help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0623
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, T.
Right arrow Articles by Ning, Z.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, T.
Right arrow Articles by Ning, Z.-Q.
Endocrinology Vol. 147, No. 2 875-884
Copyright © 2006 by The Endocrine Society

Peroxisome Proliferator-Activated Receptor-{gamma} Transcriptionally Up-Regulates Hormone-Sensitive Lipase via the Involvement of Specificity Protein-1

Tuo Deng, Song Shan, Ping-Ping Li, Zhu-Fang Shen, Xian-Ping Lu, Jing Cheng and Zhi-Qiang Ning

Department of Biological Science and Biotechnology (T.D., J.C.), Tsinghua University, Beijing 100084, China; Chipscreen Biosciences Ltd. (T.D., S.S., X.-P.L., J.C., Z.-Q.N.), Shenzhen Research Institute of Tsinghua University, Shenzhen 518057, China; and Institute of Materia Medica (P.-P.L., Z.-F.S.), Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100050, China

Address all correspondence and requests for reprints to: Zhi-Qiang Ning, Chipscreen Biosciences Ltd., Shenzhen Research Institute of Tsinghua University, Nanshan District, Shenzhen 518057, China. E-mail: zqning{at}chipscreen.com.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Both peroxisome proliferator-activated receptor (PPAR)-{gamma} and hormone-sensitive lipase (HSL) play important roles in lipid metabolism and insulin sensitivity. We demonstrate that expression of the HSL gene is up-regulated by PPAR{gamma} and PPAR{gamma} agonists (rosiglitazone and pioglitazone) in the cultured hepatic cells and differentiating preadipocytes. Rosiglitazone treatment also results in up-regulation of the HSL gene in liver and skeleton muscle from an experimental obese rat model, accompanied by the decreased triglyceride content in these tissues. The proximal promoter (–87 bp of the human HSL gene) was found to be essential for PPAR{gamma}-mediated transactivating activity. This important promoter region contains two GC-boxes and binds the transcription factor specificity protein-1 (Sp1) but not PPAR{gamma}. The Sp1-promoter binding activity can be endogenously enhanced by PPAR{gamma} and rosiglitazone, as demonstrated by analysis of EMSA and chromatin immunoprecipitation assay. Mutations in the GC-box sequences reduce the promoter binding activity of Sp1 and the transactivating activity of PPAR{gamma}. In addition, mithramycin A, the specific inhibitor for Sp1-DNA binding activity, abolishes the PPAR{gamma}-mediated up-regulation of HSL. These results indicate that PPAR{gamma} positively regulates the HSL gene expression, and up-regulation of HSL by PPAR{gamma} requires the involvement of Sp1. Taken together, this study suggests that HSL may be a newly identified PPAR{gamma} target gene, and up-regulation of HSL may be an important mechanism involved in action of PPAR{gamma} agonists in type 2 diabetes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PEROXISOME PROLIFERATOR-activated receptor (PPAR)-{gamma} belongs to the nuclear receptor family that serves as a ligand-regulated transcription factor. PPAR{gamma} forms a heterodimer with the retinoid X receptor (RXR) and regulates gene expression by either binding to specific DNA sequences termed peroxisome proliferator response elements (PPREs) or interacting with other transcription factors in a DNA binding-independent manner (1). The role of PPAR{gamma} in regulation of glucose and lipid metabolism has been well established, as illustrated by the applications of the thiazolidinedione (TZD) type of PPAR{gamma} agonists (2). TZDs such as rosiglitazone and pioglitazone improve insulin sensitivity and relieve type 2 diabetes primarily by up-regulating genes involved in glucose and lipid metabolism in adipose tissue, liver, and skeleton muscle (3). PPAR{gamma} agonists are also shown to reduce triglyceride (TG) content in liver and/or skeleton muscle in both animal models (4, 5) and type 2 diabetes patients (6, 7, 8).

Hormone-sensitive lipase (HSL) is an intracellular neutral lipase with a broad specificity for lipid substrates such as TG, diglycerides, cholesteryl esters, and retinyl esters. HSL is the major enzyme responsible for the hydrolysis of stored TG in adipose tissue and has a pivotal role in the mobilization of fatty acids in many other tissues, including liver and muscle (9, 10). Whereas many studies have focused on the posttranslational mechanisms in HSL regulation and demonstrated the importance of the HSL protein phosphorylation in enzyme activity (11), relatively fewer investigations have been carried out in terms of the transcriptional regulation of the HSL gene.

The HSL gene is known to be involved in various metabolic disorders. For example, HSL knockout mice develop hyperglycemia and hyperinsulinemia, suggesting that lack of HSL leads to impaired insulin sensitivity (12, 13). The insulin resistance was observed in skeletal muscle and liver in those studies. Human studies also support a role for HSL in insulin sensitivity and show that maximum stimulated lipolysis is defective in patients with the insulin-resistance syndrome (14, 15), and decreased expression and function of HSL are present in fat cells from obese subjects (16). Furthermore, genetic studies suggest that the polygenic background of HSL may be involved in the pathogenesis of type 2 diabetes (17, 18).

Based on the importance of both PPAR{gamma} and HSL in metabolism and insulin sensitivity, we studied the regulatory effects of PPAR{gamma} and its agonists on the HSL gene expression. In this report, we show the evidence that expression of the HSL gene is up-regulated by PPAR{gamma} and PPAR{gamma} agonists, which requires the involvement of the transcription factor specificity protein-1 (Sp1).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents and plasmids
Rosiglitazone and pioglitazone were synthesized by Chipscreen Biosciences, with the purity greater than 98.5%. Mithramycin A was purchased from Biomol (Plymouth Meeting, PA). A DNA fragment from –901 to +27 bp of the human HSL gene promoter (19) was cloned by PCR from genomic DNA and inserted into the upstream of the luciferase-coding sequence in the pGL3-basic plasmid (Promega, Madison, WI), designated as p901. Subsequently, five other DNA fragments (–695, –466, –141, –87, and –30) from the promoter with a common downstream end at +27 bp were cloned and inserted into the pGL3-basic plasmid, designated as p695, p466, p141, p87, and p30, respectively. Point mutations of p87 at the nucleotides –76 to –78 (GGG->TTT), –34 to –38 (CCGCC->TTTTT), and both were generated using the QuikChange mutagenesis kit (Stratagene, La Jolla, CA) and designated as M5, M3, and M53, respectively. Same-point mutations (M53) were also generated in the p901 promoter fragment, and the fragment was designated as p901-M53. Human cDNAs for RXR{alpha} and PPAR{gamma} were cloned by RT-PCR from the liver mRNA and inserted into pcDNA3.1 (Invitrogen, Carlsbad, CA). The integrity and fidelity of all constructs thus made were verified by DNA sequencing. The human Sp1 expression plasmid was kindly provided by Dr. G. Suske (Institut fur Molekularbiologie und Tumorforschung, Marburg, Germany). pCMVßGal was purchased from CLONTECH (Palo Alto, CA).

Cell culture
The human hepatoma SMMC-7721 cell line (20, 21) and primary human fetal liver cells (CCC-L) were obtained from the Cell Culture Center of Chinese Academy of Medical Sciences (Beijing, China) and cultured in RPMI 1640 and DMEM medium, respectively, containing 10% fetal bovine serum (FBS), 50 µg/ml streptomycin, and 50 U/ml penicillin at 37 C in a humidified incubator with 5% CO2.

Rat preadipocytes were prepared as described by Haraguchi et al. (22). Briefly, fat tissues from the male Sprague Dawley rats (3–5 wk old) were excised, minced, and digested with collagenase for 1 h at 37 C. Cells were filtered through 25-µm nylon mesh. The filtrate was centrifuged at 600 x g for 5 min. The floating adipocytes were discarded and the pellet containing preadipocytes was collected. After two washes, cells were plated into cell culture dishes at a density of 2 x 104 cells/cm2 and cultured in DMEM containing 10% FBS. When cells reached confluence, the culture medium was switched to the differentiation medium (DMEM containing 10% FBS supplemented with 0.1 µM dexamethasone and 10 µg/ml insulin) and cultured for various days in the presence or absence of the indicated compounds for 48 h. The day for the differentiation medium addition was designated as d 0 in the Results section.

FBS in culture medium was treated with charcoal dextran to reduce the lipid interference in experiments when cells were incubated with compounds or transfected with PPAR{gamma} expression plasmid.

Animal experiments and TG content analysis
Newborn Wistar rats were sc injected with monosodium L-glutamate (MSG) at 4 g/kg·d for seven successive days. In contrast to the normal rats, the MSG rats developed obesity with increased plasma TG, cholesterol, and free fatty acid contents as well as impaired insulin sensitivity in their adulthood (23, 24, 25). The obese MSG rats were treated every day with rosiglitazone (5 mg/kg) by oral route for 40 d. After fasting for 6 h on the last treatment day the animals were killed, and total RNA from liver, muscle, and adipose tissues were isolated for the analysis of the HSL gene expression. To examine TG content of liver and skeleton muscle, the liver and skeleton muscle tissues were removed. TG content in those tissues was measured as described by Atkinson et al. (26). All animal protocols were approved by the Animal Care Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College.

Gene expression analysis
Total RNA was extracted from cells or tissues with an RNeasy minikit (QIAGEN, Chatsworth, CA). The first-strand cDNA was synthesized using the oligo(dT) primers, followed by using SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. Amplification of HSL cDNA was then performed with TaqMan PCR reagent kits in the ABI Prism 7700 sequence detection system according to the protocols provided by the manufacturer (PE Applied Biosystems, Foster City, CA). The levels of HSL mRNA were detected in each sample and normalized by the amounts of 18 S ribosomal RNA, whose primers and probe were obtained from PE Biosystems. The primers and probe used for the amplification of the HSL cDNA are shown in Table 1Go. Sense and antisense primer pairs used for semiquantitative RT-PCR of CD36 cDNA were 5'-GGACGCTGAGGACAACACAGT-3' and 5'-CTGCAATACCTGGCTTTTCTCAA-3', respectively. Sense and antisense primers for glyceraldehyde-3-phosphate dehydrogenase were 5'-ATGCCATCACTGCCACCC-3' and 5'-GCCTGCTTCACCACCTTCTT-3', respectively. PCR products were analyzed by electrophoresis on a 1.5% agarose gel in the presence of 0.5 µg/ml ethidium bromide.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Primer and probe sets used for the quantitative fluorescent real-time PCR

 
Transfection and luciferase assays
SMMC-7721 cells were seeded into 24-well plates the day before transfection to give a confluency of 50–80% when transfection was performed. Then 120 ng of a reporter plasmid and 40 ng of pCMVßGal were transfected per well using the FuGene6 transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN). To evaluate transactivating activity of individual transcription factors, 60 ng of PPAR{gamma}, RXR{alpha}, and/or Sp1 expression plasmids were cotransfected. After 24 h, culture media were changed, and the cells were incubated in the presence or absence of the indicated compounds dissolved in dimethylsulfoxide and fresh media. After an additional 24 h, cells were lysed and prepared for measurement of luciferase activity using a luciferase assay kit (Promega). Luciferase enzyme activity was detected by the Ascent Fluoroskan FL reader (Thermo Labsystems, Helsinki, Finland). To measure ß-galactosidase activity, 50 µl of supernatant from each transfection lysate were transferred to a new microplate, and the enzyme activity was detected by a reagent kit (Promega) and read in a microplate reader (Bio-tek Instruments Inc., Winooski, VT). The ß-galactosidase data were used to normalize the luciferase data. By cotransfection with a green fluorescence protein (GFP) plasmid (CLONTECH), the above procedures gave transfection efficiencies around 40–60% 48 h after transfection, as monitored by a fluorescence microscope (Leica, Heidelberg, Germany).

Western blot analysis
Total cellular lysates were prepared from rat preadipocytes after treatment with the indicated compounds or from SMMC-7721 cells after transfection with RXR{alpha}, PPAR{gamma}, or both for 48 h. For internal controls, SMMC-7721 cells were cotransfected with a GFP plasmid. Cells were lysed in lysis buffer [50 mM Tris-HCl (pH 7.8), 1% Nonidet P-40, 150 mM NaCl, 0.1% sodium dodecyl sulfate (SDS), 0.5% sodium deoxycholate, and 10% glycerol)] in the presence of protease inhibitors (protease inhibitor cocktail tablets, Roche Molecular Biochemicals). Protein concentrations in lysates were determined using a PlusOne 2-D Quant kit (Amersham Biosciences Corp., San Francisco, CA) according to the manufacturer’s instructions. Samples containing 30 µg of total protein were separated in 9% SDS-polyacrylamide gels and transferred to Hybond-P polyvinyl difluoride transfer membrane (Amersham Pharmacia Biotech, Little Chalfont, Buckinghamshire, UK). Transfer and equal loading were confirmed by Ponceau S staining before blocking to the membrane with 5% milk/Tris-buffered saline buffer containing 0.1% Tween 20) for 2 h at room temperature. Blocked membranes were incubated individually with anti-HSL antibody (a gift from Dr. W. J. Shen, Department of Medicine, Stanford University, Stanford, CA), anti-ß-actin antibody (Sigma, St. Louis, MO), anti-PPAR{gamma} antibody (Biomol), or anti-GFP antibody (CLONTECH) for 2 h. After incubation with antibodies, membranes were washed in Tris-buffered saline buffer containing 0.1% Tween 20, followed by incubation with horseradish peroxidase-conjugated antirabbit antibody (Santa Cruz Biotechnology, Santa Cruz, CA). Enhanced chemiluminescence (Amersham Pharmacia Biotech) was used for signal detection.

EMSAs
In vitro transcription/translation of human PPAR{gamma} and RXR{alpha} cDNA clones was performed using TNT kits (Promega). Purified Sp1 protein was purchased from Promega. Nuclear extracts from SMMC-7721 cells were prepared as described previously (27) with modifications. Briefly, cells (1 x 107) were resuspended in 400 µl of hypotonic buffer [10 mM HEPES (pH 7.9), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 0.625% Nonidet P-40, and 1 mM dithiothreitol] with protease inhibitors. After incubation on ice for 10 min, nuclei were collected by centrifugation at 1000 x g for 5 min. The nuclei were resuspended in 50 µl of high-salt buffer [20 mM HEPES (pH 7.9), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, and 0.5 mM dithiothreitol] with protease inhibitors and maintained on ice for 40 min, followed by centrifugation at 17,000 x g for 10 min. Extracts were separated from pellet debris and stored at –70 C until use for mobility shift assays. EMSA was performed using the digoxigenin (DIG) gel shift kit (Roche Molecular Biochemicals) according to the manufacturer’s instructions. Briefly, DIG-labeled double-stranded oligonucleotides containing the –87/–15 region of the HSL promoter (TTTCTGGGTGGGAGGTGGCTTGTGCGGCTACACCCTGGGCAGGCCAGCCCCGCCCCCGGGTTTATTGCCCCAG; GC boxes are underlined) or GC-box mutated –87/–15 region (TTTCTGGGTTTTAGGTGGCTTGTGCGGC TACACCCTGGGCAGGCCAGCCTTTTTCCCGGGTTTATTGCCCCAG; mutated GC boxes are underlined) or PPRE (AGGGACCAGGACAAAGGTCACGC) were incubated with 5 µl of the in vitro-translated PPAR{gamma} and RXR{alpha} reticulocyte lysate or 110 ng of purified Sp1 protein, or 4 µg of nuclear extracts from SMMC-7721 cells in binding buffer [10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM dichlorodiphenyl-trichloroethane, 0.05 µg/µl poly(dI-dC), 5% glycerol, and 0.1 µg/µl BSA] for 20 min at room temperature.

In the competition experiments, unlabeled probes were added at 100-fold molar excess. For assays in the presence of mithramycin A, the DNA probe was preincubated with the compound (100 nM final concentration) for 1 h at 4 C, and then Sp1 protein was added. For supershift assays, nuclear extracts were preincubated with rabbit polyclonal antibodies against Sp1 (sc-59X, Santa Cruz Biotechnology) for 40 min on ice, followed by the addition with the indicated probe. Protein-DNA complexes were separated by electrophoresis in 5% polyacrylamide gels and transferred onto Hybond-N+ positively nylon transfer membrane (Amersham Pharmacia Biotech). After blocking, membranes were incubated for 30 min at room temperature with alkaline phosphatase-conjugated anti-DIG antibody. Disodium 3-(4-methoxyspiro{1, 2-dioxetane-3,2'-{5'-chloro} tricydo[3.3.1.13,7] decan}-4-yl) phenylphosphate (CSPD) was used as the substrate for the detection.

Chromatin immunoprecipitation (ChIP) assays
SMMC-7721 cells (2 x 107 cells) were treated or untreated 1 µM rosiglitazone for 24 h or transfected with PPAR{gamma}/RXR{alpha} for 48 h and then fixed with 1% formaldehyde. The cross-linking reaction was stopped by addition of 0.125 M glycine. After rinsing with ice-cold PBS, cells were scraped and lysed with lysis buffer [1% SDS, 5 mM EDTA, 50 mM Tris-HCl (pH 8.0)]. Nuclei were collected and sonicated to desired chromatin length (600–1000 bp). The chromatin was precleared by addition of sheared salmon sperm DNA, rabbit IgG, and protein A-conjugated beads (Sigma) and incubated at 4 C for 2 h with gentle agitation. The beads were pelleted and the supernatant was immunoprecipitated with rabbit antibodies against Sp1 (Upstate Biotechnology, Lake Placid, NY) at 4 C overnight. The protein-antibody complexes were collected by addition of protein A-conjugated beads at 4 C for 1 h. The beads were extensively washed, and protein-DNA cross-links were reversed by heat at 65 C for 6 h. DNA fragments were purified with QIAGEN Qiaquick spin kit. PCR was performed with primers [5'-GGGAGCTGAGCCCTCTACTCT-3' (sense) and 5'-GCTGGGACTGCTGGTCTGT-3' (antisense)] and amplified a 159-bp region of the human HSL promoter. PCR products were resolved on a 2% agarose gel in the presence of 0.5 µg/ml ethidium bromide.

Statistical analysis
Unless otherwise stated, data are expressed as the mean ± SD from three independent experiments. The significance of differences was analyzed by using a Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PPAR{gamma} up-regulates HSL gene expression
During the process of study of PPAR{gamma} in gene regulatory effects, we found that PPAR{gamma} agonists up-regulated HSL gene expression. As shown in Fig. 1AGo, expression of the HSL gene significantly increased in human SMMC-7721 hepatoma cells (upper panel) and primary fetal liver cells (lower panel) when they were treated with either rosiglitazone or pioglitazone, the TZD type of PPAR{gamma} agonists. Rosiglitazone up-regulated the HSL gene expression in a dose-dependent manner in SMMC-7721 cells (Fig. 1BGo, upper panel), with a calculated EC50 value about 85 nM. mRNA levels of the HSL gene in SMMC-7721 cells treated with 1 µM rosiglitazone increased over an extended period of time, with the maximal induction after 24 h treatment (Fig. 1BGo, lower panel). Because HSL is most abundantly expressed in adipose tissue, we then isolated rat preadipocytes and observed the changes of the gene expression in these cells during their in vitro induction in the presence or absence of the PPAR{gamma} agonist treatment for 48 h. Whereas rosiglitazone significantly up-regulated expression of the HSL gene in the early stage (d 0–2) of preadipocyte differentiation, the gene expression levels in the late stage (d 8–10), when most cells differentiated to adipocytes (data not shown), became insignificant with or without rosiglitazone treatment (Fig. 1CGo, upper panel). The increased amounts of the HSL protein were observed in rat preadipocytes treated with either rosiglitazone or pioglitazone at d 0 for 48 h (Fig. 1CGo, lower panel).



View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. Induction of the HSL gene expression by PPAR{gamma} agonists in vitro. A, The human SMMC-7721 hepatoma cells and fetal hepatic cells (CCC-L) were treated with dimethylsulfoxide, 1 µM rosiglitazone (Rosi), or 1 µM pioglitazone (Piog) for 24 h. The levels of HSL mRNA were determined by quantitative real-time PCR and normalized by the relative amounts of 18S rRNA. The results are presented as mean ± SD from three independent experiments. *, P < 0.05 and **, P < 0.01 compared with control. B, SMMC-7721 cells were treated with the indicated concentrations of rosiglitazone for 24 h (upper panel) or treated with 1 µM rosiglitazone for the indicated periods of time (lower panel), and the levels of HSL mRNA were determined by quantitative real-time PCR. The results are presented as mean ± SD from three independent experiments. C, Rat preadipocytes cultured in differentiation medium at d 0 or 8 were treated or untreated with 1 µM rosiglitazone, and 48 h after the levels of HSL mRNA were determined by quantitative real-time PCR (upper panel). Rat preadipocytes cultured in differentiation media at d 0 were treated with either 1 µM rosiglitazone or 1 µM pioglitazone (Piog) for 48 h, and the HSL protein was determined by Western blot analysis (lower panel). The protein amounts of ß-actin were used for loading controls. The results are shown from a representative experiment.

 
To investigate any in vivo effect of rosiglitazone in up-regulation of the HSL gene, 4-month-old Wistar rats, which had been treated with MSG started at d 2 after birth and developed obesity and impaired insulin sensitivity in their adulthood (Ref.23 and our unpublished data), were treated with rosiglitazone (5 mg/kg·d for 40 d in oral route), and expression of the HSL gene in the liver, muscle, and adipose tissues was examined. As shown in Fig. 2AGo, the obese MSG rats had a decreased HSL expression in liver and muscle, which could be reversed or even further up-regulated by rosiglitazone. Consistent with the in vitro observations, rosiglitazone had no significant effect on HSL expression in the adipose tissue (Fig. 2AGo). TG contents in liver and muscle from the obese MSG rats treated or untreated with rosiglitazone were also determined. More than 2-fold higher TG content in these tissues was observed in the obese rats, compared with that in the normal animals, and rosiglitazone treatment resulted in a decrease in TG accumulation, particularly in liver of the obese rats (Fig. 2BGo).



View larger version (27K):
[in this window]
[in a new window]
 
FIG. 2. Rosiglitazone increases HSL gene expression and decreases TG content in liver and muscle from obese MSG rats. A, Total RNA was isolated from liver, skeleton muscle, or fat tissues of the normal lean rats (Normal), vehicle-treated obese MSG rats (Control), or obese MSG rats treated with rosiglitazone for 40 d (Rosi). The tissue RNA samples from three animals in each group were mixed in equal amount, and the changes of the HSL mRNA levels were determined by quantitative real-time PCR and normalized by the relative amounts of 18S rRNA. The results are presented as mean ± SD from three independent experiments. *, P < 0.05 compared with control. B, TG content of liver and skeleton muscle from the indicated group of animals. The results are presented as mean ± SD from nine to 10 animals in each group. *, P < 0.05 compared with control.

 
To determine whether PPAR{gamma} was directly involved in the HSL gene induction, SMMC-7721 cells were transfected with the PPAR{gamma} and/or RXR{alpha} expression plasmids, and the changes of HSL mRNA levels were examined. As shown in Fig. 3AGo, HSL expression in cells transfected with PPAR{gamma} alone increased to a level comparable with rosiglitazone-treated cells without PPAR{gamma} transfection. Rosiglitazone further enhanced the HSL expression in cells transfected with either PPAR{gamma} alone or PPAR{gamma} plus RXR{alpha} (Fig. 3AGo). The increase in the PPAR{gamma} protein was confirmed in cells transfected with the PPAR{gamma} expression plasmid (Fig. 3BGo). These results suggest that PPAR{gamma}, in the presence of endogenous or transfected RXR in SMMC-7721 cells, is capable of mediating HSL gene induction in the absence of the receptor agonist, and this transactivating activity can be augmented through the receptor activation by its agonist.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 3. Induction of the HSL gene by PPAR{gamma}. A, SMMC-7721 cells were transfected with the expression plasmids for PPAR{gamma}, RXR{alpha}, or both. 24 h after transfection, cells were either treated or untreated with 1 µM rosiglitazone for 24 h, and total RNA from the cells was isolated. The levels of HSL mRNA were determined by quantitative real-time PCR and normalized by the relative amounts of 18S rRNA. The results are presented as mean ± SD from three independent experiments. B, SMMC-7721 cells were transfected with a GFP expression vector or cotransfected with the expression plasmids for PPAR{gamma}, RXR{alpha}, or both. Then 48 h after transfection, cellular lysates were obtained and Western blotting was carried out by using antibodies to PPAR{gamma} (upper panel) or GFP (lower panel). The results are shown from a representative experiment.

 
The GC-box-containing sequence in the proximal HSL promoter is required for PPAR{gamma}-mediated transactivation
Two different promoters to drive different sizes of the human HSL mRNA expression have been identified and characterized in different tissues. One promoter upstream of exon T is specifically used in testis, and the other upstream of exon B is used in adipocytes as well as several other tissues including hepatic cells (11). No detectable mRNA transcripts driven by the testis-specific promoter were found in SMMC-7721 cells (data not shown), and we chose the HSL promoter upstream of exon B for detailed investigations in the current study. Sequence analysis showed the lack of consensus PPRE in the 5' flanking region of the human HSL gene up to –1700 bp relative to the transcription start point, suggesting that a PPRE-independent mechanism might be involved in PPAR{gamma}-mediated HSL gene expression. To identify the regulatory sequences important for HSL gene induction by PPAR{gamma}, we created a series of deletion constructs based on a 900-bp fragment from the human HSL promoter (19). The constructs were evaluated by a luciferase reporter system in SMMC-7721 cells transfected with a PPAR{gamma} expression plasmid. As shown in Fig. 4Go, sequence deletions up to –87 bp largely retained the PPAR{gamma}-dependent promoter activity. However, deletion of the region between –87 and –30 bp resulted in a complete loss of the promoter activity, indicating that this region of the HSL promoter was required for PPAR{gamma}-mediated transactivating activity. A similar trend of changes in luciferase activity was observed when SMMC-7721 cells were treated with rosiglitazone in the presence or absence of PPAR{gamma} transfection (data not shown).



View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Fragment identification of the HSL promoter for the transactivating activity of PPAR{gamma}. SMMC-7721 cells were transfected individually with p901, p695, p466, p141, p87, or p30 reporter plasmids, combined with or without transfection of a PPAR{gamma} expression plasmid. Luciferase activity was measured 48 h after transfection. The results were normalized with the ß-galactosidase activity. The results are presented as mean ± SD from three independent experiments.

 
Analysis of the –87/–30 region revealed the presence of two GC-boxes (Fig. 4Go), which are consensus binding sites for the transcription factor Sp1 (28, 29). No other known transcription regulatory sequences were found in this region. To evaluate the importance of the GC-box sequences in PPAR{gamma}-mediated HSL induction, we carried out site-directed mutagenesis to make a single or both GC-box(es) mutated, and the transcription activating activity of PPAR{gamma} was determined in SMMC-7721 cells that were cotransfected with a PPAR{gamma} expression vector and individual reporter plasmids having the proximal HSL promoter (from –87 to +25) with either wild-type (p87) or mutated GC-box(es). As shown in Fig. 5AGo, mutations in either 5' or 3' GC-box resulted in a partial decrease in PPAR{gamma}-induced promoter activity, and almost a complete loss of the promoter activity was observed when both GC-boxes were mutated. To investigate any other elements in the HSL promoter besides GC boxes that might be potentially involved in PPAR{gamma}-mediated transactivating activity, we used a longer fragment from the promoter (–901 to +25) and created a reporter construct with both GC-boxes mutated (p901-M53). As shown in Fig. 5BGo, compared with the wild type fragment, the GC-box mutant elicited much less luciferase activating response in SMMC-7721 cells when cotransfected with PPAR{gamma}, suggesting that GC-box sequences in the proximal HSL promoter are the major elements required for the transactivating activity of PPAR{gamma}.



View larger version (28K):
[in this window]
[in a new window]
 
FIG. 5. Requirement of the GC-box sequences from the proximal HSL promoter for the transactivating activity of PPAR{gamma}. A, SMMC-7721 cells were transfected with a luciferase (Luc) reporter plasmid containing either the wild-type p87 or individual p87 with mutated GC-box(es), combined with or without transfection of a PPAR{gamma} expression plasmid. B, SMMC-7721 cells were transfected with a luciferase reporter plasmid containing either the wild-type p901 or p901 with both GC-box mutated (p901-M53), combined with or without transfection of a PPAR{gamma} expression plasmid. Luciferase activity was measured 48 h after transfection. The results were normalized with the ß-galactosidase activity. The results are presented as mean ± SD from three independent experiments.

 
Sp1 is involved in PPAR{gamma}-mediated up-regulation of HSL expression
Sp1, the prototype of the Sp family of transcription factors (30), has been shown to functionally interact with PPAR{gamma} (31, 32, 33). We therefore tested for possible interactions between the indicated transcription factors and the –87 DNA fragment from the HSL gene promoter by EMSA. As shown in Fig. 6AGo, the in vitro-translated PPAR{gamma}/RXR{alpha} proteins bound to an annealed PPRE oligonucleotide probe (lane 2) but, as expected, not to the probe derived from the –87 to –15 nucleotide sequence of the HSL promoter (lane 5). In contrast, as demonstrated in Fig. 6BGo, purified Sp1 protein was capable of binding to the –87/–15 probe (lane 2), which could be abrogated by mithramycin A, the specific inhibitor for Sp1-DNA interactions (34) (lane 3). When both GC-boxes in the –87/–15 fragment were mutated, Sp1 lost its DNA binding activity (Fig. 6BGo, lane 4).



View larger version (43K):
[in this window]
[in a new window]
 
FIG. 6. Protein-DNA binding properties of Sp1 and PPAR{gamma}. A, DIG-labeled PPRE (lanes 1–4) or –87/–15 region of the HSL promoter (lane 5) was incubated with the in vitro-translated PPAR{gamma}/RXR{alpha} (except lane 1), and the EMSA analysis was carried out. In some reactions, nonlabeled PPRE probe (lane 3) or nonlabeled –87/–15 probe (lane 4) was added. Specific protein-DNA complexes formed by PPAR{gamma}/RXR{alpha} and PPRE are indicated by an arrow. The results are shown from a representative experiment. B, DIG-labeled wild-type (lanes 1–3) or GC-box-mutated probe (lane 4) from the –87/–15 region of the HSL promoter was incubated with purified Sp1 protein, and the EMSA analysis was carried out. Reaction of preincubation of the wild-type probe with 100 nM mithramycin A (Mith) is shown in lane 3. Specific protein-DNA complex formed by Sp1 and the –87/–15 fragment is indicated by an arrow. The results are shown from a representative experiment. C, DIG-labeled –87/–15 region of the HSL promoter was incubated with nuclear extracts isolated from untreated SMMC-7721 cells (lane 1), cells treated with 1 µM rosiglitazone (Rosi) for 24 h (lane 2), or cells transfected with PPAR{gamma}/RXR{alpha} for 48 h (lanes 3 and 4), and the EMSA analysis was carried out. Specific protein-DNA complexes formed by the endogenous Sp1 and the –87/–15 fragment are indicated by an arrow in the upper left. Reaction from preincubation of Sp1 antibody with nuclear extracts isolated from cells transfected with PPAR{gamma}/RXR{alpha} is shown in lane 4, and the supershifted Sp1-DNA complex is indicated by an arrow in the upper right. The results are shown from a representative experiment. D, ChIP analysis was performed using chromatin isolated from SMMC-7721 cells treated or untreated with 1 µM rosiglitazone (Rosi) for 24 h or transfected with PPAR{gamma}/RXR{alpha} for 48 h. The chromatin preparations were immunoprecipitated with antibodies against Sp1 and analyzed by PCR to detect the HSL promoter. Aliquots of chromatin were also analyzed before immunoprecipitation (Input) as described in Materials and Methods. The results are shown from a representative experiment.

 
To investigate the binding activities of endogenous Sp1 to this GC-box containing sequence as well as any effect of PPAR{gamma} or its agonist on the potential Sp1-DNA interactions, nuclear extracts were isolated from cells untreated and cells treated with rosiglitazone or transfected with PPAR{gamma}, and the binding differences of Sp1 to the –87/–15 probe were evaluated. As shown in Fig. 6CGo, two major probe-binding complexes were present from the untreated cell nuclear extract (lane 1). The upper protein-DNA complex increased when cells were treated with rosiglitazone (lane 2) or transfected with PPAR{gamma} (lane 3). This protein-DNA complex was composed of Sp1 because the complex could be significantly supershifted after coincubation of nuclear extracts from PPAR{gamma}-transfected cells with a specific antibody to Sp1 (lane 4). Enhancement of the binding activity of Sp1 to the HSL promoter sequence within nucleus by PPAR{gamma} was confirmed by ChIP analysis. As shown in Fig. 6DGo, Sp1 protein constitutively bound to the promoter in SMMC-7721 cells, which could be enhanced by either rosiglitazone treatment or PPAR{gamma} transfection. Taken together, the results from gel shift and ChIP assays indicate that the GC-box containing sequence in the proximal promoter of the HSL gene binds to Sp1, and this promoter-transcription factor binding activity can be endogenously enhanced by PPAR{gamma} and its agonist.

To show that Sp1 was involved in PPAR{gamma}-induced HSL expression, transactivating activity of Sp1 was determined in SMMC-7721 cells cotransfected with Sp1 expression vector and a luciferase reporter plasmid inserted with the p87 fragment. As shown in Fig. 7AGo, luciferase activity in cells transfected with the p87 reporter plasmid was induced by transfection with Sp1 alone to a comparable level with that of cells transfected with PPAR{gamma} alone. Additive transactivating activity in p87 was observed when cells were cotransfected with Sp1 and PPAR{gamma}. In all cases, addition of mithramycin A resulted in almost complete loss of luciferase activity in SMMC-7721 cells (Fig. 7AGo). Finally, changes of the HSL gene expression in SMMC-7721 cells treated with rosiglitazone or transfected with PPAR{gamma} in the presence or absence of mithramycin A were determined. As shown in Fig. 7BGo, HSL expression in SMMC-7721 cells induced either by rosiglitazone treatment or PPAR{gamma} transfection or both together were completely inhibited by mithramycin A. Meanwhile, induction of the CD36 gene, a known target gene regulated by PPAR{gamma} via PPRE, was not inhibited by mithramycin A treatment (Fig. 7CGo), suggesting that the suppression of Sp1-DNA interaction, rather than any additional effects on PPAR{gamma}, contribute to the inhibitory effect of mithramycin A on PPAR{gamma}-mediated HSL gene induction. Taken together, the results indicate that the transcription factor Sp1 is functionally involved in the up-regulation of the HSL gene expression mediated by PPAR{gamma} and its agonist.



View larger version (18K):
[in this window]
[in a new window]
 
FIG. 7. Involvement of Sp1 in PPAR{gamma}-mediated HSL induction. A, SMMC-7721 cells were cotransfected with the p87 reporter plasmid and the expression plasmids for Sp1 or PPAR{gamma}, or both. Twenty-four hours after transfection, cells were treated or untreated with 100 nM mithramycin A (Mith) for 24 h, and the luciferase activity was measured. The results are presented as mean ± SD from three independent experiments. B, SMMC-7721 cells were either transfected with an empty vector or a PPAR{gamma} expression plasmid. After 24 h, cells were either treated or untreated with 1 µM rosiglitazone (Rosi), combined with or without 100 nM mithramycin A (Mith) for an additional 24 h. Total RNA was isolated and the levels of HSL mRNA were determined by quantitative real-time PCR and normalized by the relative amounts of 18S rRNA. The results are presented as mean ± SD from three independent experiments. C, SMMC-7721 cells were either treated or untreated with 1 µM rosiglitazone (Rosi), combined with or without 100 nM mithramycin A (Mith) for 24 h. Total RNA was isolated and the levels of CD36 mRNA were determined by semiquantitative RT-PCR. The mRNA levels of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) were used for controls. The results are shown from a representative experiment.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Accumulation of TG in liver and muscle has been linked with insulin resistance in both animal models and humans (35, 36, 37, 38, 39, 40). In addition, PPAR{gamma} activation by rosiglitazone results in a decrease in liver TG content in type 2 diabetes patients (6). Specific inactivation of liver PPAR{gamma} in lipoatrophic mice impairs TG clearance and abolishes hypolipidemic effect of rosiglitazone (41). Those results of studies indicate a relationship between PPAR{gamma} activation and the TG content control in liver and muscle, which may be important for the antidiabetic actions of TZDs. However, the molecular mechanisms underlined are largely unknown. Our results show that HSL, the gene encoding a key enzyme for hydrolysis of TG, is up-regulated by PPAR{gamma} or TZD compounds in cultured hepatic cells. We also show that the rosiglitazone treatment increases the HSL gene expression in the liver and muscle tissues of MSG obese rats that have impaired insulin sensitivity, accompanied by the decreased TG content in these tissues. Our results suggest that PPAR{gamma}-mediated up-regulation of the HSL gene may be an important mechanism through which TZDs regulate TG content in liver and muscle and hence improve insulin sensitivity. Interestingly, we have not observed a significant difference in the HSL gene expression in adipose tissue, the place that HSL is most abundantly present, between the rosiglitazone-treated and -untreated obese rats (Fig. 2AGo), consistent with the in vitro results that rosiglitazone lost its regulatory effect on HSL expression in differentiated adipocytes (Fig. 1CGo). Because both PPAR{gamma} and HSL are highly expressed in adipose tissue, it might be possible that this saturated situation prevents PPAR{gamma} agonists from further regulating the HSL gene expression in the tissue. Nevertheless, our results linked the HSL regulation with PPAR{gamma} that may be relevant to the actions of PPAR{gamma} agonists in improvement of insulin sensitivity.

Our results show that the –87/–30-bp fragment from the proximal HSL promoter contains the essential elements for PPAR{gamma}-mediated transactivation. However, a consensus PPRE does not exist in the fragment, nor does the fragment bind to PPAR{gamma}, suggesting that a PPRE-independent mode of action, most likely involving other transcription factors, may be responsible for the PPAR{gamma}-mediated HSL induction. Indeed, analysis of the fragment reveals of the existence of the GC-box sequence that binds to Sp1 and mutations in GC-boxes result in the abrogation of PPAR{gamma}-transactivating activity. Furthermore, endogenous binding activity of Sp1 with the fragment from the proximal HSL promoter is augmented by PPAR{gamma}, and when Sp1-DNA binding activity is blocked by a selective inhibitor, PPAR{gamma}-mediated transactivation and its induction of the HSL expression are subsequently abolished. Taken together, our results strongly imply that PPAR{gamma}-mediated up-regulation of the HSL gene is independent of PPRE and requires the involvement of the transcription factor Sp1.

PPAR{gamma} (31, 32, 33) as well as PPAR{alpha} (42, 43) has been documented to functionally interact with Sp1 to modulate gene expression. Whereas PPARs are shown to physically bind to Sp1 in some studies (31, 32, 33, 43), nondirect interactions between those two classes of transcription factors have also been reported (42). We were unable to demonstrate a physical interaction between PPAR{gamma} and Sp1 by coimmunoprecipitation assays or cooperative binding of the PPAR{gamma}/RXR heterodimer and Sp1 to the proximal HSL promoter (data not shown). Therefore, PPAR{gamma}-mediated HSL induction may take place by an indirect interaction between PPAR{gamma} and Sp1, possibly involving other cofactors that need further identification.

Two promoters of different isoforms of the human HSL gene have been identified and characterized. Whereas the promoter upstream of exon T drives expression of HSL specifically in testis (44, 45), the promoter upstream of exon B (19), which was used in our study, is used in adipocytes and other tissues (11). An interesting observation in the promoter upstream of exon B is the absence of a consensus TATA-box sequence (19). One of the common features of TATA-less promoters is that GC-boxes are present upstream of the transcription start site, and the binding of Sp1 to the GC-box sequence is required for the assembly of the transcription complex (46). Sp1 has been shown to be responsible for the basal expression of acyl-coenzyme-A oxidase controlled by a TATA-less promoter, and the maximal expression of the acyl-coenzyme-A oxidase gene is achieved by the presence of other cofactors (47). Similar mechanisms might be proved to be true in terms of regulation of the HSL gene by Sp1, i.e. the presence of Sp1 is the precondition for the basal HSL gene expression, which can be influenced on the availability of specific transcriptional components, including PPAR{gamma} as demonstrated in the current study.

In conclusion, our results have shown that HSL is the PPAR{gamma} target gene, and the regulation of HSL expression by PPAR{gamma} requires the involvement of the transcription factor Sp1. These results may further define the regulatory role of PPAR{gamma} in lipid metabolism and provide more explanation of the molecular mechanisms of action of PPAR{gamma} agonists in type 2 diabetes.


    Acknowledgments
 
The authors thank Dr. Paul Jubinsky (Albert Einstein College of Medicine, New York, NY) for his critical review of the manuscript.


    Footnotes
 
This work was supported by grants from the Chinese National "863" Project (2002AA2Z3146) and the Significant Biotech Project from Guangdong Province of China (2002A1090214).

The authors have no conflicts of interest.

First Published Online November 3, 2005

Abbreviations: ChIP, Chromatin immunoprecipitation; DIG, digoxigenin; FBS, fetal bovine serum; GFP, green fluorescence protein; HSL, hormone-sensitive lipase; MSG, monosodium L-glutamate; PPAR, peroxisome proliferator-activated receptor; PPRE, peroxisome proliferator response element; RXR, retinoid X receptor; SDS, sodium dodecyl sulfate; Sp1, specificity protein-1; TG, triglyceride; TZD, thiazolidinedione.

Received May 23, 2005.

Accepted for publication October 24, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Desvergne B, Wahli W 1999 Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev 20:649–688[Abstract/Free Full Text]
  2. Lehmann JM, Moore LB, Smith-Oliver TA, Wilkison WO, Willson TM, Kliewer SA 1995 An antidiabetic thiazolidinedione is a high affinity ligand for peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}). J Biol Chem 270:12953–12956[Abstract/Free Full Text]
  3. Yki-Jarvinen H 2004 Thiazolidinediones. N Engl J Med 351:1106–1118[Free Full Text]
  4. Ye JM, Doyle PJ, Iglesias MA, Watson DG, Cooney GJ, Kraegen EW 2001 Peroxisome proliferator-activated receptor (PPAR)-{alpha} activation lowers muscle lipids and improves insulin sensitivity in high fat-fed rats: comparison with PPAR-{gamma} activation. Diabetes 50:411–417[Abstract/Free Full Text]
  5. Murakami K, Tobe K, Ide T, Mochizuki T, Ohashi M, Akanuma Y, Yazaki Y, Kadowaki T 1998 A novel insulin sensitizer acts as a coligand for peroxisome proliferator-activated receptor-{alpha} (PPAR-{alpha}) and PPAR-{gamma}: effect of PPAR-{alpha} activation on abnormal lipid metabolism in liver of Zucker fatty rats. Diabetes 47:1841–1847[Abstract]
  6. Mayerson AB, Hundal RS, Dufour S, Lebon V, Befroy D, Cline GW, Enocksson S, Inzucchi SE, Shulman GI, Petersen KF 2002 The effects of rosiglitazone on insulin sensitivity, lipolysis, and hepatic and skeletal muscle triglyceride content in patients with type 2 diabetes. Diabetes 51:797–802[Abstract/Free Full Text]
  7. Bajaj M, Suraamornkul S, Pratipanawatr T, Hardies LJ, Pratipanawatr W, Glass L, Cersosimo E, Miyazaki Y, DeFronzo RA 2003 Pioglitazone reduces hepatic fat content and augments splanchnic glucose uptake in patients with type 2 diabetes. Diabetes 52:1364–1370[Abstract/Free Full Text]
  8. Bajaj M, Suraamornkul S, Piper P, Hardies LJ, Glass L, Cersosimo E, Pratipanawatr T, Miyazaki Y, DeFronzo RA 2004 Decreased plasma adiponectin concentrations are closely related to hepatic fat content and hepatic insulin resistance in pioglitazone-treated type 2 diabetic patients. J Clin Endocrinol Metab 89:200–206[Abstract/Free Full Text]
  9. Kraemer FB, Shen WJ 2002 Hormone-sensitive lipase: control of intracellular tri-(di-)acylglycerol and cholesteryl ester hydrolysis. J Lipid Res 43:1585–1594[Abstract/Free Full Text]
  10. Haemmerle G, Zimmermann R, Zechner R 2003 Letting lipids go: hormone-sensitive lipase. Curr Opin Lipidol 14:289–297[CrossRef][Medline]
  11. Holm C 2003 Molecular mechanisms regulating hormone-sensitive lipase and lipolysis. Biochem Soc Trans 31:1120–1124[Medline]
  12. Roduit R, Masiello P, Wang SP, Li H, Mitchell GA, Prentki M 2001 A role for hormone-sensitive lipase in glucose-stimulated insulin secretion: a study in hormone-sensitive lipase-deficient mice. Diabetes 50:1970–1975[Abstract/Free Full Text]
  13. Mulder H, Sorhede-Winzell M, Contreras JA, Fex M, Strom K, Ploug T, Galbo H, Arner P, Lundberg C, Sundler F, Ahren B, Holm C 2003 Hormone-sensitive lipase null mice exhibit signs of impaired insulin sensitivity whereas insulin secretion is intact. J Biol Chem 278:36380–36388[Abstract/Free Full Text]
  14. Reynisdottir S, Ellerfeldt K, Wahrenberg H, Lithell H, Arner P 1994 Multiple lipolysis defects in the insulin resistance (metabolic) syndrome. J Clin Invest 93:2590–2599[Medline]
  15. Reynisdottir S, Angelin B, Langin D, Lithell H, Eriksson M, Holm C, Arner P 1997 Adipose tissue lipoprotein lipase and hormone-sensitive lipase : contrasting findings in familial combined hyperlipidemia and insulin resistance syndrome. Arterioscler Thromb Vasc Biol 17:2287–2292[Abstract/Free Full Text]
  16. Large V, Reynisdottir S, Langin D, Fredby K, Klannemark M, Holm C, Arner P 1999 Decreased expression and function of adipocyte hormone-sensitive lipase in subcutaneous fat cells of obese subjects. J Lipid Res 40:2059–2066[Abstract/Free Full Text]
  17. Magre J, Laurell H, Fizames C, Antoine PJ, Dib C, Vigouroux C, Bourut C, Capeau J, Weissenbach J, Langin D 1998 Human hormone-sensitive lipase: genetic mapping, identification of a new dinucleotide repeat, and association with obesity and NIDDM. Diabetes 47:284–286[Medline]
  18. Klannemark M, Orho M, Langin D, Laurell H, Holm C, Reynisdottir S, Arner P, Groop L 1998 The putative role of the hormone-sensitive lipase gene in the pathogenesis of type II diabetes mellitus and abdominal obesity. Diabetologia 41:1516–1522[CrossRef][Medline]
  19. Grober J, Laurell H, Blaise R, Fabry B, Schaak S, Holm C, Langin D 1997 Characterization of the promoter of human adipocyte hormone-sensitive lipase. Biochem J 328(Pt 2):453–461
  20. Xu ZG, Du JJ, Zhang X, Cheng ZH, Ma ZZ, Xiao HS, Yu L, Wang ZQ, Li YY, Huo KK, Han ZG 2003 A novel liver-specific zona pellucida domain containing protein that is expressed rarely in hepatocellular carcinoma. Hepatology 38:735–744[Medline]
  21. Yang L, Li N, Wang C, Yu Y, Yuan L, Zhang M, Cao X 2004 Cyclin L2, a novel RNA polymerase II-associated cyclin, is involved in pre-mRNA splicing and induces apoptosis of human hepatocellular carcinoma cells. J Biol Chem 279:11639–11648[Abstract/Free Full Text]
  22. Haraguchi K, Shimura H, Lin L, Endo T, Onaya T 1996 Differentiation of rat preadipocytes is accompanied by expression of thyrotropin receptors. Endocrinology 137:3200–3205[Abstract]
  23. Hirata AE, Andrade IS, Vaskevicius P, Dolnikoff MS 1997 Monosodium glutamate (MSG)-obese rats develop glucose intolerance and insulin resistance to peripheral glucose uptake. Braz J Med Biol Res 30:671–674[Medline]
  24. Marmo MR, Dolnikoff MS, Kettelhut IC, Matsushita DM, Hell NS, Lima FB 1994 Neonatal monosodium glutamate treatment increases epididymal adipose tissue sensitivity to insulin in three-month old rats. Braz J Med Biol Res 27:1249–1253[Medline]
  25. de Mello MA, de Souza CT, Braga LR, dos Santos JW, Ribeiro IA, Gobatto CA 2001 Glucose tolerance and insulin action in monosodium glutamate (MSG) obese exercise-trained rats. Physiol Chem Phys Med NMR 33:63–71[Medline]
  26. Atkinson LL, Kelly SE, Russell JC, Bar-Tana J, Lopaschuk GD 2002 MEDICA 16 inhibits hepatic acetyl-CoA carboxylase and reduces plasma triacylglycerol levels in insulin-resistant JCR: LA-cp rats. Diabetes 51:1548–1555[Abstract/Free Full Text]
  27. Dignam J, Lebovitz R, Roeder R 1983 Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475–1489[Abstract/Free Full Text]
  28. Dynan WS, Tjian R 1983 The promoter-specific transcription factor Sp1 binds to upstream sequences in the SV40 early promoter. Cell 35:79–87[CrossRef][Medline]
  29. Hagen G, Muller S, Beato M, Suske G 1992 Cloning by recognition site screening of two novel GT box binding proteins: a family of Sp1 related genes. Nucleic Acids Res 20:5519–5525[Abstract/Free Full Text]
  30. Suske G 1999 The Sp-family of transcription factors. Gene 238:291–300[CrossRef][Medline]
  31. Sugawara A, Takeuchi K, Uruno A, Ikeda Y, Arima S, Kudo M, Sato K, Taniyama Y, Ito S 2001 Transcriptional suppression of type 1 angiotensin II receptor gene expression by peroxisome proliferator-activated receptor-{gamma} in vascular smooth muscle cells. Endocrinology 142:3125–3134[Abstract/Free Full Text]
  32. Sugawara A, Uruno A, Kudo M, Ikeda Y, Sato K, Taniyama Y, Ito S, Takeuchi K 2002 Transcription suppression of thromboxane receptor gene by peroxisome proliferator-activated receptor-{gamma} via an interaction with Sp1 in vascular smooth muscle cells. J Biol Chem 277:9676–9683[Abstract/Free Full Text]
  33. Sassa Y, Hata Y, Aiello LP, Taniguchi Y, Kohno K, Ishibashi T 2004 Bifunctional properties of peroxisome proliferator-activated receptor {gamma}1 in KDR gene regulation mediated via interaction with both Sp1 and Sp3. Diabetes 53:1222–1229[Abstract/Free Full Text]
  34. Blume S, Snyder R, Ray R, Thomas S, Koller C, Miller D 1991 Mithramycin inhibits SP1 binding and selectively inhibits transcriptional activity of the dihydrofolate reductase gene in vitro and in vivo. J Clin Invest 88:1613–1621[Medline]
  35. Ravikumar B, Carey PE, Snaar JE, Deelchand DK, Cook DB, Neely RD, English PT, Firbank MJ, Morris PG, Taylor R 2005 Real-time assessment of postprandial fat storage in liver and skeletal muscle in health and type 2 diabetes. Am J Physiol Endocrinol Metab 288:E789–E797
  36. Kim JK, Gavrilova O, Chen Y, Reitman ML, Shulman GI 2000 Mechanism of insulin resistance in A-ZIP/F-1 fatless mice. J Biol Chem 275:8456–8460[Abstract/Free Full Text]
  37. Ryysy L, Hakkinen AM, Goto T, Vehkavaara S, Westerbacka J, Halavaara J, Yki-Jarvinen H 2000 Hepatic fat content and insulin action on free fatty acids and glucose metabolism rather than insulin absorption are associated with insulin requirements during insulin therapy in type 2 diabetic patients. Diabetes 49:749–758[Abstract]
  38. Laybutt DR, Schmitz-Peiffer C, Saha AK, Ruderman NB, Biden TJ, Kraegen EW 1999 Muscle lipid accumulation and protein kinase C activation in the insulin-resistant chronically glucose-infused rat. Am J Physiol 277:E1070–E1076
  39. Perseghin G, Scifo P, De Cobelli F, Pagliato E, Battezzati A, Arcelloni C, Vanzulli A, Testolin G, Pozza G, Del Maschio A, Luzi L 1999 Intramyocellular triglyceride content is a determinant of in vivo insulin resistance in humans: a 1H–13C nuclear magnetic resonance spectroscopy assessment in offspring of type 2 diabetic parents. Diabetes 48:1600–1606[Abstract]
  40. Pan D, Lillioja S, Kriketos A, Milner M, Baur L, Bogardus C, Jenkins A, Storlien L 1997 Skeletal muscle triglyceride levels are inversely related to insulin action. Diabetes 46:983–988[Abstract]
  41. Gavrilova O, Haluzik M, Matsusue K, Cutson JJ, Johnson L, Dietz KR, Nicol CJ, Vinson C, Gonzalez FJ, Reitman ML 2003 Liver peroxisome proliferator-activated receptor {{gamma}} contributes to hepatic steatosis, triglyceride clearance, and regulation of body fat mass. J Biol Chem 278:34268–34276[Abstract/Free Full Text]
  42. Delerive P, De Bosscher K, Vanden Berghe W, Fruchart JC, Haegeman G, Staels B 2002 DNA binding-independent induction of I{kappa}B{alpha} gene transcription by PPAR{alpha}. Mol Endocrinol 16:1029–1039[Abstract/Free Full Text]
  43. Meissner M, Stein M, Urbich C, Reisinger K, Suske G, Staels B, Kaufmann R, Gille J 2004 PPAR{alpha} activators inhibit vascular endothelial growth factor receptor-2 expression by repressing Sp1-dependent DNA binding and transactivation. Circ Res 94:324–332[Abstract/Free Full Text]
  44. Blaise R, Grober J, Rouet P, Tavernier G, Daegelen D, Langin D 1999 Testis expression of hormone-sensitive lipase is conferred by a specific promoter that contains four regions binding testicular nuclear proteins. J Biol Chem 274:9327–9334[Abstract/Free Full Text]
  45. Blaise R, Guillaudeux T, Tavernier G, Daegelen D, Evrard B, Mairal A, Holm C, Jegou B, Langin D 2001 Testis hormone-sensitive lipase expression in spermatids is governed by a short promoter in transgenic mice. J Biol Chem 276:5109–5115[Abstract/Free Full Text]
  46. Pugh BF, Tjian R 1990 Mechanism of transcriptional activation by Sp1: evidence for coactivators. Cell 61:1187–1197[CrossRef][Medline]
  47. Krey G, Mahfoudi A, Wahli W 1995 Functional interactions of peroxisome proliferator-activated receptor, retinoid-X receptor, and Sp1 in the transcriptional regulation of the acyl-coenzyme-A oxidase promoter. Mol Endocrinol 9:219–231[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Cell Sci.Home page
S. Tejerina, A. De Pauw, S. Vankoningsloo, A. Houbion, P. Renard, F. De Longueville, M. Raes, and T. Arnould
Mild mitochondrial uncoupling induces 3T3-L1 adipocyte de-differentiation by a PPAR{gamma}-independent mechanism, whereas TNF{alpha}-induced de-differentiation is PPAR{gamma} dependent
J. Cell Sci., January 1, 2009; 122(1): 145 - 155.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. D. Wiggin, M. Kretzler, S. Pennathur, K. A. Sullivan, F. C. Brosius, and E. L. Feldman
Rosiglitazone Treatment Reduces Diabetic Neuropathy in Streptozotocin-Treated DBA/2J Mice
Endocrinology, October 1, 2008; 149(10): 4928 - 4937.
[Abstract] [Full Text] [PDF]


Home page
Endocr Relat CancerHome page
D Bonofiglio, H Qi, S Gabriele, S Catalano, S Aquila, M Belmonte, and S Ando
Peroxisome proliferator-activated receptor {gamma} inhibits follicular and anaplastic thyroid carcinoma cells growth by upregulating p21Cip1/WAF1 gene in a Sp1-dependent manner
Endocr. Relat. Cancer, June 1, 2008; 15(2): 545 - 557.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. E. Kershaw, M. Schupp, H.-P. Guan, N. P. Gardner, M. A. Lazar, and J. S. Flier
PPAR{gamma} regulates adipose triglyceride lipase in adipocytes in vitro and in vivo
Am J Physiol Endocrinol Metab, December 1, 2007; 293(6): E1736 - E1745.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Tordjman, S. Leroyer, G. Chauvet, J. Quette, C. Chauvet, C. Tomkiewicz, C. Chapron, R. Barouki, C. Forest, M. Aggerbeck, et al.
Cytosolic Aspartate Aminotransferase, a New Partner in Adipocyte Glyceroneogenesis and an Atypical Target of Thiazolidinedione
J. Biol. Chem., August 10, 2007; 282(32): 23591 - 23602.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. Wang, J. Huang, P. Saha, R. N. Kulkarni, M. Hu, Y. Kim, K. Park, L. Chan, A. S. Rajan, I. Lee, et al.
Orphan Receptor Small Heterodimer Partner Is an Important Mediator of Glucose Homeostasis
Mol. Endocrinol., November 1, 2006; 20(11): 2671 - 2681.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Deng, T.
Right arrow Articles by Ning, Z.-Q.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Deng, T.
Right arrow Articles by Ning, Z.-Q.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals