| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Transcriptionally Up-Regulates Hormone-Sensitive Lipase via the Involvement of Specificity Protein-1
Department of Biological Science and Biotechnology (T.D., J.C.), Tsinghua University, Beijing 100084, China; Chipscreen Biosciences Ltd. (T.D., S.S., X.-P.L., J.C., Z.-Q.N.), Shenzhen Research Institute of Tsinghua University, Shenzhen 518057, China; and Institute of Materia Medica (P.-P.L., Z.-F.S.), Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China
Address all correspondence and requests for reprints to: Zhi-Qiang Ning, Chipscreen Biosciences Ltd., Shenzhen Research Institute of Tsinghua University, Nanshan District, Shenzhen 518057, China. E-mail: zqning{at}chipscreen.com.
| Abstract |
|---|
|
|
|---|
and hormone-sensitive lipase (HSL) play important roles in lipid metabolism and insulin sensitivity. We demonstrate that expression of the HSL gene is up-regulated by PPAR
and PPAR
agonists (rosiglitazone and pioglitazone) in the cultured hepatic cells and differentiating preadipocytes. Rosiglitazone treatment also results in up-regulation of the HSL gene in liver and skeleton muscle from an experimental obese rat model, accompanied by the decreased triglyceride content in these tissues. The proximal promoter (87 bp of the human HSL gene) was found to be essential for PPAR
-mediated transactivating activity. This important promoter region contains two GC-boxes and binds the transcription factor specificity protein-1 (Sp1) but not PPAR
. The Sp1-promoter binding activity can be endogenously enhanced by PPAR
and rosiglitazone, as demonstrated by analysis of EMSA and chromatin immunoprecipitation assay. Mutations in the GC-box sequences reduce the promoter binding activity of Sp1 and the transactivating activity of PPAR
. In addition, mithramycin A, the specific inhibitor for Sp1-DNA binding activity, abolishes the PPAR
-mediated up-regulation of HSL. These results indicate that PPAR
positively regulates the HSL gene expression, and up-regulation of HSL by PPAR
requires the involvement of Sp1. Taken together, this study suggests that HSL may be a newly identified PPAR
target gene, and up-regulation of HSL may be an important mechanism involved in action of PPAR
agonists in type 2 diabetes. | Introduction |
|---|
|
|
|---|
belongs to the nuclear receptor family that serves as a ligand-regulated transcription factor. PPAR
forms a heterodimer with the retinoid X receptor (RXR) and regulates gene expression by either binding to specific DNA sequences termed peroxisome proliferator response elements (PPREs) or interacting with other transcription factors in a DNA binding-independent manner (1). The role of PPAR
in regulation of glucose and lipid metabolism has been well established, as illustrated by the applications of the thiazolidinedione (TZD) type of PPAR
agonists (2). TZDs such as rosiglitazone and pioglitazone improve insulin sensitivity and relieve type 2 diabetes primarily by up-regulating genes involved in glucose and lipid metabolism in adipose tissue, liver, and skeleton muscle (3). PPAR
agonists are also shown to reduce triglyceride (TG) content in liver and/or skeleton muscle in both animal models (4, 5) and type 2 diabetes patients (6, 7, 8). Hormone-sensitive lipase (HSL) is an intracellular neutral lipase with a broad specificity for lipid substrates such as TG, diglycerides, cholesteryl esters, and retinyl esters. HSL is the major enzyme responsible for the hydrolysis of stored TG in adipose tissue and has a pivotal role in the mobilization of fatty acids in many other tissues, including liver and muscle (9, 10). Whereas many studies have focused on the posttranslational mechanisms in HSL regulation and demonstrated the importance of the HSL protein phosphorylation in enzyme activity (11), relatively fewer investigations have been carried out in terms of the transcriptional regulation of the HSL gene.
The HSL gene is known to be involved in various metabolic disorders. For example, HSL knockout mice develop hyperglycemia and hyperinsulinemia, suggesting that lack of HSL leads to impaired insulin sensitivity (12, 13). The insulin resistance was observed in skeletal muscle and liver in those studies. Human studies also support a role for HSL in insulin sensitivity and show that maximum stimulated lipolysis is defective in patients with the insulin-resistance syndrome (14, 15), and decreased expression and function of HSL are present in fat cells from obese subjects (16). Furthermore, genetic studies suggest that the polygenic background of HSL may be involved in the pathogenesis of type 2 diabetes (17, 18).
Based on the importance of both PPAR
and HSL in metabolism and insulin sensitivity, we studied the regulatory effects of PPAR
and its agonists on the HSL gene expression. In this report, we show the evidence that expression of the HSL gene is up-regulated by PPAR
and PPAR
agonists, which requires the involvement of the transcription factor specificity protein-1 (Sp1).
| Materials and Methods |
|---|
|
|
|---|
TTT), 34 to 38 (CCGCC
TTTTT), and both were generated using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) and designated as M5, M3, and M53, respectively. Same-point mutations (M53) were also generated in the p901 promoter fragment, and the fragment was designated as p901-M53. Human cDNAs for RXR
and PPAR
were cloned by RT-PCR from the liver mRNA and inserted into pcDNA3.1 (Invitrogen, Carlsbad, CA). The integrity and fidelity of all constructs thus made were verified by DNA sequencing. The human Sp1 expression plasmid was kindly provided by Dr. G. Suske (Institut fur Molekularbiologie und Tumorforschung, Marburg, Germany). pCMVßGal was purchased from CLONTECH (Palo Alto, CA).
Cell culture
The human hepatoma SMMC-7721 cell line (20, 21) and primary human fetal liver cells (CCC-L) were obtained from the Cell Culture Center of Chinese Academy of Medical Sciences (Beijing, China) and cultured in RPMI 1640 and DMEM medium, respectively, containing 10% fetal bovine serum (FBS), 50 µg/ml streptomycin, and 50 U/ml penicillin at 37 C in a humidified incubator with 5% CO2.
Rat preadipocytes were prepared as described by Haraguchi et al. (22). Briefly, fat tissues from the male Sprague Dawley rats (35 wk old) were excised, minced, and digested with collagenase for 1 h at 37 C. Cells were filtered through 25-µm nylon mesh. The filtrate was centrifuged at 600 x g for 5 min. The floating adipocytes were discarded and the pellet containing preadipocytes was collected. After two washes, cells were plated into cell culture dishes at a density of 2 x 104 cells/cm2 and cultured in DMEM containing 10% FBS. When cells reached confluence, the culture medium was switched to the differentiation medium (DMEM containing 10% FBS supplemented with 0.1 µM dexamethasone and 10 µg/ml insulin) and cultured for various days in the presence or absence of the indicated compounds for 48 h. The day for the differentiation medium addition was designated as d 0 in the Results section.
FBS in culture medium was treated with charcoal dextran to reduce the lipid interference in experiments when cells were incubated with compounds or transfected with PPAR
expression plasmid.
Animal experiments and TG content analysis
Newborn Wistar rats were sc injected with monosodium L-glutamate (MSG) at 4 g/kg·d for seven successive days. In contrast to the normal rats, the MSG rats developed obesity with increased plasma TG, cholesterol, and free fatty acid contents as well as impaired insulin sensitivity in their adulthood (23, 24, 25). The obese MSG rats were treated every day with rosiglitazone (5 mg/kg) by oral route for 40 d. After fasting for 6 h on the last treatment day the animals were killed, and total RNA from liver, muscle, and adipose tissues were isolated for the analysis of the HSL gene expression. To examine TG content of liver and skeleton muscle, the liver and skeleton muscle tissues were removed. TG content in those tissues was measured as described by Atkinson et al. (26). All animal protocols were approved by the Animal Care Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.
Gene expression analysis
Total RNA was extracted from cells or tissues with an RNeasy minikit (QIAGEN, Chatsworth, CA). The first-strand cDNA was synthesized using the oligo(dT) primers, followed by using SuperScript II reverse transcriptase (Invitrogen) according to the manufacturers instructions. Amplification of HSL cDNA was then performed with TaqMan PCR reagent kits in the ABI Prism 7700 sequence detection system according to the protocols provided by the manufacturer (PE Applied Biosystems, Foster City, CA). The levels of HSL mRNA were detected in each sample and normalized by the amounts of 18 S ribosomal RNA, whose primers and probe were obtained from PE Biosystems. The primers and probe used for the amplification of the HSL cDNA are shown in Table 1
. Sense and antisense primer pairs used for semiquantitative RT-PCR of CD36 cDNA were 5'-GGACGCTGAGGACAACACAGT-3' and 5'-CTGCAATACCTGGCTTTTCTCAA-3', respectively. Sense and antisense primers for glyceraldehyde-3-phosphate dehydrogenase were 5'-ATGCCATCACTGCCACCC-3' and 5'-GCCTGCTTCACCACCTTCTT-3', respectively. PCR products were analyzed by electrophoresis on a 1.5% agarose gel in the presence of 0.5 µg/ml ethidium bromide.
|
, RXR
, and/or Sp1 expression plasmids were cotransfected. After 24 h, culture media were changed, and the cells were incubated in the presence or absence of the indicated compounds dissolved in dimethylsulfoxide and fresh media. After an additional 24 h, cells were lysed and prepared for measurement of luciferase activity using a luciferase assay kit (Promega). Luciferase enzyme activity was detected by the Ascent Fluoroskan FL reader (Thermo Labsystems, Helsinki, Finland). To measure ß-galactosidase activity, 50 µl of supernatant from each transfection lysate were transferred to a new microplate, and the enzyme activity was detected by a reagent kit (Promega) and read in a microplate reader (Bio-tek Instruments Inc., Winooski, VT). The ß-galactosidase data were used to normalize the luciferase data. By cotransfection with a green fluorescence protein (GFP) plasmid (CLONTECH), the above procedures gave transfection efficiencies around 4060% 48 h after transfection, as monitored by a fluorescence microscope (Leica, Heidelberg, Germany).
Western blot analysis
Total cellular lysates were prepared from rat preadipocytes after treatment with the indicated compounds or from SMMC-7721 cells after transfection with RXR
, PPAR
, or both for 48 h. For internal controls, SMMC-7721 cells were cotransfected with a GFP plasmid. Cells were lysed in lysis buffer [50 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, and 10% glycerol)] in the presence of protease inhibitors (protease inhibitor cocktail tablets, Roche Molecular Biochemicals). Protein concentrations in lysates were determined using a PlusOne 2-D Quant kit (Amersham Biosciences Corp., San Francisco, CA) according to the manufacturers instructions. Samples containing 30 µg of total protein were separated in 9% SDS-polyacrylamide gels and transferred to Hybond-P polyvinyl difluoride transfer membrane (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK). Transfer and equal loading were confirmed by Ponceau S staining before blocking to the membrane with 5% milk/Tris-buffered saline buffer containing 0.1% Tween 20) for 2 h at room temperature. Blocked membranes were incubated individually with anti-HSL antibody (a gift from Dr. W. J. Shen, Department of Medicine, Stanford University, Stanford, CA), anti-ß-actin antibody (Sigma, St. Louis, MO), anti-PPAR
antibody (Biomol), or anti-GFP antibody (CLONTECH) for 2 h. After incubation with antibodies, membranes were washed in Tris-buffered saline buffer containing 0.1% Tween 20, followed by incubation with horseradish peroxidase-conjugated antirabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Enhanced chemiluminescence (Amersham Pharmacia Biotech) was used for signal detection.
EMSAs
In vitro transcription/translation of human PPAR
and RXR
cDNA clones was performed using TNT kits (Promega). Purified Sp1 protein was purchased from Promega. Nuclear extracts from SMMC-7721 cells were prepared as described previously (27) with modifications. Briefly, cells (1 x 107) were resuspended in 400 µl of hypotonic buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.625% Nonidet P-40, and 1 mM dithiothreitol] with protease inhibitors. After incubation on ice for 10 min, nuclei were collected by centrifugation at 1000 x g for 5 min. The nuclei were resuspended in 50 µl of high-salt buffer [20 mM HEPES (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, and 0.5 mM dithiothreitol] with protease inhibitors and maintained on ice for 40 min, followed by centrifugation at 17,000 x g for 10 min. Extracts were separated from pellet debris and stored at 70 C until use for mobility shift assays. EMSA was performed using the digoxigenin (DIG) gel shift kit (Roche Molecular Biochemicals) according to the manufacturers instructions. Briefly, DIG-labeled double-stranded oligonucleotides containing the 87/15 region of the HSL promoter (TTTCTGGGTGGGAGGTGGCTTGTGCGGCTACACCCTGGGCAGGCCAGCCCCGCCCCCGGGTTTATTGCCCCAG; GC boxes are underlined) or GC-box mutated 87/15 region (TTTCTGGGTTTTAGGTGGCTTGTGCGGC TACACCCTGGGCAGGCCAGCCTTTTTCCCGGGTTTATTGCCCCAG; mutated GC boxes are underlined) or PPRE (AGGGACCAGGACAAAGGTCACGC) were incubated with 5 µl of the in vitro-translated PPAR
and RXR
reticulocyte lysate or 110 ng of purified Sp1 protein, or 4 µg of nuclear extracts from SMMC-7721 cells in binding buffer [10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM dichlorodiphenyl-trichloroethane, 0.05 µg/µl poly(dI-dC), 5% glycerol, and 0.1 µg/µl BSA] for 20 min at room temperature.
In the competition experiments, unlabeled probes were added at 100-fold molar excess. For assays in the presence of mithramycin A, the DNA probe was preincubated with the compound (100 nM final concentration) for 1 h at 4 C, and then Sp1 protein was added. For supershift assays, nuclear extracts were preincubated with rabbit polyclonal antibodies against Sp1 (sc-59X, Santa Cruz Biotechnology) for 40 min on ice, followed by the addition with the indicated probe. Protein-DNA complexes were separated by electrophoresis in 5% polyacrylamide gels and transferred onto Hybond-N+ positively nylon transfer membrane (Amersham Pharmacia Biotech). After blocking, membranes were incubated for 30 min at room temperature with alkaline phosphatase-conjugated anti-DIG antibody. Disodium 3-(4-methoxyspiro{1, 2-dioxetane-3,2'-{5'-chloro} tricydo[3.3.1.13,7] decan}-4-yl) phenylphosphate (CSPD) was used as the substrate for the detection.
Chromatin immunoprecipitation (ChIP) assays
SMMC-7721 cells (2 x 107 cells) were treated or untreated 1 µM rosiglitazone for 24 h or transfected with PPAR
/RXR
for 48 h and then fixed with 1% formaldehyde. The cross-linking reaction was stopped by addition of 0.125 M glycine. After rinsing with ice-cold PBS, cells were scraped and lysed with lysis buffer [1% SDS, 5 mM EDTA, 50 mM Tris-HCl (pH 8.0)]. Nuclei were collected and sonicated to desired chromatin length (6001000 bp). The chromatin was precleared by addition of sheared salmon sperm DNA, rabbit IgG, and protein A-conjugated beads (Sigma) and incubated at 4 C for 2 h with gentle agitation. The beads were pelleted and the supernatant was immunoprecipitated with rabbit antibodies against Sp1 (Upstate Biotechnology, Lake Placid, NY) at 4 C overnight. The protein-antibody complexes were collected by addition of protein A-conjugated beads at 4 C for 1 h. The beads were extensively washed, and protein-DNA cross-links were reversed by heat at 65 C for 6 h. DNA fragments were purified with QIAGEN Qiaquick spin kit. PCR was performed with primers [5'-GGGAGCTGAGCCCTCTACTCT-3' (sense) and 5'-GCTGGGACTGCTGGTCTGT-3' (antisense)] and amplified a 159-bp region of the human HSL promoter. PCR products were resolved on a 2% agarose gel in the presence of 0.5 µg/ml ethidium bromide.
Statistical analysis
Unless otherwise stated, data are expressed as the mean ± SD from three independent experiments. The significance of differences was analyzed by using a Students t test.
| Results |
|---|
|
|
|---|
up-regulates HSL gene expression
in gene regulatory effects, we found that PPAR
agonists up-regulated HSL gene expression. As shown in Fig. 1A
agonists. Rosiglitazone up-regulated the HSL gene expression in a dose-dependent manner in SMMC-7721 cells (Fig. 1B
agonist treatment for 48 h. Whereas rosiglitazone significantly up-regulated expression of the HSL gene in the early stage (d 02) of preadipocyte differentiation, the gene expression levels in the late stage (d 810), when most cells differentiated to adipocytes (data not shown), became insignificant with or without rosiglitazone treatment (Fig. 1C
|
|
was directly involved in the HSL gene induction, SMMC-7721 cells were transfected with the PPAR
and/or RXR
expression plasmids, and the changes of HSL mRNA levels were examined. As shown in Fig. 3A
alone increased to a level comparable with rosiglitazone-treated cells without PPAR
transfection. Rosiglitazone further enhanced the HSL expression in cells transfected with either PPAR
alone or PPAR
plus RXR
(Fig. 3A
protein was confirmed in cells transfected with the PPAR
expression plasmid (Fig. 3B
, in the presence of endogenous or transfected RXR in SMMC-7721 cells, is capable of mediating HSL gene induction in the absence of the receptor agonist, and this transactivating activity can be augmented through the receptor activation by its agonist.
|
-mediated transactivation
-mediated HSL gene expression. To identify the regulatory sequences important for HSL gene induction by PPAR
, we created a series of deletion constructs based on a 900-bp fragment from the human HSL promoter (19). The constructs were evaluated by a luciferase reporter system in SMMC-7721 cells transfected with a PPAR
expression plasmid. As shown in Fig. 4
-dependent promoter activity. However, deletion of the region between 87 and 30 bp resulted in a complete loss of the promoter activity, indicating that this region of the HSL promoter was required for PPAR
-mediated transactivating activity. A similar trend of changes in luciferase activity was observed when SMMC-7721 cells were treated with rosiglitazone in the presence or absence of PPAR
transfection (data not shown).
|
-mediated HSL induction, we carried out site-directed mutagenesis to make a single or both GC-box(es) mutated, and the transcription activating activity of PPAR
was determined in SMMC-7721 cells that were cotransfected with a PPAR
expression vector and individual reporter plasmids having the proximal HSL promoter (from 87 to +25) with either wild-type (p87) or mutated GC-box(es). As shown in Fig. 5A
-induced promoter activity, and almost a complete loss of the promoter activity was observed when both GC-boxes were mutated. To investigate any other elements in the HSL promoter besides GC boxes that might be potentially involved in PPAR
-mediated transactivating activity, we used a longer fragment from the promoter (901 to +25) and created a reporter construct with both GC-boxes mutated (p901-M53). As shown in Fig. 5B
, suggesting that GC-box sequences in the proximal HSL promoter are the major elements required for the transactivating activity of PPAR
.
|
-mediated up-regulation of HSL expression
(31, 32, 33). We therefore tested for possible interactions between the indicated transcription factors and the 87 DNA fragment from the HSL gene promoter by EMSA. As shown in Fig. 6A
/RXR
proteins bound to an annealed PPRE oligonucleotide probe (lane 2) but, as expected, not to the probe derived from the 87 to 15 nucleotide sequence of the HSL promoter (lane 5). In contrast, as demonstrated in Fig. 6B
|
or its agonist on the potential Sp1-DNA interactions, nuclear extracts were isolated from cells untreated and cells treated with rosiglitazone or transfected with PPAR
, and the binding differences of Sp1 to the 87/15 probe were evaluated. As shown in Fig. 6C
(lane 3). This protein-DNA complex was composed of Sp1 because the complex could be significantly supershifted after coincubation of nuclear extracts from PPAR
-transfected cells with a specific antibody to Sp1 (lane 4). Enhancement of the binding activity of Sp1 to the HSL promoter sequence within nucleus by PPAR
was confirmed by ChIP analysis. As shown in Fig. 6D
transfection. Taken together, the results from gel shift and ChIP assays indicate that the GC-box containing sequence in the proximal promoter of the HSL gene binds to Sp1, and this promoter-transcription factor binding activity can be endogenously enhanced by PPAR
and its agonist.
To show that Sp1 was involved in PPAR
-induced HSL expression, transactivating activity of Sp1 was determined in SMMC-7721 cells cotransfected with Sp1 expression vector and a luciferase reporter plasmid inserted with the p87 fragment. As shown in Fig. 7A
, luciferase activity in cells transfected with the p87 reporter plasmid was induced by transfection with Sp1 alone to a comparable level with that of cells transfected with PPAR
alone. Additive transactivating activity in p87 was observed when cells were cotransfected with Sp1 and PPAR
. In all cases, addition of mithramycin A resulted in almost complete loss of luciferase activity in SMMC-7721 cells (Fig. 7A
). Finally, changes of the HSL gene expression in SMMC-7721 cells treated with rosiglitazone or transfected with PPAR
in the presence or absence of mithramycin A were determined. As shown in Fig. 7B
, HSL expression in SMMC-7721 cells induced either by rosiglitazone treatment or PPAR
transfection or both together were completely inhibited by mithramycin A. Meanwhile, induction of the CD36 gene, a known target gene regulated by PPAR
via PPRE, was not inhibited by mithramycin A treatment (Fig. 7C
), suggesting that the suppression of Sp1-DNA interaction, rather than any additional effects on PPAR
, contribute to the inhibitory effect of mithramycin A on PPAR
-mediated HSL gene induction. Taken together, the results indicate that the transcription factor Sp1 is functionally involved in the up-regulation of the HSL gene expression mediated by PPAR
and its agonist.
|
| Discussion |
|---|
|
|
|---|
activation by rosiglitazone results in a decrease in liver TG content in type 2 diabetes patients (6). Specific inactivation of liver PPAR
in lipoatrophic mice impairs TG clearance and abolishes hypolipidemic effect of rosiglitazone (41). Those results of studies indicate a relationship between PPAR
activation and the TG content control in liver and muscle, which may be important for the antidiabetic actions of TZDs. However, the molecular mechanisms underlined are largely unknown. Our results show that HSL, the gene encoding a key enzyme for hydrolysis of TG, is up-regulated by PPAR
or TZD compounds in cultured hepatic cells. We also show that the rosiglitazone treatment increases the HSL gene expression in the liver and muscle tissues of MSG obese rats that have impaired insulin sensitivity, accompanied by the decreased TG content in these tissues. Our results suggest that PPAR
-mediated up-regulation of the HSL gene may be an important mechanism through which TZDs regulate TG content in liver and muscle and hence improve insulin sensitivity. Interestingly, we have not observed a significant difference in the HSL gene expression in adipose tissue, the place that HSL is most abundantly present, between the rosiglitazone-treated and -untreated obese rats (Fig. 2A
and HSL are highly expressed in adipose tissue, it might be possible that this saturated situation prevents PPAR
agonists from further regulating the HSL gene expression in the tissue. Nevertheless, our results linked the HSL regulation with PPAR
that may be relevant to the actions of PPAR
agonists in improvement of insulin sensitivity.
Our results show that the 87/30-bp fragment from the proximal HSL promoter contains the essential elements for PPAR
-mediated transactivation. However, a consensus PPRE does not exist in the fragment, nor does the fragment bind to PPAR
, suggesting that a PPRE-independent mode of action, most likely involving other transcription factors, may be responsible for the PPAR
-mediated HSL induction. Indeed, analysis of the fragment reveals of the existence of the GC-box sequence that binds to Sp1 and mutations in GC-boxes result in the abrogation of PPAR
-transactivating activity. Furthermore, endogenous binding activity of Sp1 with the fragment from the proximal HSL promoter is augmented by PPAR
, and when Sp1-DNA binding activity is blocked by a selective inhibitor, PPAR
-mediated transactivation and its induction of the HSL expression are subsequently abolished. Taken together, our results strongly imply that PPAR
-mediated up-regulation of the HSL gene is independent of PPRE and requires the involvement of the transcription factor Sp1.
PPAR
(31, 32, 33) as well as PPAR
(42, 43) has been documented to functionally interact with Sp1 to modulate gene expression. Whereas PPARs are shown to physically bind to Sp1 in some studies (31, 32, 33, 43), nondirect interactions between those two classes of transcription factors have also been reported (42). We were unable to demonstrate a physical interaction between PPAR
and Sp1 by coimmunoprecipitation assays or cooperative binding of the PPAR
/RXR heterodimer and Sp1 to the proximal HSL promoter (data not shown). Therefore, PPAR
-mediated HSL induction may take place by an indirect interaction between PPAR
and Sp1, possibly involving other cofactors that need further identification.
Two promoters of different isoforms of the human HSL gene have been identified and characterized. Whereas the promoter upstream of exon T drives expression of HSL specifically in testis (44, 45), the promoter upstream of exon B (19), which was used in our study, is used in adipocytes and other tissues (11). An interesting observation in the promoter upstream of exon B is the absence of a consensus TATA-box sequence (19). One of the common features of TATA-less promoters is that GC-boxes are present upstream of the transcription start site, and the binding of Sp1 to the GC-box sequence is required for the assembly of the transcription complex (46). Sp1 has been shown to be responsible for the basal expression of acyl-coenzyme-A oxidase controlled by a TATA-less promoter, and the maximal expression of the acyl-coenzyme-A oxidase gene is achieved by the presence of other cofactors (47). Similar mechanisms might be proved to be true in terms of regulation of the HSL gene by Sp1, i.e. the presence of Sp1 is the precondition for the basal HSL gene expression, which can be influenced on the availability of specific transcriptional components, including PPAR
as demonstrated in the current study.
In conclusion, our results have shown that HSL is the PPAR
target gene, and the regulation of HSL expression by PPAR
requires the involvement of the transcription factor Sp1. These results may further define the regulatory role of PPAR
in lipid metabolism and provide more explanation of the molecular mechanisms of action of PPAR
agonists in type 2 diabetes.
| Acknowledgments |
|---|
| Footnotes |
|---|
The authors have no conflicts of interest.
First Published Online November 3, 2005
Abbreviations: ChIP, Chromatin immunoprecipitation; DIG, digoxigenin; FBS, fetal bovine serum; GFP, green fluorescence protein; HSL, hormone-sensitive lipase; MSG, monosodium L-glutamate; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; RXR, retinoid X receptor; SDS, sodium dodecyl sulfate; Sp1, specificity protein-1; TG, triglyceride; TZD, thiazolidinedione.
Received May 23, 2005.
Accepted for publication October 24, 2005.
| References |
|---|
|
|
|---|
(PPAR
). J Biol Chem 270:1295312956
activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats: comparison with PPAR-
activation. Diabetes 50:411417
(PPAR-
) and PPAR-
: effect of PPAR-
activation on abnormal lipid metabolism in liver of Zucker fatty rats. Diabetes 47:18411847[Abstract]
in vascular smooth muscle cells. Endocrinology 142:31253134
via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277:96769683
1 in KDR gene regulation mediated via interaction with both Sp1 and Sp3. Diabetes 53:12221229
} contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. J Biol Chem 278:3426834276
B
gene transcription by PPAR
. Mol Endocrinol 16:10291039
activators inhibit vascular endothelial growth factor receptor-2 expression by repressing Sp1-dependent DNA binding and transactivation. Circ Res 94:324332This article has been cited by other articles:
![]() |
S. Tejerina, A. De Pauw, S. Vankoningsloo, A. Houbion, P. Renard, F. De Longueville, M. Raes, and T. Arnould Mild mitochondrial uncoupling induces 3T3-L1 adipocyte de-differentiation by a PPAR{gamma}-independent mechanism, whereas TNF{alpha}-induced de-differentiation is PPAR{gamma} dependent J. Cell Sci., January 1, 2009; 122(1): 145 - 155. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. D. Wiggin, M. Kretzler, S. Pennathur, K. A. Sullivan, F. C. Brosius, and E. L. Feldman Rosiglitazone Treatment Reduces Diabetic Neuropathy in Streptozotocin-Treated DBA/2J Mice Endocrinology, October 1, 2008; 149(10): 4928 - 4937. [Abstract] [Full Text] [PDF] |
||||
![]() |
D Bonofiglio, H Qi, S Gabriele, S Catalano, S Aquila, M Belmonte, and S Ando Peroxisome proliferator-activated receptor {gamma} inhibits follicular and anaplastic thyroid carcinoma cells growth by upregulating p21Cip1/WAF1 gene in a Sp1-dependent manner Endocr. Relat. Cancer, June 1, 2008; 15(2): 545 - 557. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. E. Kershaw, M. Schupp, H.-P. Guan, N. P. Gardner, M. A. Lazar, and J. S. Flier PPAR{gamma} regulates adipose triglyceride lipase in adipocytes in vitro and in vivo Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1736 - E1745. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tordjman, S. Leroyer, G. Chauvet, J. Quette, C. Chauvet, C. Tomkiewicz, C. Chapron, R. Barouki, C. Forest, M. Aggerbeck, et al. Cytosolic Aspartate Aminotransferase, a New Partner in Adipocyte Glyceroneogenesis and an Atypical Target of Thiazolidinedione J. Biol. Chem., August 10, 2007; 282(32): 23591 - 23602. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, J. Huang, P. Saha, R. N. Kulkarni, M. Hu, Y. Kim, K. Park, L. Chan, A. S. Rajan, I. Lee, et al. Orphan Receptor Small Heterodimer Partner Is an Important Mediator of Glucose Homeostasis Mol. Endocrinol., November 1, 2006; 20(11): 2671 - 2681. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |