| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
School of Biomedical Sciences (S.T.A., J.L.B., K.J.F., D.H.L.K., M.J.W., J.D.C.) and Institute for Molecular Biosciences (M.J.W.), The University of Queensland, Queensland 4072, Australia
Address all correspondence and requests for reprints to: Dr. S. T. Anderson, School of Biomedical Sciences, The University of Queensland, Queensland 4072, Australia. E-mail: stephen.anderson{at}uq.edu.au.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
One of the major intracellular signaling pathways for PRL receptors involves activation of Janus tyrosine kinase 2 (Jak2) and subsequent phosphorylation of signal transducers and activators of transcription (STAT) proteins (for review see Refs.1 and 7). These phosphoSTAT proteins undergo movement to the nucleus (nuclear translocation) and bind to STAT response elements on promoter regions of genes to regulate transcription. Recent evidence supports this signaling pathway as part of PRL negative feedback in TIDA neurons. PRL is known to cause nuclear translocation of STAT5 in TIDA neurons in ovariectomized rats (8), and the presence of the STAT5b isoform appears to be critical for normal PRL negative feedback because STAT5b-deficient mice have abnormally high serum PRL concentrations (9).
In lactating females, chronically elevated plasma PRL concentrations are observed, a phenomena well known to be associated with the sucking stimulus. In the presence of the sucking pups, the TIDA neurons display relatively low activity (10, 11), and by mid-lactation the TIDA neurons are unresponsive to exogenous PRL (11, 12). In contrast, removal of pups and therefore the sucking stimulus results in increased TIDA neuronal activity, suppression of plasma PRL concentrations, and increased responsiveness of the TIDA neurons to exogenous PRL (12). The cellular mechanisms involved in these apparent changes in sensitivity to PRL negative feedback in mid-lactation remain unknown. No evidence exists to support the notion of down-regulation of PRL receptors in the arcuate nucleus during lactation; rather, they appear to be up-regulated (13). Nevertheless, resistance to PRL within the TIDA neurons could still occur through inhibition of intracellular signaling pathways. So, in the first part of our study, we examined PRL signaling through STAT5 in TIDA neurons of lactating rats. Results from these experiments indicated that PRL-induced STAT5 nuclear translocation in TIDA neurons is indeed reduced by the sucking stimulus. One possible explanation for this inhibition could be increased expression of a negative regulator of PRL signaling within the TIDA neurons. In this regard, certain members of the suppressors of cytokine signaling (SOCS) family of proteins, SOCS1, SOCS2, SOCS3, and cytokine-inducible SH2-domain-containing protein (CIS), are known to negatively regulate PRL receptor signaling through Jak2/STAT5 (14). Therefore, we next examined the hypothesis that loss of sensitivity to PRL negative feedback during lactation is caused by increased expression of a SOCS protein in TIDA neurons, which inhibits PRL signal transduction through STAT5.
| Materials and Methods |
|---|
|
|
|---|
Animals
Female Wistar rats obtained from the Central Animal Breeding House, University of Queensland were used. Rats were given free access to water and food and exposed to a 12-h light, 12-h dark photoperiod. Experiments were performed on cyclic (diestrus) and lactating rats (d 911 postpartum). Vaginal smears were taken each morning from cyclic rats to determine the stage of the estrous cycle, and animals were killed on the morning of diestrus after two normal estrous cycles. Late pregnant rats were inspected daily for births, and within 48 h of birth the number of pups was standardized to 12 pups/dam. Before death on d 911 postpartum, some of the lactating rats had their pups removed for 16 h, whereas the remainder continued to suckle.
In experiments where PRL was used, 1 h before death rats received a sc injection of 250 µg oPRL dissolved in 250 µl of oPRL buffer [30 mM NaHCO3 in 150 mM NaCl (pH 10.8)] and 250 µl saline, or vehicle alone (250 µl oPRL buffer and 250 µl saline). In one experiment, bromocriptine mesylate (3 mg/kg in 1% tartaric acid/30% ethanol) was given by sc injection 2 h before oPRL or vehicle injection to acutely suppress endogenous PRL levels. This bromocriptine treatment is known to suppress the suckling induced increase in PRL in lactating rats (15), and acutely (within 2 h) reduce circulating serum PRL concentrations in ovariectomized rats (16).
All experiments were conducted in accord with NHMRC (Australia) guidelines and were approved by the Animal Experimentation and Ethics Committee of The University of Queensland.
Immunohistochemistry
Rats were killed by injection of pentobarbitone. The head was perfused with 100 ml of 1.0% sodium nitrite solution in 0.1 M sodium phosphate buffer (PB, pH 7.4), followed by 400 ml fixative (4% formaldehyde in 0.1 M PB, pH 7.4). The brain was removed and postfixed for 2 h, before being equilibrated in 30% sucrose in 0.1 M PB. After equilibration, the brain was embedded and frozen in OCT. Coronal sections (25 µm) of the hypothalamus were obtained using a cryostat. Sections were collected into tissue culture plates containing 0.1 M PB with 0.01% sodium azide and stored at 4 C until required.
Coronal sections located between bregma 2.30 and 3.30 (17) were examined. Free floating sections were washed in 0.1 M PBS (PBS; 3 x 5 min), then serum blocked for 20 min (10% horse serum in PBS containing 0.4% Triton X-100), before being incubated with primary antibodies; mouse antityrosine hydroxylase (1:1000), together with either rabbit anti-STAT5 (1:1000) or rabbit anti-CIS (1:20) or goat anti-SOCS3 (1:50) for 24 h at 4 C. All antibodies were diluted in buffer (2% horse serum, 0.4% Triton X-100 in 0.1 M PBS). After further washing in PBS (3 x 5 min), sections were incubated with secondary antibodies. For CIS and TH staining, donkey antirabbit Texas Red and donkey antimouse FITC were used together both at 1:400 dilution in antibody buffer for 18 h at 4 C. For SOCS3 and TH staining, biotinylated donkey antigoat IgG and donkey antimouse FITC were used (both at 1:200 dilution), followed by streptavidin Texas Red conjugate (1:200 dilution), with both incubations for 3 h at room temperature. Sections were again washed in PBS, before being mounted on glass microscope slides, and coverslipped under 50% glycerol in PBS. Control sections with omission of primary or secondary antibodies were performed to confirm specificity of the antisera. CIS and SOCS3 immunoreactivity was verified using other primary antibodies; rabbit anti-CIS (gift from A. Yoshimura, Fukuoka, Japan) and rabbit anti-SOCS3 (gift from D. J. Hilton, Melbourne, Australia).
Confocal immunofluorescence images were obtained as previously described (18). Diestrous rats, continuously suckled lactating rats, and lactating rats with pups removed 16 h before death were examined (n = 4 per group). During each confocal session, images were obtained from one animal in each treatment group in a blind unbiased manner. For quantitation, confocal settings were kept constant (aperture size, laser power, detector gain, zero black level adjustment) and captured images were analyzed using NIH image software (National Institutes of Health, Bethesda, MD).
The intracellular localization of STAT5 in TH-positive neurons in the dorsomedial arcuate nucleus (dmArc) was determined using the ratio of mean STAT5 fluorescence (Texas Red) intensity in the nucleus expressed as a proportion of that over the cytoplasmic profile of a TH (FITC) immunoreactive neuron [nuclear/cytoplasmic (N/C) ratio]. Where visible, the nucleolus was excluded from quantitation. For each animal, the STAT5 N/C ratio was determined from at least 30 neurons in the dmArc. Furthermore, the distribution of STAT5 immunostaining in dopaminergic neurons located in the zona incerta (present on the same coronal section as the dmArc) was also determined as a negative control because these neurons do not express the PRL receptor (19).
The intensity of CIS immunofluorescence in TH-positive neurons in the dmArc was also quantified. Again, the TH (FITC) staining was used to delineate the cytoplasm and nuclear profile of individual TIDA neurons. For each animal, the mean intensity of CIS immunostaining (Texas Red) was quantified in the cytoplasm and nucleus from at least 15 TH-positive neurons in the dmArc. An estimate of background (Texas Red) staining was determined for each image, using an area close to the neuron that appeared to have no specific staining. This background measure was subtracted from the signal intensity of each compartment.
Northern analysis
Hypothalamic tissue was obtained from diestrous rats, continuously suckled lactating rats, and lactating rats 16 h after pup removal. Rats were killed by pentobarbitone. The brain was quickly removed and the hypothalamus dissected with a scalpel blade, frozen on solid CO2 and stored at 80 C. Total RNA was extracted from hypothalamic tissue using Trizol reagent. Northern blot analysis for SOCS1, SOCS2, SOCS3, and CIS was performed as previously described (20, 21). Membranes were stripped and rehybridized with a probe to 18S rRNA for standardization. Densitometer scans were performed and results were expressed as fold induction relative to diestrous animals.
RT-PCR
The arcuate nucleus from diestrous and lactating rats with pups (n = 4 per group) was microdissected from thick (300 µm) coronal brain sections using a micropunch technique as previously described (22). Arcuate tissue punches were placed in Trizol reagent and the tissue disrupted mechanically by sonication. Total RNA was extracted and reverse transcribed as previously described (18) using the Superscript Preamplification System according to the manufacturers instructions (Life Technologies, Inc.). The RT product was amplified in PCR with specific rodent CIS forward (CTGGCTCCTTTCTTCTTCCG) and reverse (CACAAGGCTGACCACATCTG) primers designed from GenBank sequences (AJ243907 and AF065161). PCR was performed using 0.4 µl RT product, 0.5 µM of each primer, 0.2 mM deoxynucleotide triphosphate, 2 mM MgCl2 and 1.3 U Taq DNA polymerase in 50 µl 1x Taq reaction buffer for 35 cycles (94 C, 30 sec; 61 C, 30 sec; 72 C, 30 sec). PCR products were visualized on an ethidium bromide-stained agarose gel. In addition, PCR with ß-actin primers (forward, TGAACCCTAAGGCCAACCGTG; reverse GCTCATAGCTCTTCTCCAGGG) was performed for 24 cycles (94 C for 30 sec; 68 C for 30 sec; 72 C for 30 sec) as a positive control for each tissue sample.
Statistics
Data were analyzed using one or two-way ANOVA, followed by Student-Newman-Keuls post hoc test where appropriate. Data were log transformed before analysis to reduce heterogeneity of variance.
| Results |
|---|
|
|
|---|
|
|
Is the resistance to PRL signaling through STAT5 dependent upon endogenous PRL levels?
Because the continuously suckled lactating rats in the previous experiment (Fig. 2
) would have high endogenous PRL levels compared with animals with their pups removed, it is possible that the difference in PRL concentrations per se could account for the different STAT5 responses to injected PRL. We therefore treated animals with bromocriptine to suppress endogenous PRL and reexamined the STAT5 response to PRL injection. In continuously suckled lactating rats pretreated with bromocriptine, oPRL injection had no significant effect on the STAT5 N/C ratio in TIDA neurons (Fig. 3
). In comparison, oPRL injection significantly (P < 0.05) increased the STAT5 N/C ratio in diestrous rats, despite pretreatment with bromocriptine (Fig. 3
).
|
|
Is CIS protein up-regulated in TIDA neurons?
We used dual-label immunofluorescence to determine whether CIS or SOCS3 was localized to TIDA neurons. Figure 5
shows representative images of CIS and SOCS3 immunoreactivity in TH-positive neurons in the dmArc nucleus. All TH-positive neurons in the dmArc expressed CIS in both diestrous and lactating rats. In addition, there were many CIS-positive cells that were not TH positive in the dmArc nucleus (Fig. 5
, AD). Furthermore, CIS immunoreactive perikarya were observed in other nearby hypothalamic regions including the ventrolateral arcuate nucleus, ventromedial nucleus, dorsomedial hypothalamus, lateral hypothalamus, and zona incerta (not shown). The distribution of CIS in the dmArc and other hypothalamic regions was confirmed with another CIS antisera (gift from A. Yoshimura).
|
To investigate whether CIS expression is increased in the TIDA neurons of lactating rats, we quantified the intensity of CIS immunostaining from confocal images of TH-positive neurons in the dmArc. In continuously suckled lactating rats, the intensity of CIS staining in either the cytoplasm (Fig. 6A
) or nucleus (Fig. 6B
) was significantly (P < 0.05) greater than that observed in either pup-deprived lactating rats, or diestrous rats. In most neurons, the intensity of CIS immunostaining in the cytoplasm was greater than the nucleus (see Fig. 5
, C and D).
|
| Discussion |
|---|
|
|
|---|
Diminished responsiveness of the TIDA neurons to PRL negative feedback in lactation is well recognized (10, 11, 12, 23). Our results suggest that at least part of the reduction in negative feedback occurs at the PRL signal transduction level involving STAT5. PRL signals through various signal transduction pathways, and some involve STAT proteins, notably STAT1, STAT3, and STAT5 (24). However, the predominant signaling pathway for PRL in most cells appears to be via Jak2/STAT5. STAT5 has been previously localized to the TIDA neurons in the arcuate nucleus (8, 25). Indeed, STAT5 nuclear translocation in response to PRL in TIDA neurons had been noted in ovariectomized rats (8), and now we show similar effects in both diestrous and lactating rats where pups have been removed for 16 h. Moreover, the STAT5b isoform appears to be essential for normal PRL negative feedback because STAT5b-deficient mice have abnormally high serum PRL concentrations due to a lack of negative feedback on TIDA neurons (9). Our results in lactating rats extend these findings, indicating that lactational hyperprolactinaemia due to the sucking stimulus is associated with a reduction of PRL-induced STAT5 signaling within the TIDA neurons.
There are a number of possible explanations for reduced PRL feedback via STAT5 in the TIDA neurons of lactating rats. For example, the lack of PRL signal transduction via STAT5 may be simply due to PRL receptor down-regulation. This appears unlikely because the numbers of neurons in the arcuate nucleus expressing immunoreactive PRL receptors are increased during lactation (13), and recent in situ hybridization studies (Kokay, I., and D. Grattan, personal communication) show that PRL receptor mRNA expression on TIDA neurons does not change in lactation. Another possible explanation for reduced STAT5 nuclear translocation is that there is increased expression of an inhibitor of PRL signaling that causes PRL resistance within the TIDA neurons. In this regard, the SOCS family of proteins are likely candidates because SOCS1, SOCS3, and CIS are well known to inhibit PRL signaling through Jak2/STAT5 (14, 14, 26, 27).
Our initial approach using Northern blots on whole hypothalamus suggested that CIS could be the factor causing resistance to PRL negative feedback in lactation. We observed increased CIS mRNA expression in the hypothalamus of continuously suckled lactating rats, compared with both diestrous and lactating rats with their pups removed for 16 h. Furthermore, in continuously suckled lactating rats we localized increased CIS mRNA expression to the arcuate nucleus using discrete micropunches and found significantly higher levels of CIS immunostaining within the TIDA neurons. Indeed, using two different CIS antisera we observed that all TH-immunoreactive neurons in the dmArc were immunoreactive for CIS. Together, these results strongly support the notion that loss of sensitivity to PRL negative feedback during lactation is a result of increased CIS expression in TIDA neurons. In contrast, our results do not suggest such a role for the other SOCS proteins that inhibit PRL signaling. We did not observe any increase in hypothalamic mRNA expression of SOCS1 and SOCS3 in lactating rats with pups, whereas SOCS2 was undetectable. However, because our Northern blots were performed on whole hypothalamus, they may not be indicative of changes in SOCS expression within TIDA neurons, so SOCS13 cannot be excluded. Nevertheless, SOCS3 is unlikely to be important in PRL negative feedback because we did not observe SOCS3 immunoreactivity in the TIDA neurons of lactating (or diestrous) rats. So overall, our studies suggest that increased CIS expression in the TIDA neurons contributes to the loss of sensitivity to PRL negative feedback during lactation, although involvement of SOCS1 and SOCS2 cannot be excluded.
Despite strong in vitro evidence that CIS inhibits PRL signaling through STAT5 by binding directly to the PRL receptor (28, 29), few in vivo studies have investigated physiological roles for CIS. Mice overexpressing CIS display reduced STAT5 phosphorylation in the mammary glands and fail to lactate after parturition (26), indicative of a failure in PRL signal transduction. In contrast, CIS null mice do not display any overt phenotype (30). However, to our knowledge circulating PRL concentrations have not been examined in either of these animal models. As a logical extension of our present results, we would predict the CIS null mouse to have abnormally low PRL levels during lactation. The fact that these animals lactate normally (Ihle, J., personal communication) could indicate a redundant role for CIS in the TIDA neurons. Alternatively, PRL levels in CIS null mice may be reduced but still sufficient to stimulate lactogenesis, and only close examination of PRL levels in these animals would reveal any deficit.
Whether the increase in CIS expression is a consequence of high endogenous PRL levels caused by the sucking stimulus or a consequence of other mechanisms remains to be determined. Up-regulation of SOCS/CIS expression in cells to date has been viewed primarily as direct consequence of cytokine stimulation, with increased SOCS/CIS expression preventing further stimulation by the cytokine and therefore cellular resistance. However, increasingly other signaling molecules, for example angiotensin (31), TSH (32), and prostaglandin F2
(21), have been shown to modulate expression of SOCS proteins and therefore could induce cytokine resistance. In relation to the TIDA neurons, it is worth noting from our results that bromocriptine treatment, to suppress endogenous PRL levels, did not modify the lack of STAT5 responsiveness to PRL in the TIDA neurons of lactating rats (Fig. 3
). Also, we did not observe any change in hypothalamic CIS mRNA expression in lactating rats after bromocriptine treatment (see the supplemental data published on The Endocrine Societys Journals Online web site at http://endo.endojournals.org). Certainly, the return of sucking pups to their mothers after 16 h of separation markedly increases hypothalamic CIS mRNA expression within 1 h (see supplemental data). Therefore, it is likely that the increased CIS expression in lactating rats in response to the sucking stimulus is a consequence of stimuli other than PRL, possibly neuronal inputs to the TIDA neurons, and this warrants further investigation.
In conclusion, our results indicate that PRL negative feedback on TIDA neurons involves nuclear translocation of STAT5 and this is disrupted in lactating rats by the sucking stimulus. We have further shown that CIS, a member of the SOCS family of proteins known to negatively regulate PRL signaling, is up-regulated in the hypothalamus during lactation by the sucking stimulus. Moreover, CIS protein is localized to TIDA neurons that mediate PRL negative feedback, and in lactating rats CIS levels in these neurons is increased in the presence of sucking pups. Together, the results support the hypothesis that loss of sensitivity to PRL negative feedback during lactation is a result of increased expression of CIS in the TIDA neurons.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online December 15, 2005
Abbreviations: CIS, Cytokine-inducible SH2-domain-containing protein; FITC, fluorescein isothiocyanate; Jak2, Janus tyrosine kinase 2; N/C, nuclear/cytoplasmic; oPRL, ovine PRL; PRL, prolactin; SOCS, suppressors of cytokine signaling; RT, reverse transcription; STAT, signal transducers and activators of transcription; TIDA, tuberoinfundibular dopaminergic.
Received July 19, 2005.
Accepted for publication December 2, 2005.
| References |
|---|
|
|
|---|
) analog induces suppressors of cytokine signaling-3 expression in the corpus luteum of the pregnant rat: a potential new mechanism in luteolysis. Endocrinology 143:39843993This article has been cited by other articles:
![]() |
A. Blume, L. Torner, Y. Liu, S. Subburaju, G. Aguilera, and I. D. Neumann Prolactin Activates Mitogen-Activated Protein Kinase Signaling and Corticotropin Releasing Hormone Transcription in Rat Hypothalamic Neurons Endocrinology, April 1, 2009; 150(4): 1841 - 1849. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Misztal, K. Gorski, D. Tomaszewska-Zaremba, E. Molik, and K. Romanowicz Identification of salsolinol in the mediobasal hypothalamus of lactating ewes and its relation to suckling-induced prolactin and GH release J. Endocrinol., July 1, 2008; 198(1): 83 - 89. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ben-Jonathan, C. R. LaPensee, and E. W. LaPensee What Can We Learn from Rodents about Prolactin in Humans? Endocr. Rev., February 1, 2008; 29(1): 1 - 41. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Anderson, P. Beijer, A. S. Bang, M. A. Fenwick, S. J. Bunn, and D. R. Grattan Suppression of Prolactin-Induced Signal Transducer and Activator of Transcription 5b Signaling and Induction of Suppressors of Cytokine Signaling Messenger Ribonucleic Acid in the Hypothalamic Arcuate Nucleus of the Rat during Late Pregnancy and Lactation Endocrinology, October 1, 2006; 147(10): 4996 - 5005. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |