help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0888
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/3/1256    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, Y.
Right arrow Articles by Du, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, Y.
Right arrow Articles by Du, J.
Endocrinology Vol. 147, No. 3 1256-1263
Copyright © 2006 by The Endocrine Society

Angiotensin II Stimulates Transcription of Insulin-Like Growth Factor I Receptor in Vascular Smooth Muscle Cells: Role of Nuclear Factor-{kappa}B

Yewei Ma1, Liping Zhang1, Tao Peng1, Jizhong Cheng, Shilpa Taneja, Jiqiang Zhang, Patrice Delafontaine and Jie Du

Department of Medicine (Y.M., L.Z., T.P., J.C., S.T., J.Z., J.D.), Baylor College of Medicine, Houston, Texas 77030; and Department of Internal Medicine (P.D.), Tulane University, New Orleans, Louisiana 70131

Address all correspondence and requests for reprints to: Dr. Jie Du, Mail stop BCM285, Department of Medicine, One Baylor Plaza, N520, Baylor College of Medicine, Houston, Texas 77030. E-mail: jdu{at}bcm.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Increased expression of the IGF-I receptor (IGF-IR) is associated with proliferation and survival of vascular smooth muscle cells (VSMCs). In cultured VSMCs, we reported that angiotensin II (Ang II) increases transcription and expression of IGF-IR. Now, we show that mesenteric arteries of rats infused with Ang II develop thickening and increased IGF-IR expression. To determine how Ang II transcriptionally regulates IGF-IR expression in VSMCs, we generated 5'-end deletions of the IGF-IR promoter and measured Ang II-induced promoter-luciferase activity in VSMCs. Activities from these promoter sequences suggested that the Ang II-responsive region is located between –270 and –135 of the IGF-IR promoter. Using a DNase I foot printing analysis, we identified two putative nuclear factor-{kappa}B (NF-{kappa}B)-like sequences located in the same region of the IGF-IR promoter. When we mutated either of these NF-{kappa}B-like sites, Ang II-induced IGF-IR promoter activity decreased sharply. Electrophoretic mobility gel shift, anti-p50 of NF-{kappa}B supershift and chromatin immunoprecipitation assays demonstrated that both the p65 and p50 subunits of NF-{kappa}B will bind to this Ang II response element in the IGF-IR promoter. When we blocked the Ras/MAPK kinase 1 pathway or the inhibitory-{kappa}B kinase pathway, both Ang II-induced IGF-IR promoter activity and expression of IGF-IR protein significantly declined. Our results indicate that the mechanism by which Ang II stimulates IGF-IR expression in VSMCs involves NF-{kappa}B binding to NF-{kappa}B sites in the IGF-IR promoter, leading to expression of IGF-IR through both Ras/MAPK kinase 1-and inhibitory-{kappa}B kinase-dependent pathways. Because IGF-IR is a major factor associated with thickening of mesenteric vessels, our results provide potential therapeutic targets.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ANGIOTENSIN II (ANG II) plays an important role in vascular disease (1, 2, 3), and angiotensin-converting enzyme inhibitors or Ang II type 1 receptor antagonists can lower blood pressure and reverse vascular remodeling in patients with hypertension or in spontaneously hypertensive rats (4). Ang II exerts some of its effects on the vasculature by stimulating expression of growth factors including basic fibroblast growth factor (5), platelet-derived growth factor (6), TGFß (7, 8), IGF-I (9) and the IGF-I receptor (IGF-IR) (10, 11, 12). IGF-IR has a unique role because it is required for functioning of the cell signaling processes initiated by other growth factors. Fibroblasts derived from mice embryos lacking IGF-IR fail to grow in response to platelet-derived growth factor or basic fibroblast growth factor separately or in combination (13, 14). There also is a requirement for IGF-IR action in normal development because IGF-IR knockout mice have severe growth retardation and perinatal lethality (15).

In vascular smooth muscle cells (VSMCs), activated IGF-IR is involved in regulating proliferation, migration, and apoptosis (16, 17), and the mitogenic effects of Ang II are blocked when IGF-IR expression is inhibited by antisense IGF-IR cDNA (10, 12). How does Ang II increase IGF-IR expression in VSMCs? Two pathways that increase IGF-IR expression have been identified: a protein kinase C-independent, a redox-sensitive, and the Ras-Raf-MAPK pathway (11, 18, 19). The transcriptional mechanism and downstream transcription factor(s) that are activated when Ang II stimulates IGF-IR expression have not been identified. Structural and functional analyses of the IGF-IR gene promoter region reveal that it lacks TATA or CAAT elements (20, 21). The proximal 5'-flanking region of the IGF-IR gene is GC rich and contains multiple specificity protein-1 (Sp1) and early growth response consensus-binding sequences (20, 21, 22, 23). Other reports indicate that the transcriptional factors Sp1, Wilms’ tumor 1 (an early growth response gene), and p53 can each regulate IGF-IR gene expression (22, 24, 25). Regarding redox stimulation of IGF-IR, reactive oxygen species are known to activate NF-{kappa}B, but it is unsettled whether this transcription factor mediates Ang II-induced IGF-IR expression.

Recently we showed that stimulation of the Ras/MAPK kinase (MEK)1/p90 ribosomal S6 kinase (RSK) pathway by Ang II activates I{kappa}B kinase (IKK) to phosphorylate p65 of nuclear factor-{kappa}B (NF-{kappa}B). This increases NF-{kappa}B transcriptional activity (26, 27). Therefore, we investigated the influence of NF-{kappa}B on IGF-IR expression. We found that a region in IGF-IR promoter is responsive to Ang II stimulation and that there are NF-{kappa}B like sequences in this region. We also found that phosphorylated NF-{kappa}B components, p65 and p50 of NF-{kappa}B, bind to the Ang II-responsive element in the IGF-IR promoter. The signaling pathway leading to transcriptional stimulation of the IGF-IR promoter includes activation of IKK and Ras/MEK1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ang II and the anti-ß-actin antibody were obtained from Sigma-Aldrich (St. Louis, MO); IGF-I was from Roche Applied Science (Indianapolis, IN), and the anti-IGF-IR ß chain and anti-p65 antibodies were from Santa Cruz Biotechnology (Santa Cruz, VA). The anti-phospho-p65 antibody was from Cell Signaling (Beverly, MA).

The IGF-IR promoter-reporter gene (–476/+640-Luc), which exhibits full responses to Ang II (18), was used to generate series 5'-end deletion fragments. The fragments were from nucleotides –476 to +21, –416 to +21, –330 to +21, –270 to +21, and –135 to +21. These fragments were subcloned into the firefly luciferase pGL2 basic vector (IGF-IR-Luc) (19). The mutations for the IGF-IR promoter sequence in the mut –190/–170 construct or mut –210/–190 construct were created by a standard PCR-based linker-scan mutagenesis. We replaced the sequence –190/–170 or –210/–190 in IGF-IR with a same length of linker: 5'-GAGATCTTGATCAGATATCA-3'. Briefly, the linker sequence was incorporated so that it flanked the PCR primer of the IGF-IR promoter. Two separate PCRs were performed to amplify fragments upstream and downstream of an appropriate mutation site (–190/–170 or –210/–190). The combined overlap fragments were used as templates to generate mutation within the region of –270/+21 of IGF-IR; and the mutated fragments were subcloned into pGL2 luciferase vector.

We also used adenoviruses expressing dominant-negative RasY57, IKKß KA, and MEK1 to investigate mechanism of NF-{kappa}B activation as described (26, 28). All experiments were conducted in primary VSMCs isolated from rat thoracic aortas as described (29). Cells were grown in culture medium with 4.5 g/liter glucose, supplemented with 10% calf serum, 2 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin and passaged twice a week. For the experiments examining IGF-IR expression, we used cells from passages 5–16 seeded into 100-mm dishes and grown to 80–90% confluence. They were rendered quiescent by exposure to serum-free medium for 48 h.

Transient transfection and luciferase assay
VSMCs (107 cells) were transfected with 5 µg IGF-IR-Luc and 5 ng pRL-TK using the Nucleofector reagent and electroporator (AMAXA, San Diego, CA). They were grown in 24-well plates. Some IGF-IR-Luc transfected cells were infected with adenoviruses expressing dominant-negative RasY57, IKKßKA, or MEK1, as described (26). These cells were then placed in serum-free media for 24 h before being treated for 6 h with or without Ang II (100 nM). Firefly and Renilla luciferase activities were measured using a dual luciferase system (Promega, Madison, WI).

Real-time PCR
VSMCs at 80–90% confluence were serum starved for 24 h before adding 100 nM Ang II for 1, 2, 3, or 6 h. Total RNA was isolated by Tri-reagent (Sigma-Aldrich), and one-step RT-PCR was performed with 80 ng RNA for both the target gene and endogenous control (ABI7000, Applied Biosystems, Foster City, CA). Probe and primers for rat IGF-IR and an endogenous control (ß-actin) were purchased from Applied Biosystems. The PCR cycling conditions were as follows: 48 C for 30 min, 95 C for 10 min, 40 cycles at 95 C for 15 sec, and 60 C for 1 min. Expressions of target genes were measured in triplicate and normalized to ß-actin expression levels.

EMSA
Extracts from nuclei of VSMCs were prepared as described (28). A double-stranded oligonucleotide containing the putative IGF-IR –178/–168 NF-{kappa}B-like sequences, 5'-TGCCTCCTGGGCCCGGCT-3', and –205/–195, 5'-GGCCGGCGCGGGTGGAGGC-3', were used to measure the DNA-binding activity of NF-{kappa}B by EMSA. For supershift, we used 1 µg of anti-p50 or control IgG antibody in the binding mixture.

Footprinting
The IGF-IR-promoter fragment (–330 to +21) was end labeled using {gamma}-32P-ATP and incubated for 20 min with recombinant NF-{kappa}B p50 (Promega) or buffer alone (control reactions). Enzymatic cleavage was initiated by adding a RQ1 RNase-free DNase I solution (Promega). Footprinting was detected using the Promega kit according to the manufacturer’s instruction. The samples were analyzed in Urea-6% polyacrylamide gel. The {gamma}-32P-ATP-labeled {varphi}X174/HinfI DNA ladder (Stratagene, La Jolla, CA) was used for localization of footprinting.

Chromatin immunoprecipitation assay (CHIP)
CHIP analysis was performed according the kit manufacture’s protocol (Upstate Biotechnology, Lake Placid, NY) with a slight modification. Briefly, after incubation with 100 nM Ang II, 3 x 106 VSMCs were fixed with 1% formaldehyde for 5 min. VSMCs were washed extensively with ice-cold PBS and then lysed in the lysis buffer over 10 min. Chromatin was sheared by sonication to an average size of approximately 300–400 bp and immunoprecipitated overnight at 4 C with 10 µl (1 µg) of anti-p65, anti-phosphor-p65, or anti-p50 of NF-{kappa}B. Immune complexes were collected using salmon sperm DNA-saturated protein G Sepharose for 1 h and washed extensively following the manufacturer’s protocol. Immunoprecipitated chromatin fragments were incubated at 65 C overnight to release DNA from chromatin. After proteinase K digestion, DNA was extracted with phenol/chloroform and precipitated with ethanol. Precipitated DNAs were analyzed by PCR (40 cycles) using the following promoter-specific primers: forward (–234 to –220), 5'-GTGGCTCAGTGTGCG-3', and reverse (–104 to –120), 5'-TCGGCAGTCGCCAAGAG-3' to amplify a 130-bp region of the rat IGF-IR promoter.

Ang II infusion of rats and immunohistochemistry assay of IGF-IR
Three-month-old male Sprague Dawley rats had sc implantation of osmotic pumps (model 2001; Alza Corp., Palo Alto, CA). Ang II (500 ng/kg·min in Ringer’s solution) was infused for 7 d; control rats received the vehicle. The mesenteric artery was isolated, embedded in paraffin, and examined as described (26). The experiments were approved by the Institutional Animal Care and Use Committee of the Baylor College of Medicine.

Statistical analysis
All experiments were performed at least three times. Data are expressed as mean ± SE. Comparisons between groups was performed with Student’s t test, and a value of P < 0.05 was considered statistically significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ang II increases IGF-IR expression in mesenteric vessels and VSMCs
Infusion of Ang II (500 ng/kg·min) into rats increased systolic blood pressures at d 3 (153 ± 9 mm Hg vs. control, sham infused,135 ± 7 mm Hg, n = 6, P < 0.05) and d 7 (178 ± 14 mm Hg vs. control, sham infused 132 ± 8 mm Hg, n = 6, P < 0.01). After d 7 of Ang II infusion, hematoxylin-eosin staining of mesenteric artery revealed medial thickening (Fig. 1AGo, upper right panel), and immunohistochemical staining showed an increase in the level of IGF-IR (Fig. 1AGo, lower right panel).


Figure 1
View larger version (36K):
[in this window]
[in a new window]
 
FIG. 1. Ang II increases IGF-IR expression in VSMCs. A, Ang II increases IGF-IR expression in vivo. Mesenteric arteries from sham (left panel) and Ang II-infused rats (right panel) were stained with hematoxylin and eosin and show evidence of remodeling (top panel). Immunostaining with anti-IGF-IR demonstrates IGF-IR expression (bottom panel). B, Ang II increases IGF-IR mRNA expression. VSMCs were treated with 100 nM Ang II for the indicated times and the changes in IGF-IR mRNA expression were determined by quantitative real-time PCR, normalized to levels of ß-actin. The fold changes, compared with control values (i.e. after serum starvation) after normalizing to ß-actin, are shown. Data are expressed as mean ± SE of four separate experiments. *, P < 0.01 vs. serum-free results. C, The IGF-IR protein level is increased by Ang II in VSMCs. Proteins from VSMCs after treatment with/without Ang II were separated on 10% PAGE gel and immunoblotted with anti-IGF-IR. ß-Actin was used as a loading control.

 
We incubated VSMCs with 100 nM Ang II for various times and then measured the level of IGF-IR mRNA by real-time PCR. IGF-IR mRNA was significantly increased after 2 h of treatment with Ang II and continued to rise (>4-fold) at 3 h (n = 4; P < 0.01, Fig. 1BGo). After 24 or 48 h of Ang II exposure, there was also an increase in IGF-IR protein (Fig. 1CGo). Thus, Ang II increases IGF-IR in VSMCs both in animals and in vitro.

Localization of the Ang II-responsive promoter element
To localize the Ang II-responsive region of the IGF-IR promoter, we performed 5'-end deletions of IGF-IR promoter (–476/+640) (Fig. 2AGo, left panel). VSMCs were transiently transfected with these promoter segments in promoter-luciferase reporter constructs and with pRL-TK (as an internal control). Using the control IGF-IR promoter, we found that Ang II (100 nM) exposure significantly increased IGF-IR promoter activity in VSMCs, compared with basal p(–270/+21-luc) activity (Fig. 2AGo, right panel). A shorter IGF-IR promoter, p(–270/+21-Luc), did not eliminate responsiveness to Ang II (2.9 ± 0.4-fold increase, P < 0.01, n = 4) but when the promoter was clipped to –135 nt [p(–135/+21-Luc)], there was no response to Ang II. This suggests the major Ang II-responsive element is located between nucleotides –270 and –135 of the 5'-flanking region of IGF-IR promoter. There are two putative NF-{kappa}B binding sites in this IGF-IR promoter region located at –178/–168 (GGGCCCGGCT) and –205/–195 (GGGTGGAGGC) of IGF-IR (Fig. 2BGo, bottom panel). To examine whether NF-{kappa}B binds to these sites, we performed a DNase I footprinting assay. The p50 subunit of NF-{kappa}B is generally considered to bind to a NF-{kappa}B site, but p65 subunit can also bind a NF-{kappa}B site (30, 31). We used recombinant p50 of NF-{kappa}B to determine whether NF-{kappa}B binds to the promoter region of IGF-IR. The 352-bp DNA of the IGF-IR promoter (–331/+21), which contains both putative NF-{kappa}B sites, was incubated with recombinant p50 of NF-{kappa}B, followed by DNase I digestion and gel separation. As shown in Fig. 2BGo (upper panel), the p50 of NF-{kappa}B protected the putative NF-{kappa}B sites of the IGF-IR promoter at –205/–195 and –178/–168, respectively.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Ang II regulates IGF-IR expression through an Ang II-responsive promoter element. A, 5'-end deletion fragments of the IGF-IR promoter were subcloned into pGL2 basic vector. The promoter-luciferase constructs were transfected into VSMCs, and promoter activity was examined after treatment with/without 100 nM Ang II for 6 h. The fold changes were calculated by comparing them with p(–270/+21-Luc) results that were obtained in VSMCs cultured in serum-free media. Data are expressed as mean ± SE of four separate experiments. *, P < 0.01 vs. serum-free results. B, DNase I footprinting assay using recombinant p50. 32P-labeled 352-bp DNA fragments from IGF-IR (–331/+21) were incubated with recombinant p50 (lane 2) followed by DNase I digestion. The sequences of footprint that were protected from DNase I digestion are indicated on the right side of the gel, and the sequence of –270 to –135 of IGF-IR is shown in the bottom panel. C, The constructs (p(–270/+21)luc) containing a mutated NF-{kappa}B-like binding site (–210/–190 or –190/–170) of the IGF-IR promoter were transfected into VSMCs. The VSMCs were treated with/without 100 nM Ang II for 6 h. Data are expressed as mean ± SE of four separate experiments. *, P < 0.01. Ang II vs. serum-free group.

 
To examine whether the NF-{kappa}B-like sites are involved in Ang II stimulation of IGF-IR promoter activity, we mutated the sequences containing either NF-{kappa}B-like sites of –190/–170 or –210/–190 by replacing with a same-length linker GAGATCTTGATCAGATATCA within the region of –270/+21 of IGF-IR and subcloned these mutations into pGL2 luciferase constructs. When the mutated IGF-IR promoter constructs were transiently transfected into VSMCs, the promoter activity in response to Ang II decreased significantly (Fig. 2CGo). However, the mutation construct does not affect the basal promoter activities, compared with wild-type promoter (1.0 vs. 0.9, P = 0.3). These results suggest that the NF-{kappa}B site in IGF-IR promoter is important for Ang II–induced transcriptional regulation of IGF-IR.

Ang II increases NF-{kappa}B binding to the putative NF-{kappa}B site in the IGF-IR promoter
To examine whether Ang II stimulates NF-{kappa}B binding to the NF-{kappa}B-like site in the IGF-IR promoter, we designed a probe containing the sequences of the NF-{kappa}B-like sites in the IGF-IR promoter (–178 to –168) and used the probe in an in vitro DNA-protein binding assay. As shown in Fig. 3AGo, Ang II increased the binding of a nuclear protein to the NF-{kappa}B-like site. The Ang II-stimulated binding to the probe was not present when we added an excess (100-fold) of cold probe (Fig. 3AGo, upper panel, lane 2) or when we added classical NF-{kappa}B consensus oligos (Fig. 3AGo, upper panel, lane 3). However, an excess (100-fold) of unrelated activator protein-1 cold probe did not affect binding (Fig. 3AGo, bottom panel).


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
FIG. 3. Ang II induces NF-{kappa}B binding to putative NF-{kappa}B-like sites of the IGF-IR promoter. A, EMSA: Ang II induces NF-{kappa}B binding to IGF-IR promoter. EMSAs were performed using P32-labeled probes from the putative NF-{kappa}B binding site. We added 100-fold excess of the following cold competitors: 1) the NF-{kappa}B-like binding site from IGF-IR; 2) a classical, consensus NF-{kappa}B binding site (upper panel); or 3) an unrelated activator protein-1 (AP1; bottom panel). B, Supershift assay: VSMCs were treated with Ang II for 30 min. Supershift was performed using 1 µg of anti p50 of NF-{kappa}B or control, IgG in the EMSA complex containing 32P-labeled probes from the putative NF-{kappa}B binding site. Antibody-mediated supershift band is indicated. C, CHIP assay: Ang II treatment leads to NF-{kappa}B binding to the IGF-IR promoter. VSMCs were treated with Ang II for the times indicated and CHIP assays were performed with antibodies recognizing p50, p65, and phospho-p65. PCR amplification of the sites was obtained using the IGF-IR promoter-specific primers. Shown is a representative gel exhibiting NF-{kappa}B binding to chromatin contained in the IGF-IR promoter. SF, Serum free.

 
To prove that Ang II increases NF-{kappa}B binding to the NF-{kappa}B-like site in the IGF-IR promoter, we did both supershift and CHIP assay. As shown in Fig. 3BGo, Ang II-induced binding to IGF-IR promoter could be shifted by anti-p50 of NF-{kappa}B. Moreover, VSMCs were treated with Ang II and chromatin was immunoprecipitated with anti p50, anti-p65, or anti-phospho-p65 of NF-{kappa}B and followed by PCR amplification of the 130-bp promoter region of IGF-IR. We found that p50 and p65 bound to the IGF-IR promoter within 45 min of treating VSMCs with Ang II (Fig. 3CGo). Phospho-p65 binding to the IGF-IR promoter occurred as early as 15 min. These results indicate that p65 binds to the transcription site in the IGF-IR promoter and hence could be involved in Ang II-stimulation of IGF-IR transcriptional activity.

Ras/MEK1 and IKK mediate Ang II-stimulated transcriptional expression of IGF-IR
Recently we showed that Ang II increases phosphorylation of p65 of NF-{kappa}B and its transcriptional activity by both the Ras/MEK1/RSK and IKK pathways (27). To determine whether the Ras/MEK1 or IKK pathways are upstream signals that activate NF-{kappa}B to regulate IGF-IR transcription in VSMCs, we transfected VSMCs with the IGF-IR promoter reporter construct, p(–476/+21-Luc). The cells were then infected with a recombinant adenovirus expressing a dominant-negative form of IKK (Ad.IKKßKA) or Ras (Ad.RasY57) or MEK1(Ad.MEK1DN). As shown in Fig. 4AGo, the expression of a dominant-negative Ras or MEK1 almost completely blocked the ability of Ang II to stimulate IGF-IR promoter-luciferase activity (vs. control results obtained with infection of an adenovirus expressing ß-galactosidase. Likewise, expression of the dominant-negative IKKß suppressed IGF-IR promoter activity 61% (P < 0.05). As a positive control for NF-{kappa}B activity, we infected VSMCs with adenoviruses expressing dominant-negative IKKß, Ras, or MEK1. VSMCs were then treated with Ang II and NF-{kappa}B promoter activity was sharply reduced (Fig. 4BGo). Note that Ang II induced a greater increase in NF-{kappa}B expression, compared with that of IGF1-IR promoter activity. These results indicate that Ang II regulates transcription of IGF-IR by Ras/MEK1- and IKK-dependent pathways. To evaluate whether inhibition of signaling pathways activated by Ang II will not only decrease the transcription of the IGF-IR gene but also reduce the expression of IGF-IR, we expressed dominant-negative MEK1, Ras, or IKKß in VSMCs. Blocking these pathways inhibited Ang II-induced increase in IGF-IR protein (Fig. 4Go, C and D).


Figure 4
View larger version (28K):
[in this window]
[in a new window]
 
FIG. 4. Ras/MEK1 and IKK are signal proteins that mediate the ability of Ang II to stimulate transcriptional expression of IGF-IR. A, Different adenoviruses containing dominant-negative Ras, MEK, or IKKß were found to block Ang II-induced IGF-IR promoter activity. VSMCs were transfected with IGF-IR promoter, p(–476/+640-Luc), and infected with one of the dominant-negative adenoviruses before being treated with/without Ang II for 6 h. The IGF-IR promoter-luciferase activity was expressed as fold changes, compared with infection of the adenovirus expressing ß-galactosidase (Ad.ß-gal) virus. *, P < 0.01 (n = 4). B, Dominant-negative Ras, MEK, or IKK blocks Ang II-induced classic NF-{kappa}B promoter activity. The experiments were similar to Fig. 4AGo; Ang II-induced IGF-IR protein expression is blocked by the presence of the Ras Y57, IKKßKA (C), or MEK1DN (D) inhibitor. VSMCs were infected with dominant-negative adenoviruses as indicated and treated with/without Ang II for 24 h. Western blots of the cell lysate was used to detect IGF-IR. The bands were normalized for ß-actin, and the percentage increase of Ang II treatment over serum free was indicated on bottom panel. *, P < 0.01 (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The expression of IGF-IR in VSMCs plays an important role in the survival, proliferation, and migration of VSMCs, processes that characterizes vascular remodeling. Because these same processes are stimulated by Ang II, we studied the signaling mechanisms that could link Ang II to expression of the IGF-IR. We determined that Ang II stimulates an interaction between NF-{kappa}B and the IGF-IR promoter and that two pathways, Ras/MEK1 and IKK, mediate the transcription of the IGF-IR. This is relevant because the expression of IGF-IR is primarily determined at the transcriptional level, and Ang II increases IGF-IR expression in both cultured VSMCs and the arteries of animals (Fig. 1Go, A and C).

Ang II stimulated promoter activity of the –476/+640 fragment to a much larger extent than the –476/+21 fragment, Giraud et al. (32) have shown that 5'-untranslated region of the IGF-IR (+21 to +640) increase translation by an internal initiation mechanism. This mechanism is responsible for the greater luciferase activity of the –476/+640 promoter fragment, compared with the –476/+21 promoter fragment. However, when we compared the promoter activity of the –476/+640 fragment with that of the –270/+21 fragment, Ang II induced a similar degree of activation (2.6 ± 0.3-fold vs. 2.8 ± 0.25-fold, P > 0.05). The smaller induction of IGF-IR promoter activity by Ang II in the –476/+21 and –416/+21 relative to –270/+21 is the result of negative regulatory elements. Idelman et al. (33) showed that the –476/+640 of IGF-IR promoter is negatively regulated by a number of transcription factors, including the Wilms’ tumor 1 and p53 tumor suppressors. Using a promoter-deletion analysis, we found a cis element for the Ang II response located between –270 and –135 nt of the IGF-IR promoter (Fig. 2AGo). Additional evidence was obtained by showing that mutation of the NF-{kappa}B like site at –178/–168 and –205/–195 nt of the IGF-IR promoter blocked the transcriptional response in cells exposed to Ang II (Fig. 2CGo). We performed a sequence alignment between human and rats and found three NF-{kappa}B-like sequences in the human IGF-IR promoter region, located at –97 to –87; –158 to –145; and –191 to –180. There were 80, 80, and 60% similarities, respectively, with our analysis of promoter regions in the rat gene that could interact with NF-{kappa}B.

The binding of NF-{kappa}B to the IGF-IR promoter was investigated in depth using a supershift and CHIP assay: we found a NF-{kappa}B-IGF-IR DNA complex using this assay. An antibody against p50 of NF-{kappa}B shifted the binding complex (Fig. 3BGo). Moreover, antibodies recognizing p65, p50, and phospho-p65 of NF-{kappa}B pulled down an IGF-IR promoter fragment, indicating NF-{kappa}B binding was occurring in nuclei of Ang II-treated VSMCs (Fig. 3CGo). Notably, peak binding of phospho-p65 to the IGF-IR promoter occurred as early as 15 min, and subsequently phosphor p65 is replaced by nonphosphorylated p65 and p50. The latter NF-{kappa}B in binding reaches a second peak after 40 min (Fig. 3CGo). The results are consistent with those reported by Gao et al. (34), who found a dynamic change in NF-{kappa}B binding to inhibitory-{kappa}B promoter after TNF{alpha} treatment of HEK293 cells. These dynamic changes in promoter binding change the transcriptional activity in these cells. The mechanism underlying the biphasic changes in binding patterns has not been identified.

Identifying how Ang II stimulates the binding of phosphorylated p65 or p65/p50 to IGF-IR promoter and activates IGF-IR transcription is an important step in understanding the signaling pathway by which Ang II stimulates transcription of IGF-IR. Previously we showed that Ang II increases the expression of IGF-IR via a redox and a protein tyrosine kinase-dependent signaling pathway that is independent of protein kinase C (18). Recently we found that both the activated Ras/MEK1/RSK and IKK pathway can stimulate phosphorylation of p65 to activate NF-{kappa}B (26, 27). Thus, there are two pathways capable of producing maximal NF-{kappa}B-mediated responses. In the present study, we found that inhibition of Ras/MEK1 or IKK in VSMCs not only blocks Ang II-induced NF-{kappa}B promoter activity but also inhibits Ang II-induced transcription of IGF-IR (Fig. 4Go, A, C, and D). Note that inhibition of Ras/MEK1 causes different responses in terms of Ang II-induced transcription. First, it reduces Ang II-stimulated IGF-IR transcription by 85%. Second, it suppresses Ang II-induced transcription of the downstream mediator, NF-{kappa}B, but by only 70% (Fig. 4BGo). These results suggest that the Ras/MEK1 pathway must stimulate other downstream transcription factors that regulates IGF-IR transcription other than NF-{kappa}B. Werner et al. (21) reported that the transcription factor Sp1 is involved in IGF-IR transcription. Because MEk1 can regulate Sp1, our results highlight the complexity of transcriptional regulation of IGF-IR.

In summary, we have demonstrated that Ang II induces expression of IGF-IR through activation of the transcription factor NF-{kappa}B. The pathways that regulate NF-{kappa}B activity, Ras/MEK1 and IKK, are involved in initiating transcription of the IGF-IR gene and protein expression. These results could provide targets for strategies directed at preventing vascular remodeling.


    Acknowledgments
 
We are indebted to Dr. W. E. Mitch for helpful discussions and critical reading of this manuscript.


    Footnotes
 
This work was supported by the National Institutes of Health Grants RO1 HL 70762, HL 70241, and 1P50-DK064233 and a Scientist Development grant from the American Heart Association.

First Published Online December 1, 2005

1 Y.M., L.Z., and T.P. contributed equally to this work. Back

Abbreviations: Ang II, Angiotensin II; CHIP, chromatin immunoprecipitation assay; IGF-IR, IGF-I receptor; IKK, inhibitory-{kappa}B kinase; MEK1, MAPK kinase-1; NF-{kappa}B, nuclear factor-{kappa}B; RSK, p90 ribosomal S6 kinase; Sp1, specificity protein-1; VSMC, vascular smooth muscle cells.

Received July 15, 2005.

Accepted for publication November 21, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Touyz RM 2005 Molecular and cellular mechanisms in vascular injury in hypertension: role of angiotensin II. Curr Opin Nephrol Hypertens 14:125–131[Medline]
  2. Huggins CE, Domenighetti AA, Pedrazzini T, Pepe S, Delbridge LM 2003 Elevated intracardiac angiotensin II leads to cardiac hypertrophy and mechanical dysfunction in normotensive mice. J Renin Angiotensin Aldosterone Syst 4:186–190[Medline]
  3. Baker KM, Chernin MI, Schreiber T, Sanghi S, Haiderzaidi S, Booz GW, Dostal DE, Kumar R 2004 Evidence of a novel intracrine mechanism in angiotensin II-induced cardiac hypertrophy. Regul Pept 120:5–13[CrossRef][Medline]
  4. Schiffrin EL, Park JB, Intengan HD, Touyz RM 2000 Correction of arterial structure and endothelial dysfunction in human essential hypertension by the angiotensin receptor antagonist losartan. Circulation 101:1653–1659[Abstract/Free Full Text]
  5. Gibbons GH, Pratt RE, Dzau VJ 1992 Vascular smooth muscle cell hypertrophy vs. hyperplasia. Autocrine transforming growth factor-ß1 expression determines growth response to angiotensin II. J Clin Invest 90:456–461[Medline]
  6. Ferns GA, Raines EW, Sprugel KH, Motani AS, Reidy MA, Ross R 1991 Inhibition of neointimal smooth muscle accumulation after angioplasty by an antibody to PDGF. Science 253:1129–1132[Abstract/Free Full Text]
  7. Chen K, Mehta JL, Li D, Joseph L, Joseph J 2004 Transforming growth factor ß receptor endoglin is expressed in cardiac fibroblasts and modulates profibrogenic actions of angiotensin II. Circ Res 95:1167–1173[Abstract/Free Full Text]
  8. Erman A, Veksler S, Gafter U, Boner G, Wittenberg C, van Dijk DJ 2004 Renin-angiotensin system blockade prevents the increase in plasma transforming growth factor ß1, and reduces proteinuria and kidney hypertrophy in the streptozotocin-diabetic rat. J Renin Angiotensin Aldosterone Syst 5:146–151[Medline]
  9. Stouffer GA, Owens GK 1992 Angiotensin II-induced mitogenesis of spontaneously hypertensive rat-derived cultured smooth muscle cells is dependent on autocrine production of transforming growth factor-ß. Circ Res 70:820–828[Abstract/Free Full Text]
  10. Delafontaine P, Meng XP, Ku L, Du J 1995 Regulation of vascular smooth muscle cell insulin-like growth factor I receptors by phosphorothioate oligonucleotides. Effects on cell growth and evidence that sense targeting at the ATG site increases receptor expression. J Biol Chem 270:14383–14388[Abstract/Free Full Text]
  11. Du J, Peng T, Scheidegger KJ, Delafontaine P 1999 Angiotensin II activation of insulin-like growth factor 1 receptor transcription is mediated by a tyrosine kinase-dependent redox-sensitive mechanism. Arterioscler Thromb Vasc Biol 19:2119–2126[Abstract/Free Full Text]
  12. Du J, Delafontaine P 1995 Inhibition of vascular smooth muscle cell growth through antisense transcription of a rat insulin-like growth factor I receptor cDNA. Circ Res 76:963–972[Abstract/Free Full Text]
  13. Baserga R, Sell C, Porcu P, Rubini M 1994 The role of the IGF-I receptor in the growth and transformation of mammalian cells. Cell Prolif 27:63–71[Medline]
  14. Sell C, Dumenil G, Deveaud C, Miura M, Coppola D, DeAngelis T, Rubin R, Efstratiadis A, Baserga R 1994 Effect of a null mutation of the insulin-like growth factor I receptor gene on growth and transformation of mouse embryo fibroblasts. Mol Cell Biol 14:3604–3612[Abstract/Free Full Text]
  15. Liu JP, Baker J, Perkins AS, Robertson EJ, Efstratiadis A 1993 Mice carrying null mutations of the genes encoding insulin-like growth factor I (IGF-I) and type 1 IGF receptor (Igf1r). Cell 75:59–72[Medline]
  16. Duan C 2003 The chemotactic and mitogenic responses of vascular smooth muscle cells to insulin-like growth factor-I require the activation of ERK1/2. Mol Cell Endocrinol 206:75–83[CrossRef][Medline]
  17. Gockerman A, Prevette T, Jones JI, Clemmons DR 1995 Insulin-like growth factor (IGF)-binding proteins inhibit the smooth muscle cell migration responses to IGF-I and IGF-II. Endocrinology 136:4168–4173[Abstract]
  18. Du J, Meng XP, Delafontaine P 1996 Transcriptional regulation of the insulin-like growth factor-I receptor gene: evidence for protein kinase C-dependent and -independent pathways. Endocrinology 137:1378–1384[Abstract]
  19. Scheidegger KJ, Du J, Delafontaine P 1999 Distinct and common pathways in the regulation of insulin-like growth factor-1 receptor gene expression by angiotensin II and basic fibroblast growth factor. J Biol Chem 274:3522–3530[Abstract/Free Full Text]
  20. Werner H, Stannard B, Bach MA, LeRoith D, Roberts Jr CT 1990 Cloning and characterization of the proximal promoter region of the rat insulin-like growth factor I (IGF-I) receptor gene. Biochem Biophys Res Commun 169:1021–1027[CrossRef][Medline]
  21. Werner H, Bach MA, Stannard B, Roberts Jr CT, LeRoith D 1992 Structural and functional analysis of the insulin-like growth factor I receptor gene promoter. Mol Endocrinol 6:1545–1558[Abstract]
  22. Cooke DW, Bankert LA, Roberts Jr CT, LeRoith D, Casella SJ 1991 Analysis of the human type I insulin-like growth factor receptor promoter region. Biochem Biophys Res Commun 177:1113–1120[CrossRef][Medline]
  23. Mamula PW, Goldfine ID 1992 Cloning and characterization of the human insulin-like growth factor-I receptor gene 5'-flanking region. DNA Cell Biol 11:43–50[Medline]
  24. Werner H, Rauscher 3rd FJ, Sukhatme VP, Drummond IA, Roberts Jr CT, LeRoith D 1994 Transcriptional repression of the insulin-like growth factor I receptor (IGF-I-R) gene by the tumor suppressor WT1 involves binding to sequences both upstream and downstream of the IGF-I-R gene transcription start site. J Biol Chem 269:12577–12582[Abstract/Free Full Text]
  25. Ohlsson C, Kley N, Werner H, LeRoith D 1998 p53 regulates insulin-like growth factor-I (IGF-I) receptor expression and IGF-I-induced tyrosine phosphorylation in an osteosarcoma cell line: interaction between p53 and Sp1. Endocrinology 139:1101–1107[Abstract/Free Full Text]
  26. Zhang L, Ma Y, Zhang J, Cheng J, Du J 2005 A new cellular signaling mechanism for angiotensin II activation of NF-{kappa}B: an I{kappa}B-independent, RSK-mediated phosphorylation of p65. Arterioscler Thromb Vasc Biol 25:1148–1153[Abstract/Free Full Text]
  27. Zhang L, Cheng J, Ma Y, Thomas W, Zhang J, Du J 2005 Dual pathways for nuclear factor {kappa}B activation by angiotensin II in vascular smooth muscle: phosphorylation of p65 by I{kappa}B kinase and ribosomal kinase. Circ Res 97:975–982[Abstract/Free Full Text]
  28. Zhang L, Cui R, Cheng X, Du J 2005 Antiapoptotic effect of serum and glucocorticoid-inducible protein kinase is mediated by novel mechanism activating I{{kappa}}B kinase. Cancer Res 65:457–464[Abstract/Free Full Text]
  29. Lassegue B, Alexander RW, Clark M, Griendling KK 1991 Angiotensin II-induced phosphatidylcholine hydrolysis in cultured vascular smooth-muscle cells. Regulation and localization. Biochem J 276(Pt 1):19–25
  30. Urban MB, Baeuerle PA 1991 The role of the p50 and p65 subunits of NF-{kappa}B in the recognition of cognate sequences. New Biol 3:279–288[Medline]
  31. Urban MB, Schreck R, Baeuerle PA 1991 NF-{kappa}B contacts DNA by a heterodimer of the p50 and p65 subunit. EMBO J 10:1817–1825[Medline]
  32. Giraud S, Greco A, Brink M, Diaz JJ, Delafontaine P 2001 Translation initiation of the insulin-like growth factor I receptor mRNA is mediated by an internal ribosome entry site. J Biol Chem 276:5668–5675[Abstract/Free Full Text]
  33. Idelman G, Glaser T, Roberts Jr CT, Werner H 2003 WT1–p53 interactions in insulin-like growth factor-I receptor gene regulation. J Biol Chem 278:3474–3482[Abstract/Free Full Text]
  34. Gao Z, Chiao P, Zhang X, Zhang X, Lazar MA, Seto E, Young HA, Ye J2005 Coactivators and corepressors of NF-{kappa}B in I{kappa}B{alpha} gene promoter. J Biol Chem 280:21091–21098



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. M. Kavurma, M. Schoppet, Y. V. Bobryshev, L. M. Khachigian, and M. R. Bennett
TRAIL Stimulates Proliferation of Vascular Smooth Muscle Cells via Activation of NF-{kappa}B and Induction of Insulin-like Growth Factor-1 Receptor
J. Biol. Chem., March 21, 2008; 283(12): 7754 - 7762.
[Abstract] [Full Text] [PDF]


Home page
Cardiovasc ResHome page
R. M. Bell, J. E. Clark, D. J. Hearse, and M. J. Shattock
Reperfusion kinase phosphorylation is essential but not sufficient in the mediation of pharmacological preconditioning: Characterisation in the bi-phasic profile of early and late protection
Cardiovasc Res, January 1, 2007; 73(1): 153 - 163.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/3/1256    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ma, Y.
Right arrow Articles by Du, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ma, Y.
Right arrow Articles by Du, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals