling control the dynamics of gene expression. Science 306:704–708[Abstract/Free Full Text]
  31. Nelson G, Paraoan L, Spiller DG, Wilde GJ, Browne MA, Djali PK, Unitt JF, Sullivan E, Floettmann E, White MR 2002 Multi-parameter analysis of the kinetics of NF-{kappa}B signalling and transcription in single living cells. J Cell Sci 115:1137–1148[Abstract/Free Full Text]
  32. Takasuka N, White MRH, Wood CD, Robinson WR, Davis JRE 1998 Dynamic changes in prolactin promotor activation in single living lactotrophic cells. Endocrinology 129:1361–1368
  33. Veldhuis JD 1996 New modalities for understanding dynamic regulation of the somatotropic (GH) axis: explication of gender differences in GH neuroregulation in the human. J Pediatr Endocrinol Metab 9(Suppl 3):237–253
  34. Stirland JA, Seymour ZC, Windeatt S, Norris AJ, Stanley P, Castro MG, Loudon AS, White MR, Davis JR 2003 Real-time imaging of gene promoter activity using an adenoviral reporter construct demonstrates transcriptional dynamics in normal anterior pituitary cells. J Endocrinol 178:61–69[Abstract]
  35. Shorte SL, Leclerc GM, Vazquez-Martinez R, Leaumont DC, Faught WJ, Frawley LS, Boockfor FR 2002 PRL gene expression in individual living mammotropes displays distinct functional pulses that oscillate in a noncircadian temporal pattern. Endocrinology 143:1126–1133[Abstract/Free Full Text]
  36. See V, Rajala NK, Spiller DG, White MR 2004 Calcium-dependent regulation of the cell cycle via a novel MAPK–NF-{kappa}B pathway in Swiss 3T3 cells. J Cell Biol 166:661–672[Abstract/Free Full Text]
  37. Black EG, Logan A, Davis JR, Sheppard MC 1990 Basic fibroblast growth factor affects DNA synthesis and cell function and activates multiple signalling pathways in rat thyroid FRTL-5 and pituitary GH3 cells. J Endocrinol 127:39–46[Abstract]
  38. Nalda AM, Martial JA, Muller M 1997 The glucocorticoid receptor inhibits the human prolactin gene expression by interference with Pit-1 activity. Mol Cell Endocrinol 134:129–137[CrossRef][Medline]
  39. Nelson G, Wilde GJ, Spiller DG, Kennedy SM, Ray DW, Sullivan E, Unitt JF, White MR 2003 NF-{kappa}B signalling is inhibited by glucocorticoid receptor and STAT6 via distinct mechanisms. J Cell Sci 116:2495–2503[Abstract/Free Full Text]
  40. Garside H, Stevens A, Farrow S, Normand C, Houle B, Berry A, Maschera B, Ray D 2004 Glucocorticoid ligands specify different interactions with NF-{kappa}B by allosteric effects on the glucocorticoid receptor DNA binding domain. J Biol Chem 279:50050–50059[Abstract/Free Full Text]
  41. Gellersen B, Kempf R, Telgmann R, DiMattia GE 1995 Pituitary-type transcription of the human prolactin gene in the absence of Pit-1. Mol Endocrinol 9:887–901[Abstract]
  42. Candolfi M, Zaldivar V, De Laurentiis A, Jaita G, Pisera D, Seilicovich A 2002 TNF-{alpha} induces apoptosis of lactotropes from female rats. Endocrinology 143:3611–3617[Abstract/Free Full Text]
  43. McFerran DW, Stirland JA, Norris AJ, Khan RA, Takasuka N, Seymour ZC, Gill MS, Robertson WR, Loudon AS, Davis JR, White MR 2001 Persistent synchronized oscillations in prolactin gene promoter activity in living pituitary cells. Endocrinology 142:3255–3260[Abstract/Free Full Text]
  44. Villalobos C, Faught WJ, Frawley LS 1999 Dynamics of stimulus-expression coupling as revealed by monitoring of prolactin promoter-driven reporter activity in individual, living mammotropes. Mol Endocrinol 13:1718–1727[Abstract/Free Full Text]
  45. Fiering S, Whitelaw E, Martin DI 2000 To be or not to be active: the stochastic nature of enhancer action. Bioessays 22:381–387[CrossRef][Medline]
  46. Walters MC, Fiering S, Eidemiller J, Magis W, Groudine M, Martin DI 1995 Enhancers increase the probability but not the level of gene expression. Proc Natl Acad Sci USA 92:7125–7129[Abstract/Free Full Text]
  47. Biggar SR, Crabtree GR 2001 Cell signaling can direct either binary or graded transcriptional responses. EMBO J 20:3167–3176[CrossRef][Medline]
  48. McNally JG, Muller WG, Walker D, Wolford R, Hager GL 2000 The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262–1265[Abstract/Free Full Text]
  49. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  50. Norris AJ, Stirland JA, McFerran DW, Seymour ZC, Spiller DG, Loudon AS, White MR, Davis JR 2003 Dynamic patterns of growth hormone gene transcription in individual living pituitary cells. Mol Endocrinol 17:193–202[Abstract/Free Full Text]
  51. Grandison L, Nolan GP, Pfaff DW 1994 Activation of the transcription factor NF-{kappa}B in GH3 pituitary cells. Mol Cell Endocrinol 106:9–15[CrossRef][Medline]
  52. Jackson TA, Koterwas DM, Morgan MA, Bradford AP 2003 Fibroblast growth factors regulate prolactin transcription via an atypical Rac-dependent signaling pathway. Mol Endocrinol 17:1921–1930[Abstract/Free Full Text]
  53. Xiao W, Hodge DR, Wang L, Yang X, Zhang X, Farrar WL 2004 NF-{kappa}B activates IL-6 expression through cooperation with c-Jun and IL6-AP1 site, but is independent of its IL6-NF{kappa}B regulatory site in autocrine human multiple myeloma cells. Cancer Biol Ther 3:1007–1017[Medline]
  54. Xiao W, Hodge DR, Wang L, Yang X, Zhang X, Farrar WL 2004 Co-operative functions between nuclear factors NF{kappa}B and CCAT/enhancer-binding protein-ß (C/EBP-ß) regulate the IL-6 promoter in autocrine human prostate cancer cells. Prostate 61:354–370[CrossRef][Medline]
  55. Chen J, Zhao M, Rao R, Inoue H, Hao CM 2005 C/EBPß and its binding element are required for NF{kappa}B induced COX2 expression following hypertonic stress. J Biol Chem 279:16354–16359
  56. Kalaitzidis D, Gilmore TD 2005 Transcription factor cross-talk: the estrogen receptor and NF-{kappa}B. Trends Endocrinol Metab 16:46–52[CrossRef][Medline]
  57. Wissink S, van der Burg B, Katzenellenbogen BS, van der Saag PT 2001 Synergistic activation of the serotonin-1A receptor by nuclear factor-{kappa}B and estrogen. Mol Endocrinol 15:543–552[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 EndocrinologyHome page
A. D. Adamson, S. Friedrichsen, S. Semprini, C. V. Harper, J. J. Mullins, M. R. H. White, and J. R. E. Davis
Human Prolactin Gene Promoter Regulation by Estrogen: Convergence with Tumor Necrosis Factor-{alpha} Signaling
Endocrinology, February 1, 2008; 149(2): 687 - 694.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text