| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Research Centre for Reproductive Health, Department of Obstetrics and Gynaecology, University of Adelaide, Adelaide, South Australia 5005, Australia
Address all correspondence and requests for reprints to: Assoc. Prof. Sarah A. Robertson, Research Centre for Reproductive Health, Department of Obstetrics and Gynaecology, University of Adelaide, Adelaide, South Australia 5005, Australia. E-mail: sarah.robertson{at}adelaide.edu.au.
| Abstract |
|---|
|
|
|---|
-hydroxylase/C1720-lyase. Embryos recovered from TGFß1 null mutant females were developmentally arrested in the morula stage and rarely progressed to blastocysts. Attempts to rescue embryos by exogenous progesterone administration and in vitro culture were unsuccessful, and in vitro fertilization and culture experiments demonstrated that impaired development is unlikely to result from lack of maternal tract TGFß1. We conclude that embryo arrest is due to developmental incompetence in oocytes developed in a TGFß1-deficient follicular environment. This study demonstrates that TGFß1 is a critical determinant of normal ovarian function, operating through regulation of LH activity and generation of oocytes competent for embryonic development and successful initiation of pregnancy. | Introduction |
|---|
|
|
|---|
Studies describing in vivo expression of TGFß1 and its receptors as well as in vitro cell culture experiments implicate the TGFß1 signaling pathway prominently in the events of early pregnancy. In the ovary, TGFß1 may act as a local regulator of granulosa cell proliferation and steroid hormone production during follicular development (4, 5, 6), as well as in development and function of the corpus luteum (7, 8). TGFß1 is expressed in developing oocytes (9, 10, 11) in which it may participate in oocyte-granulosa cell communication (5, 6). Maternal TGFß1 transcripts appear to be sequestered in the oocyte and translated in the developing preimplantation embryo (12), in which TGFß1 is attributed an autocrine trophic role (10, 13). At implantation, TGFß1 is a potential key regulator of endometrial receptivity (2) and of trophoblast cell differentiation and invasiveness during placental morphogenesis (2, 14). However, the precise role and functional necessity for TGFß1 in each of these processes in vivo remains undefined.
An opportunity to study the physiological significance of TGFß1 in female reproductive function in vivo is provided by the availability of TGFß1 null mutant mice. TGFß1 null mice suffer severe multifocal inflammatory lesions and, on a conventional genetic background, do not survive past weaning age (15, 16). Inducing an immunocompromised state in TGFß1 null mutant mice by treatment with dexamethasone (17) or anti-CD11
(18), mutation in the ß2-microglobulin (19) or major histocompatibility complex class II (20) genes, or introduction of the severe combined immunodeficiency spontaneous mutation (scid) (18) prevents inflammatory pathology and prolongs their lifespan, enabling adult mice to be studied.
It is has been noted that the fertility of TGFß1 null mutant mice is severely impaired (21). However, the reasons underpinning reproductive loss in TGFß1-deficient mice have not been formally investigated, largely because of difficulties in generating and maintaining sufficient experimental mice to reproductive age. The aim of this study was to examine reproductive function in female TGFß1 null mutant mice on the immunocompromised scid background. Here we demonstrate that TGFß1 is indeed crucial to female reproductive success, primarily through its effects on gonadotropin regulation of the estrous cycle and ovulation, acquisition of oocyte competence, and early embryo development.
| Materials and Methods |
|---|
|
|
|---|
Control mice used in these experiments were TGFß1-replete littermates (TGFß1+/ or +/+; termed TGFß1+/±, unless specified otherwise). B10 male mice (ARC, Perth, Australia) were used as stud males in mating experiments, and CBA F1 (CBA x C57BL/6) males (University of Adelaide, Central Animal House) were used to provide spermatozoa for in vitro fertilization.
The genotype of each mouse in the colony was determined by diagnostic PCR of tail tissue DNA, using the forward primer 5'-GAGAAGAACTGCTGTGTGCG together with the reverse primers (1) 5'-GTGTCCAGGCTCCAAATATAGG to detect the intact Tgfß1 gene and (2) 5'-CTCGTCCTGCAGTTCATTCA, which detects the neomycin resistance gene used to disrupt Tgfß1. Over the 3-yr duration of the project, a total of 616 female progeny from approximately 250 litters produced by TGFß1+/ breeding pairs were genotyped, yielding 222 TGFß1+/+, 295 TGFß1+/, and 99 TGFß1/ female mice (ratio of +/+ to +/ to /, 1.00:1.32:0.45).
To investigate pregnancy outcome, TGFß1/ and TGFß1+/± female mice were caged 1:1 from the age of 8 wk with a stud B10 male of proven fertility and checked daily for the presence of a vaginal plug, indicative of a mating event. After mating, females were separated from males and monitored for visible signs of pregnancy and birth of pups.
Evaluation of onset of puberty and estrous cycle tracking
TGFß1/ and TGFß1+/± female mice were observed daily from the time of weaning at 21 d for appearance of a vaginal opening. Once this occurred, daily histological analysis of vaginal smears was undertaken to determine onset of proestrus, defined by the presence of round epithelial cells (22). Mice were killed during the periovulatory period at 1600 h on the day of proestrus, and blood was recovered by heart puncture for serum estrogen, FSH, and LH assay.
Estrous cycles were monitored in another cohort of virgin TGFß1/ and TGFß1+/± female mice for 28 d from 6 wk of age by examining vaginal cytology (22). To encourage cycling activity, stud male mice were housed adjacent to females, and bedding from the male cages was added to the female cages. Estrous cycle length was defined as the interval between onset of one estrus event and onset of the next estrus event.
Assessment of early embryo development
To analyze embryo development in vivo, 8-wk-old TGFß1/ and TGFß1+/± female mice were caged 1:1 with a stud male B10 mouse of proven fertility and checked daily for the presence of a vaginal plug, nominated d 0.5 postcoitus (pc). Some mice were given progesterone (Sigma, St. Louis, MO) (1 mg in peanut oil, sc) on d 1.5 and 2.5 pc. On d 3.5 pc, between 1100 and 1200 h, blood was collected by cardiac puncture under deep anesthesia with avertin before the animals were killed by cervical dislocation. The reproductive tract was dissected and flushed to recover embryos. The embryos were assessed for developmental stage and classified as one-cell, premorula embryo, morula, blastocyst, or degenerating embryo. The number of corpora lutea on the ovaries were counted as an index of the number of oocytes ovulated, and the ovaries were weighed and then fixed in 10% buffered formalin and paraffin embedded. The uterus was also dissected and fixed for histological analysis.
To investigate the viability of embryos developed in vitro, prepubertal (2729 d old) TGFß1/ and TGFß1+/± females were superovulated by administration of 5 IU Folligon (Intervet, Boxmeer, Holland), followed 50 h later by 5 IU Chorulon (Intervet), in a protocol proven in our hands to yield approximately 30 oocytes from prepubertal CBA x C57BL/6 F1 mice. The oocytes were fertilized either in vitro or in vivo, followed in both cases by in vitro culture to blastocysts. The in vitro fertilization procedure used sperm retrieved from the epididymis of CBA F1 males and capacitated for 1 h in pregassed rS1 media (Vitrolife, Kungsbacka, Sweden), and oocytes were harvested from the ampulla of TGFß1/ and TGFß1+/± females 14 h after human chorionic gonadotropin (hCG) injection. This protocol routinely achieved 77% cleavage and 78% blastocyst development when CBA F1 females were used. Sperm were cultured together with the oocytes for 4 h at a concentration of 106 sperm/ml. The oocytes were then washed and transferred to 30 µl drops of rS1 under oil at a density of 10 oocytes per drop. The in vivo fertilization procedure used B10 stud males housed 1:1 with superovulated females. Embryos were retrieved from the oviduct of females on d 0.5 pc and cultured in 30-µl droplets of pregassed rS1 media at a density of 10 oocytes per droplet. All embryos were assessed for cleavage on d 2 of culture and transferred to 30 µl droplets of SQC media (Vitrolife) under oil. Blastocyst formation was assessed on d 5 of culture.
Histological analysis of ovaries and uterus
Ovaries and uterus were dissected from virgin TGFß1/ and TGFß1+/± females killed on the day of first proestrus or from mated mice on d 3.5 pc. Serial 7-µm sections of paraffin embedded tissue were cut, mounted on glass slides, and stained with hematoxylin and eosin. Ovarian follicles were classified according to the method of Pedersen and Peters (1968) (23). Briefly, type 13 follicles had up to one single layer of granulosa cells, type 4 follicles had two layers of granulosa cells, type 5 follicles had between three and five layers of granulosa cells and no atrum, type 6 follicles comprised a multilayered membrana granulosa with scattered deposits of antral fluid, and type 7 and 8 follicles had a large, well-developed antrum, without (type 7) or with (type 8) a cumulus stalk. Atretic follicles were characterized by the presence of a degenerated oocyte, a high proportion of pyknotic nuclei, and/or a disorganized granulosa structure. The number of follicles at each stage of development or in atresia was counted in every 20th section (approximately every 150 µm) through the entire ovary. The number of follicles per section and the percentage at each stage of development were calculated.
Serum hormone analysis
Serum progesterone and estradiol concentrations were measured using commercial RIA kits DSL-4800 and DSL-3400, respectively (Diagnostic Systems Laboratories, Webster, TX) according to the instructions of the manufacturer, at the National Association of Testing Authorities (Adelaide, Australia) accredited Reproductive Medicine Laboratories (Sydney, Australia). Assays were performed in duplicate, and all samples were measured in a single assay. The lower limits of detection were 8 pM estradiol and 0.3 nM progesterone. The within-assay coefficients of variation were 10.0% in the estradiol assay and 7.9% in the progesterone assay. All data points were above the assay thresholds. The precision of the estradiol assay at low serum estradiol content was confirmed in experiments using serum from mice after ovariectomy and exogenous steroid hormone replacement.
Serum FSH and LH were determined by RIA using reagents kindly provided by Dr. Parlow at National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) (Bethesda, MD). Iodinated preparations and antisera used in the FSH and LH RIAs were rFSH-I-9 and anti-rFSH-S-11, and rLH-I-9 and anti-rLH-S-10, respectively. Results are expressed in terms of NIDDK mFSH-RP (AFP-5308D) and NIDDK mLH-RP (AFP-5306A). The iodination preparations were iodinated using Iodogen reagent (Pierce, Rockford, IL). Goat antirabbit IgG (GAR12; Monash Institute of Reproduction and Development, Monash University, Melbourne, Australia) was used as second antibody for the FSH and LH RIAs. Assays were performed in duplicate on 20-µl serum samples, and all samples were measured in a single assay. The lower limits of detection were 0.78 ng/ml FSH and 0.10 ng/ml LH. The within-assay coefficients of variation were 8.1% in the FSH assay and 7.3% in the LH assay. Data points below the assay threshold were assigned the threshold values for data analysis.
Ovarian steroidogenic enzyme mRNA analysis
Quantitative RT-PCR was used to analyze the quantity of steroidogenic acute regulatory protein (StAR), P450 side chain cleavage (P450scc), 3ß-hydroxysteroid dehydrogenase-1 (HSD3ß1), and P450 17
-hydroxylase/C1720-lyase (P450c17) mRNA in ovarian tissue from superovulated 27- to 29-d-old female mice killed 14 h after hCG injection. Primers to detect expression of StAR, HSD3ß1, P450scc, and P450c17 mRNAs were designed using PrimerExpress 2.0 software from respective cDNA sequences (24, 25, 26) (GenBank accession no. AF195119). The intron/exon boundaries for StAR were identified using the complete murine sequence (GenBank accession no. AY032730), for P450scc by comparison with the rat sequence (27), and for HSD3ß1 and P450c17 by comparison with the human sequences from Bain et al. (25) and Kagimoto et al. (28), respectively. The primers used were as follows: StAR, forward, 5'CCGGAGCAGAGTGGTGTCAT and reverse, 5'-TGCGATAGGACCTGGTTGATG; HSD3ß1, forward, 5'-GGACAAAGTATTCCGACCAGAAAC and reverse, 5'CAGGCACTGGGCATCCA; P450scc, forward, 5'ACAGACGCATCAAGCAGCAA and reverse, 5'-CACTGCTGATGGACTCAAAGGA; P450c17, forward, 5'-TGGCTTTCCTGGTGCACAA and reverse, 5'-GTGTTCGACTGAAGCCTACATACTG and 18S (Universal 18S primers; Ambion Austin, TX). Ovaries were snap frozen in liquid N2 and stored at 70 C before RNA extraction. Total cellular RNA was extracted according to a modification of the method described by Chomczynski and Sacchi (29). After treatment with RNase-free DNase I (500 IU/ml; 60 min at 37 C) (Roche Molecular Biochemicals, Mannheim, Germany), first-strand cDNA was reverse transcribed from 1 µg RNA using a Superscript II RNase H Reverse Transcriptase kit (90 min at 43 C) (Invitrogen, Carlsbad, CA). The PCR amplification used reagents supplied in a 2x SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA), and each reaction volume (20 µl total) contained of 0.51 µM 5' and 3' primers and 3 µl cDNA. The negative control included in each reaction consisted of H2O substituted for cDNA. PCR amplification was performed in triplicate in a ABI Prism 5700 Sequence Detection System (Applied Biosystems) according to the instructions of the manufacturer. The absence of alternative PCR products and primer dimers in the PCR product was shown by a single dissociation peak and confirmed by visualization of the PCR product after agarose gel electrophoresis. Serial dilutions of cDNA were analyzed to confirm a linear relationship between cDNA content and quantity of product across the amplification range. The efficiency of each PCR was determined by regression analysis of the fluorescence of the sample at each cycle number. Efficiencies of all PCRs were between 80 and 100%. Data were normalized for 18S mRNA expression using the 2-
Ct method (30) and expressed as a ratio of the mean value for TGFß1+/± control ovaries.
Statistical analysis
Data were analyzed with SPSS 11.0 for Windows software (SPSS, Chicago, IL), using independent samples t test or one-way ANOVA with post hoc Tukeys test when appropriate. When data were not normally distributed, nonparametric Mann-Whitney U tests were used. Significance was inferred at P < 0.05. Data are mean ± SEM unless specified otherwise.
| Results |
|---|
|
|
|---|
Effect of TGFß1 null mutation on estrous cycling
The failure to mate, and extended interval between placement with a male and mating in TGFß1 null mice, suggested disrupted estrous cycling activity. To investigate the effect of TGFß1 null mutation on estrous cyclicity, the stage of estrous cycle was tracked by analysis of vaginal cytology for a period of 28 d from 6 wk of age. Cycles were severely perturbed in null mutant mice, with deficiency in TGFß1 reducing the frequency of estrus events by 42% (P = 0.001) (Fig. 1
, A and B) and increasing mean estrous cycle length by 70% (P = 0.01) (Fig. 1
, A and B). Consistent with fewer estrus events was a significant reduction in the percentage of time spent in the proestrus stage of the cycle in TGFß1/ females (Fig. 1C
). However, there was no difference in the proportion of time spent in other stages of the estrus cycle, because TGFß1/ females often demonstrated a prolonged estrus event, as indicated by 100% cornified vaginal epithelial cells present for 2 d or more (Fig. 1A
).
|
There was no difference in the absolute weight or weight relative to body size of ovaries from TGFß1+/± and TGFß1/ females collected at first proestrus [2.2 ± 0.2 mg in TGFß1+/± females (n = 12) vs. 1.7 ± 0.2 mg in TGFß1/ females (n = 9)]. Analysis of histological sections of ovaries showed that follicles in the full range of expected stages of development (Fig. 2
, A and C) and mature antral follicles with normal morphology were present regardless of genotype (Fig. 2
, B and D). Quantitative analysis of follicle numbers showed that there was no effect of TGFß1 status on the relative abundance of primordial/primary follicles (types 13), preantral follicles with multiple layers of granulosa cells (types 4, 5), or small antral (type 6) or large antral (types 7, 8) follicles (Fig. 2E
). Furthermore, there was no effect on the proportion of atretic follicles (data not shown).
|
|
|
|
|
To investigate the effect of TGFß1 null mutation on ovarian steroidogenesis, ovaries excised from gonadotropin-stimulated prepubertal females approximately 2 h after ovulation were analyzed, and steroidogenic enzyme mRNA expression was measured using quantitative RT-PCR. There was a 50% decrease in expression of mRNA encoding HSD3ß1 and a 4-fold increase in P450c17 mRNA in TGFß1/ compared with TGFß1+/± mice (Fig. 6
). StAR and P450scc was not significantly altered in TGFß1/ and TGFß1+/± ovaries.
|
|
|
Effect of TGFß1 null mutation on uterine morphology
To examine the effect of TGFß1 null mutation on uterine morphology, sections of fixed, paraffin-embedded uteri from d 3.5 pc naturally mated females were stained with hematoxylin and eosin (Fig. 8
). There was no overt effect of genotype on the tissue mass or diameter of uterine tissue (data not shown). The uteri from TGFß1/ females were morphologically indistinguishable from uteri dissected from TGFß1+/± females in terms of luminal diameter, presence and relative thickness of endometrial and myometrial tissues, and the abundance and size of uterine glands.
|
| Discussion |
|---|
|
|
|---|
The major determinant of reduced fecundity in null mutant mice was that ovulation occurred approximately 40% less frequently than in wild-type controls, and, when it did occur, approximately 40% fewer oocytes were ovulated. Synthesis of the gonadotropin LH was severely reduced at the expected time of the LH surge in TGFß1 null mutant females. In contrast, administration of exogenous gonadotropins to immature TGFß1/ mice successfully induced ovulation, with a response equal to that seen in wild-type mice in terms of the proportion of mice that ovulated and the number of oocytes released. The effects of TGFß1 deficiency on estrous cycling and ovulation can thus largely be attributed to disrupted LH activity, suggesting a requirement for TGFß1 in normal hypothalamic or pituitary function. Mice with a mutation in the LH ß subunit are totally infertile and anovulatory (31), showing the absolute requirement for this hormone in estrous cycling and ovulation. LH was detectable at low levels in most of the TGFß1/ mice, indicating that synthesis must be impaired or dysregulated rather than completely absent. This is consistent with the wide variance in ovarian cycle disturbances manifesting both at a population level and within individual mice. Some null mutant mice cycled more successfully than others, which in the worst cases, showed only one estrus event over the 28-d period of study. More than half of the TGFß1 null females failed to mate even once during the 28-d period of caging with males, which might reflect a more severe LH deficiency in these animals.
Although growth trajectory after birth was delayed in TGFß1 null mutant mice and their onset of puberty occurred on average 6 d later than in wild-type mice, this was not causally associated with reduced LH at first proestrus, because there was no correlation between body weight and serum LH content in individual mice and, furthermore, the mean body weight of mice at proestrus was similar regardless of genotype (data not shown). Therefore, although TGFß1 appears to be required for normal growth rate after birth and this likely explains the delay in puberty in TGFß1 null mutant mice, growth impairment is unlikely to account for disrupted LH activity at the time of onset of ovarian cycling.
The observation that approximately 10% of null mutant mice were able to ovulate, mate, and maintain pregnancy successfully to deliver overtly normal pups at term shows that, although TGFß1 is clearly essential for normal fecundity, other factors or circumstances must attenuate the severity of effects caused by absence of this cytokine. Because the proportion of null mutant mice able to establish pregnancy after mating was comparable with the proportion in which embryos reached blastocyst stage, it is reasonable to infer that postimplantation loss is not a major contributing factor in reduced fecundity in TGFß1-deficient female mice. This suggests that implantation and placental morphogenesis can proceed relatively unimpaired in the absence of maternal TGFß1 but does not exclude the possibility that a more rigorous analysis might reveal deficits in the quality of placental structure and function or in fetal development and growth trajectory. A gene dosage effect and rescue by transfer of maternal TGFß1 across the placenta is evident when TGFß1-deficient fetuses gestate in mothers heterozygous for the TGFß1 null mutation (17, 21, 32), but the current data show that maternal cytokine is not an essential requirement for fetal development, at least in the event of heterozygousity for the TGFß1 mutation in embryos.
The variability in fertility phenotype seen in the current experiments is likely to reflect differences in the extent to which individual mice carry genes conferring compensation for TGFß1 deficiency or other interactions with TGFß1 status. It has been noted previously that genetic background has a significant influence on penetrance of embryonic lethality due to defects in pre- and postimplantation development in TGFß1/ embryos (21, 33). On the mixed genetic background CF1/129/C3H used in the current study, breeding pairs heterozygous for the TGFß1 null mutation were reasonably fertile, but, in concurrence with previous reports (21, 34), we observed less than the expected number of pups genotyped as homozygous for the null mutation, reflecting embryonic lethality in approximately 50% of homozygous offspring and severely constraining availability of experimental mice. Our attempts to backcross the TGFß1 null genotype onto the C57BL/6 background resulted in progressively declining fertility, as experienced previously by others, and can be attributed to a small number of genetic modifiers (21, 33). The number of heterozygous offspring was also approximately 50% less than would be expected, suggesting a Tgfß1 gene dosage effect in the developing fetal-placenta unit. Previous studies have reported a selective loss of both TGFß1/ and TGFß1+/ conceptuses in TGFß1+/ intercrosses (34).
Impaired ovarian function persisted after ovulation, with diminished progesterone production by corpora lutea. Interestingly, estrogen synthesis was unaffected, both during the periovulatory period and in early pregnancy. This suggests that follicular estrogen synthesis is less sensitive to TGFß1 deficiency than luteal cell progesterone synthesis and is consistent with the dominant function of LH in initiating luteinization compared with the greater dependence of follicle development on FSH, the circulating level of which was unchanged in the absence of TGFß1. Reduced serum progesterone content was seen even when the smaller number of corpora lutea was taken into account and was associated with alterations in expression of mRNAs encoding components of the steroidogenic pathway. HSD3ß1 and P450c17 mRNA expression in ovaries from immature gonadotropin-stimulated TGFß1 null mice were decreased and increased, respectively, when compared with synthesis in ovaries from TGFß1-replete littermates. HSD3ß1 catalyzes the conversion of pregnenolone to progesterone, and P450c17 catalyzes the conversion of progesterone to androstenedione. The decreased and increased relative expression of these enzymes in TGFß1 null mutants is consistent with the observation of reduced progesterone production with normal estradiol production in naturally mated TGFß1 null females. Therefore, TGFß1 deficiency appears to cause impaired communication in the paracrine or autocrine signals that regulate progesterone synthesis in the corpus luteum.
Although the steroidogenic defect can in part be attributed to reduced LH, altered expression of steroidogenic enzymes was evident after gonadotropin replacement, suggesting that LH-independent mechanisms may also contribute. Inhibitory effects of TGFß1 deficiency on progesterone synthesis or secretion might be mediated through direct regulatory effects of this cytokine on luteal cells, because luteal cells express TGFß receptors and are responsive to this cytokine in vitro (7, 8). Alternatively, ovarian macrophages potentially act as a mediating cell by virtue of their high responsiveness to TGFß1 (35) and specific roles in development and function of the corpus luteum (36, 37, 38). Macrophage-secreted cytokines TNF-
and IL-1 are implicated in regulating luteal steroidogenesis (39), and disrupted macrophage regulation leading to overproduction of these antisteroidogenic cytokines in the absence of TGFß1 may contribute to the reduced serum progesterone seen in early pregnancy. The ovarian phenotype we describe in TGFß1 null mutant mice bears remarkable similarity to that seen in macrophage-deficient Csf1op/Csf1op mice, which also have disrupted ovarian cycles, reduced ovulation rates, and impaired steroidogenesis associated with reduced LH (40). In Csf1op/Csf1op mice, ovarian effects appear to be largely secondary to altered hypothalamic activity caused by absence of macrophages in that tissue (41), so it would be of interest to examine whether hypothalamic macrophage function is similarly altered in TGFß1 null mutants.
Despite infrequent estrus and reduction in oocytes ovulated, approximately 40% of TGFß1 null females were able to mate. However, in 80% of mice in which mating occurred, pregnancy failed due to impaired preimplantation embryo development. Developmental arrest appeared not to be due to an adverse maternal tract environment secondary to TGFß1 or progesterone deficiency but rather was intrinsic to the embryo, because strategies including progesterone replacement or ex vivo fertilization and embryo culture failed to rescue embryonic demise. Furthermore, histological evaluation of the uterus revealed no differences in the structure of the endometrium and glands. This finding does not preclude a role for maternal TGFß1 in the reproductive tract but does show that TGFß1 deficiency in the oviduct and uterus is an insufficient explanation for the embryo lethality observed.
It is possible that TGFß1+/ early embryos had reduced developmental competence by virtue of their depleted capacity to synthesize endogenous TGFß1 after embryonic genome activation. Embryos normally synthesize TGFß1 (10, 13) and express TGFß receptors (10, 11), supporting an autocrine role for TGFß1 in preimplantation development (42). A premorula lethality in null embryos has been reported in TGFß1 heterozygous breeder pairs and contributes to the less than expected proportion of TGFß1/ offspring observed (21). However, it is unlikely that reduced embryonic TGFß1 synthesis is responsible for the developmental failure in embryos from TGFß1/ females mated with TGFß1+/+ males described here. In vitro fertilization using sperm from TGFß1/ males and TGFß1+/+ oocytes shows that the cleaved embryos (all TGFß1+/) develop to blastocysts at a similar rate to those oocytes fertilized by TGFß1+/+ sperm (Ingman, W. V., and S. A. Robertson, manuscript in preparation). Therefore, when the null mutation is paternally inherited, TGFß1+/ embryos develop to the blastocyst stage normally. The possibility that maternally imprinted expression of the Tgfß1 gene in the developing embryo is required can be disregarded because whether the null gene was inherited maternally vs. paternally was found not to influence the expected frequency of the null gene in offspring (21).
The most compelling explanation for embryonic arrest in null mutant mice is oocyte incompetence, caused by developmental defects occurring during oocyte growth and development in the TGFß1 null ovary, such that those follicles that do progress to ovulation yield oocytes less capable of supporting development after fertilization. It is well known that, as oocytes grow and develop in the ovarian follicle, they gradually and sequentially acquire the cellular and molecular machinery required to support early embryogenesis, and that the quality of the follicular milieu directly affects the developmental potential of the ensuing embryo (43, 44). Perturbation can have adverse consequences for structural organization of the embryo, activation of the embryonic genome, and subsequent gene expression patterns several cell cycles into embryo development, often manifesting in arrest during the preimplantation phase (44). Oocytes from TGFß1 null mutants appear to be fully meiotically competent (capable of reaching metaphase II), as evidenced by comparable fertilization frequencies with control mice. Impaired cytoplasmic competence of TGFß1 null mutant oocytes is more likely, potentially due to absence of oocyte TGFß1 protein or mRNA, because TGFß1 is known to be a maternally stored transcript (12). Alternatively, oocyte incompetence might reflect a more generalized perturbation of oocyte development in a suboptimal, TGFß-deficient follicular environment.
In summary, we conclude that TGFß1 deficiency severely impacts female fertility through disrupted ovulation, oocyte development, and corpus luteum function. Absence of maternal TGFß1 causes impaired LH activity and also appears to impact the maturing oocyte in such a way as to reduce developmental competence after ovulation and fertilization. The relevance of this work to human follicle development is highlighted by comparable expression patterns for TGFß1 and its signaling molecules in the human ovary (45, 46) and the observation that levels of TGFß1 in follicular fluid correlate with pregnancy success after in vitro fertilization (47).
| Acknowledgments |
|---|
| Footnotes |
|---|
W.V.I., R.L.R., and K.W. have nothing to declare. S.A.R. consults for GroPep Ltd. (Adelaide, Australia).
First Published Online November 3, 2005
Abbreviations: hCG, Human chorionic gonadotropin; HSD3ß1, 3ß-hydroxysteroid dehydrogenase-1; P450c17, P450 17
-hydroxylase/C1720-lyase; P450scc, P450 side chain cleavage; pc, postcoitus; scid, severe combined immunodeficiency spontaneous mutation; StAR, steroidogenic acute regulatory protein.
Received September 19, 2005.
Accepted for publication October 21, 2005.
| References |
|---|
|
|
|---|
, and TGF-ß genes in preimplantation mouse embryos. Science 241:18231825
5-
4 isomerase and differential expression in gonads, adrenal glands, liver, and kidneys of both sexes. Proc Natl Acad Sci USA 88:88708874
-hydroxylase/C1720 lyase. Genomics 10:270275[CrossRef][Medline]
-hydroxylase genes: molecular basis of one example of combined 17
-hydroxylase/17,20 lyase deficiency. Mol Endocrinol 2:564570
C(T)) method. Methods 25:402408[CrossRef][Medline]This article has been cited by other articles:
![]() |
X. Zheng, D. Boerboom, and P. D Carriere Transforming growth factor-{beta}1 inhibits luteinization and promotes apoptosis in bovine granulosa cells Reproduction, June 1, 2009; 137(6): 969 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Guerin, J. R. Prins, and S. A. Robertson Regulatory T-cells and immune tolerance in pregnancy: a new target for infertility treatment? Hum. Reprod. Update, March 11, 2009; (2009) dmp004v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-J. Chen, M.-T. Lee, H.-C. Yao, P.-W. Hsiao, F.-C. Ke, and J.-J. Hwang Crucial Role of Estrogen Receptor-{alpha} Interaction with Transcription Coregulators in Follicle-Stimulating Hormone and Transforming Growth Factor {beta}1 Up-Regulation of Steroidogenesis in Rat Ovarian Granulosa Cells Endocrinology, September 1, 2008; 149(9): 4658 - 4668. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. V. Ingman and R. L. Jones Cytokine knockouts in reproduction: the use of gene ablation to dissect roles of cytokines in reproductive biology Hum. Reprod. Update, March 1, 2008; 14(2): 179 - 192. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. V. Ingman and S. A. Robertson Transforming Growth Factor-{beta}1 Null Mutation Causes Infertility in Male Mice Associated with Testosterone Deficiency and Sexual Dysfunction Endocrinology, August 1, 2007; 148(8): 4032 - 4043. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Diaz, K. Wigglesworth, and J. J. Eppig Oocytes determine cumulus cell lineage in mouse ovarian follicles J. Cell Sci., April 15, 2007; 120(8): 1330 - 1340. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |