| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
B
Department of Medicine (Y.M., L.Z., T.P., J.C., S.T., J.Z., J.D.), Baylor College of Medicine, Houston, Texas 77030; and Department of Internal Medicine (P.D.), Tulane University, New Orleans, Louisiana 70131
Address all correspondence and requests for reprints to: Dr. Jie Du, Mail stop BCM285, Department of Medicine, One Baylor Plaza, N520, Baylor College of Medicine, Houston, Texas 77030. E-mail: jdu{at}bcm.edu.
| Abstract |
|---|
|
|
|---|
B (NF-
B)-like sequences located in the same region of the IGF-IR promoter. When we mutated either of these NF-
B-like sites, Ang II-induced IGF-IR promoter activity decreased sharply. Electrophoretic mobility gel shift, anti-p50 of NF-
B supershift and chromatin immunoprecipitation assays demonstrated that both the p65 and p50 subunits of NF-
B will bind to this Ang II response element in the IGF-IR promoter. When we blocked the Ras/MAPK kinase 1 pathway or the inhibitory-
B kinase pathway, both Ang II-induced IGF-IR promoter activity and expression of IGF-IR protein significantly declined. Our results indicate that the mechanism by which Ang II stimulates IGF-IR expression in VSMCs involves NF-
B binding to NF-
B sites in the IGF-IR promoter, leading to expression of IGF-IR through both Ras/MAPK kinase 1-and inhibitory-
B kinase-dependent pathways. Because IGF-IR is a major factor associated with thickening of mesenteric vessels, our results provide potential therapeutic targets. | Introduction |
|---|
|
|
|---|
In vascular smooth muscle cells (VSMCs), activated IGF-IR is involved in regulating proliferation, migration, and apoptosis (16, 17), and the mitogenic effects of Ang II are blocked when IGF-IR expression is inhibited by antisense IGF-IR cDNA (10, 12). How does Ang II increase IGF-IR expression in VSMCs? Two pathways that increase IGF-IR expression have been identified: a protein kinase C-independent, a redox-sensitive, and the Ras-Raf-MAPK pathway (11, 18, 19). The transcriptional mechanism and downstream transcription factor(s) that are activated when Ang II stimulates IGF-IR expression have not been identified. Structural and functional analyses of the IGF-IR gene promoter region reveal that it lacks TATA or CAAT elements (20, 21). The proximal 5'-flanking region of the IGF-IR gene is GC rich and contains multiple specificity protein-1 (Sp1) and early growth response consensus-binding sequences (20, 21, 22, 23). Other reports indicate that the transcriptional factors Sp1, Wilms tumor 1 (an early growth response gene), and p53 can each regulate IGF-IR gene expression (22, 24, 25). Regarding redox stimulation of IGF-IR, reactive oxygen species are known to activate NF-
B, but it is unsettled whether this transcription factor mediates Ang II-induced IGF-IR expression.
Recently we showed that stimulation of the Ras/MAPK kinase (MEK)1/p90 ribosomal S6 kinase (RSK) pathway by Ang II activates I
B kinase (IKK) to phosphorylate p65 of nuclear factor-
B (NF-
B). This increases NF-
B transcriptional activity (26, 27). Therefore, we investigated the influence of NF-
B on IGF-IR expression. We found that a region in IGF-IR promoter is responsive to Ang II stimulation and that there are NF-
B like sequences in this region. We also found that phosphorylated NF-
B components, p65 and p50 of NF-
B, bind to the Ang II-responsive element in the IGF-IR promoter. The signaling pathway leading to transcriptional stimulation of the IGF-IR promoter includes activation of IKK and Ras/MEK1.
| Materials and Methods |
|---|
|
|
|---|
The IGF-IR promoter-reporter gene (476/+640-Luc), which exhibits full responses to Ang II (18), was used to generate series 5'-end deletion fragments. The fragments were from nucleotides 476 to +21, 416 to +21, 330 to +21, 270 to +21, and 135 to +21. These fragments were subcloned into the firefly luciferase pGL2 basic vector (IGF-IR-Luc) (19). The mutations for the IGF-IR promoter sequence in the mut 190/170 construct or mut 210/190 construct were created by a standard PCR-based linker-scan mutagenesis. We replaced the sequence 190/170 or 210/190 in IGF-IR with a same length of linker: 5'-GAGATCTTGATCAGATATCA-3'. Briefly, the linker sequence was incorporated so that it flanked the PCR primer of the IGF-IR promoter. Two separate PCRs were performed to amplify fragments upstream and downstream of an appropriate mutation site (190/170 or 210/190). The combined overlap fragments were used as templates to generate mutation within the region of 270/+21 of IGF-IR; and the mutated fragments were subcloned into pGL2 luciferase vector.
We also used adenoviruses expressing dominant-negative RasY57, IKKß KA, and MEK1 to investigate mechanism of NF-
B activation as described (26, 28). All experiments were conducted in primary VSMCs isolated from rat thoracic aortas as described (29). Cells were grown in culture medium with 4.5 g/liter glucose, supplemented with 10% calf serum, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin and passaged twice a week. For the experiments examining IGF-IR expression, we used cells from passages 516 seeded into 100-mm dishes and grown to 8090% confluence. They were rendered quiescent by exposure to serum-free medium for 48 h.
Transient transfection and luciferase assay
VSMCs (107 cells) were transfected with 5 µg IGF-IR-Luc and 5 ng pRL-TK using the Nucleofector reagent and electroporator (AMAXA, San Diego, CA). They were grown in 24-well plates. Some IGF-IR-Luc transfected cells were infected with adenoviruses expressing dominant-negative RasY57, IKKßKA, or MEK1, as described (26). These cells were then placed in serum-free media for 24 h before being treated for 6 h with or without Ang II (100 nM). Firefly and Renilla luciferase activities were measured using a dual luciferase system (Promega, Madison, WI).
Real-time PCR
VSMCs at 8090% confluence were serum starved for 24 h before adding 100 nM Ang II for 1, 2, 3, or 6 h. Total RNA was isolated by Tri-reagent (Sigma-Aldrich), and one-step RT-PCR was performed with 80 ng RNA for both the target gene and endogenous control (ABI7000, Applied Biosystems, Foster City, CA). Probe and primers for rat IGF-IR and an endogenous control (ß-actin) were purchased from Applied Biosystems. The PCR cycling conditions were as follows: 48 C for 30 min, 95 C for 10 min, 40 cycles at 95 C for 15 sec, and 60 C for 1 min. Expressions of target genes were measured in triplicate and normalized to ß-actin expression levels.
EMSA
Extracts from nuclei of VSMCs were prepared as described (28). A double-stranded oligonucleotide containing the putative IGF-IR 178/168 NF-
B-like sequences, 5'-TGCCTCCTGGGCCCGGCT-3', and 205/195, 5'-GGCCGGCGCGGGTGGAGGC-3', were used to measure the DNA-binding activity of NF-
B by EMSA. For supershift, we used 1 µg of anti-p50 or control IgG antibody in the binding mixture.
Footprinting
The IGF-IR-promoter fragment (330 to +21) was end labeled using
-32P-ATP and incubated for 20 min with recombinant NF-
B p50 (Promega) or buffer alone (control reactions). Enzymatic cleavage was initiated by adding a RQ1 RNase-free DNase I solution (Promega). Footprinting was detected using the Promega kit according to the manufacturers instruction. The samples were analyzed in Urea-6% polyacrylamide gel. The
-32P-ATP-labeled
X174/HinfI DNA ladder (Stratagene, La Jolla, CA) was used for localization of footprinting.
Chromatin immunoprecipitation assay (CHIP)
CHIP analysis was performed according the kit manufactures protocol (Upstate Biotechnology, Lake Placid, NY) with a slight modification. Briefly, after incubation with 100 nM Ang II, 3 x 106 VSMCs were fixed with 1% formaldehyde for 5 min. VSMCs were washed extensively with ice-cold PBS and then lysed in the lysis buffer over 10 min. Chromatin was sheared by sonication to an average size of approximately 300400 bp and immunoprecipitated overnight at 4 C with 10 µl (1 µg) of anti-p65, anti-phosphor-p65, or anti-p50 of NF-
B. Immune complexes were collected using salmon sperm DNA-saturated protein G Sepharose for 1 h and washed extensively following the manufacturers protocol. Immunoprecipitated chromatin fragments were incubated at 65 C overnight to release DNA from chromatin. After proteinase K digestion, DNA was extracted with phenol/chloroform and precipitated with ethanol. Precipitated DNAs were analyzed by PCR (40 cycles) using the following promoter-specific primers: forward (234 to 220), 5'-GTGGCTCAGTGTGCG-3', and reverse (104 to 120), 5'-TCGGCAGTCGCCAAGAG-3' to amplify a 130-bp region of the rat IGF-IR promoter.
Ang II infusion of rats and immunohistochemistry assay of IGF-IR
Three-month-old male Sprague Dawley rats had sc implantation of osmotic pumps (model 2001; Alza Corp., Palo Alto, CA). Ang II (500 ng/kg·min in Ringers solution) was infused for 7 d; control rats received the vehicle. The mesenteric artery was isolated, embedded in paraffin, and examined as described (26). The experiments were approved by the Institutional Animal Care and Use Committee of the Baylor College of Medicine.
Statistical analysis
All experiments were performed at least three times. Data are expressed as mean ± SE. Comparisons between groups was performed with Students t test, and a value of P < 0.05 was considered statistically significant.
| Results |
|---|
|
|
|---|
|
Localization of the Ang II-responsive promoter element
To localize the Ang II-responsive region of the IGF-IR promoter, we performed 5'-end deletions of IGF-IR promoter (476/+640) (Fig. 2A
, left panel). VSMCs were transiently transfected with these promoter segments in promoter-luciferase reporter constructs and with pRL-TK (as an internal control). Using the control IGF-IR promoter, we found that Ang II (100 nM) exposure significantly increased IGF-IR promoter activity in VSMCs, compared with basal p(270/+21-luc) activity (Fig. 2A
, right panel). A shorter IGF-IR promoter, p(270/+21-Luc), did not eliminate responsiveness to Ang II (2.9 ± 0.4-fold increase, P < 0.01, n = 4) but when the promoter was clipped to 135 nt [p(135/+21-Luc)], there was no response to Ang II. This suggests the major Ang II-responsive element is located between nucleotides 270 and 135 of the 5'-flanking region of IGF-IR promoter. There are two putative NF-
B binding sites in this IGF-IR promoter region located at 178/168 (GGGCCCGGCT) and 205/195 (GGGTGGAGGC) of IGF-IR (Fig. 2B
, bottom panel). To examine whether NF-
B binds to these sites, we performed a DNase I footprinting assay. The p50 subunit of NF-
B is generally considered to bind to a NF-
B site, but p65 subunit can also bind a NF-
B site (30, 31). We used recombinant p50 of NF-
B to determine whether NF-
B binds to the promoter region of IGF-IR. The 352-bp DNA of the IGF-IR promoter (331/+21), which contains both putative NF-
B sites, was incubated with recombinant p50 of NF-
B, followed by DNase I digestion and gel separation. As shown in Fig. 2B
(upper panel), the p50 of NF-
B protected the putative NF-
B sites of the IGF-IR promoter at 205/195 and 178/168, respectively.
|
B-like sites are involved in Ang II stimulation of IGF-IR promoter activity, we mutated the sequences containing either NF-
B-like sites of 190/170 or 210/190 by replacing with a same-length linker GAGATCTTGATCAGATATCA within the region of 270/+21 of IGF-IR and subcloned these mutations into pGL2 luciferase constructs. When the mutated IGF-IR promoter constructs were transiently transfected into VSMCs, the promoter activity in response to Ang II decreased significantly (Fig. 2C
B site in IGF-IR promoter is important for Ang IIinduced transcriptional regulation of IGF-IR.
Ang II increases NF-
B binding to the putative NF-
B site in the IGF-IR promoter
To examine whether Ang II stimulates NF-
B binding to the NF-
B-like site in the IGF-IR promoter, we designed a probe containing the sequences of the NF-
B-like sites in the IGF-IR promoter (178 to 168) and used the probe in an in vitro DNA-protein binding assay. As shown in Fig. 3A
, Ang II increased the binding of a nuclear protein to the NF-
B-like site. The Ang II-stimulated binding to the probe was not present when we added an excess (100-fold) of cold probe (Fig. 3A
, upper panel, lane 2) or when we added classical NF-
B consensus oligos (Fig. 3A
, upper panel, lane 3). However, an excess (100-fold) of unrelated activator protein-1 cold probe did not affect binding (Fig. 3A
, bottom panel).
|
B binding to the NF-
B-like site in the IGF-IR promoter, we did both supershift and CHIP assay. As shown in Fig. 3B
B. Moreover, VSMCs were treated with Ang II and chromatin was immunoprecipitated with anti p50, anti-p65, or anti-phospho-p65 of NF-
B and followed by PCR amplification of the 130-bp promoter region of IGF-IR. We found that p50 and p65 bound to the IGF-IR promoter within 45 min of treating VSMCs with Ang II (Fig. 3C
Ras/MEK1 and IKK mediate Ang II-stimulated transcriptional expression of IGF-IR
Recently we showed that Ang II increases phosphorylation of p65 of NF-
B and its transcriptional activity by both the Ras/MEK1/RSK and IKK pathways (27). To determine whether the Ras/MEK1 or IKK pathways are upstream signals that activate NF-
B to regulate IGF-IR transcription in VSMCs, we transfected VSMCs with the IGF-IR promoter reporter construct, p(476/+21-Luc). The cells were then infected with a recombinant adenovirus expressing a dominant-negative form of IKK (Ad.IKKßKA) or Ras (Ad.RasY57) or MEK1(Ad.MEK1DN). As shown in Fig. 4A
, the expression of a dominant-negative Ras or MEK1 almost completely blocked the ability of Ang II to stimulate IGF-IR promoter-luciferase activity (vs. control results obtained with infection of an adenovirus expressing ß-galactosidase. Likewise, expression of the dominant-negative IKKß suppressed IGF-IR promoter activity 61% (P < 0.05). As a positive control for NF-
B activity, we infected VSMCs with adenoviruses expressing dominant-negative IKKß, Ras, or MEK1. VSMCs were then treated with Ang II and NF-
B promoter activity was sharply reduced (Fig. 4B
). Note that Ang II induced a greater increase in NF-
B expression, compared with that of IGF1-IR promoter activity. These results indicate that Ang II regulates transcription of IGF-IR by Ras/MEK1- and IKK-dependent pathways. To evaluate whether inhibition of signaling pathways activated by Ang II will not only decrease the transcription of the IGF-IR gene but also reduce the expression of IGF-IR, we expressed dominant-negative MEK1, Ras, or IKKß in VSMCs. Blocking these pathways inhibited Ang II-induced increase in IGF-IR protein (Fig. 4
, C and D).
|
| Discussion |
|---|
|
|
|---|
B and the IGF-IR promoter and that two pathways, Ras/MEK1 and IKK, mediate the transcription of the IGF-IR. This is relevant because the expression of IGF-IR is primarily determined at the transcriptional level, and Ang II increases IGF-IR expression in both cultured VSMCs and the arteries of animals (Fig. 1
Ang II stimulated promoter activity of the 476/+640 fragment to a much larger extent than the 476/+21 fragment, Giraud et al. (32) have shown that 5'-untranslated region of the IGF-IR (+21 to +640) increase translation by an internal initiation mechanism. This mechanism is responsible for the greater luciferase activity of the 476/+640 promoter fragment, compared with the 476/+21 promoter fragment. However, when we compared the promoter activity of the 476/+640 fragment with that of the 270/+21 fragment, Ang II induced a similar degree of activation (2.6 ± 0.3-fold vs. 2.8 ± 0.25-fold, P > 0.05). The smaller induction of IGF-IR promoter activity by Ang II in the 476/+21 and 416/+21 relative to 270/+21 is the result of negative regulatory elements. Idelman et al. (33) showed that the 476/+640 of IGF-IR promoter is negatively regulated by a number of transcription factors, including the Wilms tumor 1 and p53 tumor suppressors. Using a promoter-deletion analysis, we found a cis element for the Ang II response located between 270 and 135 nt of the IGF-IR promoter (Fig. 2A
). Additional evidence was obtained by showing that mutation of the NF-
B like site at 178/168 and 205/195 nt of the IGF-IR promoter blocked the transcriptional response in cells exposed to Ang II (Fig. 2C
). We performed a sequence alignment between human and rats and found three NF-
B-like sequences in the human IGF-IR promoter region, located at 97 to 87; 158 to 145; and 191 to 180. There were 80, 80, and 60% similarities, respectively, with our analysis of promoter regions in the rat gene that could interact with NF-
B.
The binding of NF-
B to the IGF-IR promoter was investigated in depth using a supershift and CHIP assay: we found a NF-
B-IGF-IR DNA complex using this assay. An antibody against p50 of NF-
B shifted the binding complex (Fig. 3B
). Moreover, antibodies recognizing p65, p50, and phospho-p65 of NF-
B pulled down an IGF-IR promoter fragment, indicating NF-
B binding was occurring in nuclei of Ang II-treated VSMCs (Fig. 3C
). Notably, peak binding of phospho-p65 to the IGF-IR promoter occurred as early as 15 min, and subsequently phosphor p65 is replaced by nonphosphorylated p65 and p50. The latter NF-
B in binding reaches a second peak after 40 min (Fig. 3C
). The results are consistent with those reported by Gao et al. (34), who found a dynamic change in NF-
B binding to inhibitory-
B promoter after TNF
treatment of HEK293 cells. These dynamic changes in promoter binding change the transcriptional activity in these cells. The mechanism underlying the biphasic changes in binding patterns has not been identified.
Identifying how Ang II stimulates the binding of phosphorylated p65 or p65/p50 to IGF-IR promoter and activates IGF-IR transcription is an important step in understanding the signaling pathway by which Ang II stimulates transcription of IGF-IR. Previously we showed that Ang II increases the expression of IGF-IR via a redox and a protein tyrosine kinase-dependent signaling pathway that is independent of protein kinase C (18). Recently we found that both the activated Ras/MEK1/RSK and IKK pathway can stimulate phosphorylation of p65 to activate NF-
B (26, 27). Thus, there are two pathways capable of producing maximal NF-
B-mediated responses. In the present study, we found that inhibition of Ras/MEK1 or IKK in VSMCs not only blocks Ang II-induced NF-
B promoter activity but also inhibits Ang II-induced transcription of IGF-IR (Fig. 4
, A, C, and D). Note that inhibition of Ras/MEK1 causes different responses in terms of Ang II-induced transcription. First, it reduces Ang II-stimulated IGF-IR transcription by 85%. Second, it suppresses Ang II-induced transcription of the downstream mediator, NF-
B, but by only 70% (Fig. 4B
). These results suggest that the Ras/MEK1 pathway must stimulate other downstream transcription factors that regulates IGF-IR transcription other than NF-
B. Werner et al. (21) reported that the transcription factor Sp1 is involved in IGF-IR transcription. Because MEk1 can regulate Sp1, our results highlight the complexity of transcriptional regulation of IGF-IR.
In summary, we have demonstrated that Ang II induces expression of IGF-IR through activation of the transcription factor NF-
B. The pathways that regulate NF-
B activity, Ras/MEK1 and IKK, are involved in initiating transcription of the IGF-IR gene and protein expression. These results could provide targets for strategies directed at preventing vascular remodeling.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online December 1, 2005
1 Y.M., L.Z., and T.P. contributed equally to this work. ![]()
Abbreviations: Ang II, Angiotensin II; CHIP, chromatin immunoprecipitation assay; IGF-IR, IGF-I receptor; IKK, inhibitory-
B kinase; MEK1, MAPK kinase-1; NF-
B, nuclear factor-
B; RSK, p90 ribosomal S6 kinase; Sp1, specificity protein-1; VSMC, vascular smooth muscle cells.
Received July 15, 2005.
Accepted for publication November 21, 2005.
| References |
|---|
|
|
|---|
B activation by angiotensin II in vascular smooth muscle: phosphorylation of p65 by I
B kinase and ribosomal kinase. Circ Res 97:975982
}B kinase. Cancer Res 65:457464
B in the recognition of cognate sequences. New Biol 3:279288[Medline]
B contacts DNA by a heterodimer of the p50 and p65 subunit. EMBO J 10:18171825[Medline]
B in I
B
gene promoter. J Biol Chem 280:2109121098This article has been cited by other articles:
![]() |
M. M. Kavurma, M. Schoppet, Y. V. Bobryshev, L. M. Khachigian, and M. R. Bennett TRAIL Stimulates Proliferation of Vascular Smooth Muscle Cells via Activation of NF-{kappa}B and Induction of Insulin-like Growth Factor-1 Receptor J. Biol. Chem., March 21, 2008; 283(12): 7754 - 7762. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Bell, J. E. Clark, D. J. Hearse, and M. J. Shattock Reperfusion kinase phosphorylation is essential but not sufficient in the mediation of pharmacological preconditioning: Characterisation in the bi-phasic profile of early and late protection Cardiovasc Res, January 1, 2007; 73(1): 153 - 163. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |