help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-0782
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/3/1452    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwasaki, T.
Right arrow Articles by Koibuchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwasaki, T.
Right arrow Articles by Koibuchi, N.
Endocrinology Vol. 147, No. 3 1452-1457
Copyright © 2006 by The Endocrine Society

The Interaction of TRß1-N Terminus with Steroid Receptor Coactivator-1 (SRC-1) Serves a Full Transcriptional Activation Function of SRC-1

Toshiharu Iwasaki, Akira Takeshita, Wataru Miyazaki, William W. Chin and Noriyuki Koibuchi

Department of Integrative Physiology (T.I., W.M., N.K.), Gunma University Graduate School of Medicine, Maebashi, Gunma 371-8511, Japan; Core Research for Evolutional Science and Technology (CREST) (T.I., W.M., N.K.), Japan Science and Technology Corporation (J.S.T.), Kawaguchi, Saitama 332-0012, Japan; Brigham and Women’s Hospital and Harvard Medical School (T.I., A.T., W.W.C., N.K.), Boston, Massachusetts 02115; and Division of Endocrinology and Metabolism (A.T.), Toranomon Hospital, Okinaka Memorial Institute for Medical Research, Tokyo 105-8470, Japan

Address all correspondence and requests for reprints to: Toshiharu Iwasaki, M.D., Ph.D., Department of Integrative Physiology, Gunma University Graduate School of Medicine, 3-39-22 Showa-machi, Maebashi 371-8511, Gunma, Japan. E-mail: tiwasaki{at}med.gunma-u.ac.jp.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Steroid receptor coactivator-1 (SRC-1) plays a crucial role in nuclear receptor-mediated transcription including thyroid hormone receptor (TR)-dependent gene expression. Interaction of the TR-ligand binding domain and SRC-1 through LXXLL motifs is required for this action. However, potential interactions between the TRß1-N terminus (N) and SRC-1 have not been explored and thus are examined in this manuscript. Far-Western studies showed that protein construct containing TRß1-N + DNA binding domain (DBD) bound to nuclear receptor binding domain (NBD)-1 (amino acid residue, aa 595–780) of SRC-1 without ligand. Mammalian two-hybrid studies showed that NBD-1, as well as SRC-1 (aa 595-1440), bound to TRß1-N+DBD in the absence of ligand in CV-1 cells. However, NBD-2 (aa 1237–1440) did not bind to this protein. Glutathione-S-transferase pull-down studies showed that TRß1-N (aa 1–105) bound to the broad region of SRC-1-C terminus. Expression vectors encoding a series of truncations and/or point mutations of TRß1 were used in transient transfection-based reporter assays in CV-1 cells. N-terminal truncated TRß1 ({Delta}N-TRß1) showed lower activity than that of wild-type in both artificial F2-thyroid hormone response element and native malic enzyme response element. These results suggest that there is the interaction between N terminus of TRß1 and SRC-1, which may serve a full activation of SRC-1, together with activation function-2 on TRß1-mediated transcription.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE NUCLEAR HORMONE receptors (NRs) are transcription factors that regulate target gene transcription in response to ligands such as steroid and thyroid hormones (THs) (1, 2). The DNA binding domain (DBD) of NR binds to the cognate hormone response element, located in the promoter regions of target genes. One of these, TH receptor (TR) belongs to type II nuclear hormone receptors that form heterodimers with retinoid X receptor (3, 4, 5).

At least three functional isoforms of TR (TR{alpha}1, ß1, and ß2) have been reported to be expressed in mammalian cells at protein level (3, 4, 5). These TRs are highly similar within their DNA binding, hinge, and ligand binding domains (LBDs), but are divergent in their amino-terminal regions (3, 4, 5). These forms are expressed in distinct developmental- and tissue-specific manners, suggesting that they may possess unique functional properties (2).

In mammalian cells, TH binding to TR results in dissociation of corepressor complexes followed by recruitment of coactivator complexes to activate transcription. Functional analyses of NRs have shown that there are two major activation domains: activation function (AF)-1 and AF-2 (3, 4). The extreme C-terminal region of the LBD (AF-2) exhibits ligand-dependent transactivation. AF-2 interacts with coactivators, such as SRC-1 (6, 7), in a ligand-dependent manner (1, 8, 9). Members of SRC-1 family (1, 8, 10, 11, 12, 13), cAMP response element binding protein-binding protein (CBP) (1, 8, 14) and p300/CBP-associated factor (1, 8, 15), and participate in a protein complex on AF-2 possess intrinsic histone acetyltransferase activity. These cofactors may remodel chromatin structure, allowing the efficient access of basal transcriptional machinery to DNA (1). In addition to these coactivators, several other proteins, such as coactivator-associated arginine methyltransferase-1 (16) and TR binding protein (17)—this is also named as AIB3/ASC-2/RAP250/PRIP/NRC (18, 19, 20, 21, 22)—are involved in this complex and contribute to the precise transcriptional regulation.

On the other hand, the AF-1 region, located within the N-terminal region, contains a ligand-independent activation function (23, 24). The potency of the AF-1 transactivation domain varies widely, depending on the cell and promoter context (25, 26, 27, 28). The AF-1 domain of TRß1 is represented by 19 amino acids located between residues 69 and 89 (29). Unlike the AF-2 domain, this AF-1 domain is not homologous to those of TR{alpha}1, TRß2, or the other steroid hormone receptors (27). This observation suggests that the AF-2 domain may evolutionarily represent the primary transactivation domain of TR, whereas the AF-1 domain, with differences in diverse sequences in the amino termini, may provide the molecular basis for differential activities of different TR isoforms to allow unique promoter- or cell-specific actions. Thus, in the present study, to examine the role of the TRß1-N terminus on SRC-1-mediated transactivation, we investigated the binding between TRß1-N terminus and SRC-1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Plasmids
cDNAs encoding glutathione-S-transferase (GST)-fusion proteins including the LBD of the rat TRß1 (aa 174–461) has been described previously (7). GST-TRß1-N terminus + DBD (aa 1–174), GST-TRß1-N terminus (N) (aa 1–105), GST-TRß1 (aa 1–54), GST-TRß1 (aa 55–105), and GST-TRß1-DBD (aa 106–174) were constructed by inserting the PCR-amplified fragments from TRß1 into the EcoRI and HindIII sites of pGEX-4T-1 (Amersham Biosciences, Buckinghamshire, UK). GST-SRC-1-NR binding domain (NBD)-1 was constructed by inserting PCR-generated fragments of SRC-1 (7) (residues aa 595–780) into the GST plasmid (30), as described previously (31). Expression vectors TRß1, TRß1-AF2 (E457A) (glutamate at aa 457 was replaced to alanine, AF-2 mutant), N terminus (aa 1–105)-deleted TRß1 ({Delta}N-TRß1) and {Delta}N-TRß1-AF2 (E457A) were constructed by inserting the PCR-amplified fragments from TRß1 or TRß1-AF2 (E457A) (31) into the EcoRI and HindIII sites of pBK/CMV (Stratagene, La Jolla, CA). Expression vectors encoding SRC-1 (aa 1154–1440) and SRC-1 (aa 595-1440) were constructed by inserting the PCR-generated fragments from human SRC-1 into EcoRI and HindIII sites into pBK/CMV. The luciferase (LUC) reporter constructs, the chick lysozyme thyroid hormone response element (TRE) (F2)-thymidine kinase (TK)-LUC, artificial direct repeat TRE, DR4-TRE-TK-LUC, and malic enzyme (ME) promoter fragment containing three TRE half-sites (GATCCATCCAGGACGTTGGGGTTAGGGGAGGACA GTGGA) in the PT109 vector (ME-LUC) were described previously (31, 32). 5x Upstream activation signal (UAS)-LUC has been described previously (31). Gal4-NBD-1 (aa 595–780), Gal4-NBD-2 (aa 1237–1440), Gal4-NBD- (1 + 2) (aa 595-1440) were constructed by insertion of PCR fragment into EcoRI site of pM (Invitrogen, Carlsbad, CA). VP16 transactivation domain fusion construct VP16-TRß1-N+DBD (aa 1–174) was constructed by insertion of PCR fragment into EcoRI site of pVP16 (Invitrogen).

Far Western blotting
GST-SRC-1 protein was produced in Escherichia coli BL21 (DE3) and purified by gluthathione-Sepharose resin (Amersham Biosciences). Indicated amounts of GST-SRC-1 were spotted on nitrocellulose membrane. The production of the probe was described previously (7). Briefly, after affinity purification of the GST-fused TR construct proteins on glutathione-Sepharose resin, cleavage of the fusion protein by human thrombin (Sigma, St. Louis, MO) was performed. The supernatant containing TR protein was passed through a NICK column (Amersham Biosciences) preequilibrated with the kinase buffer [20 mM Tris (pH 7.5), 100 mM NaCl, 12 mM MgCl2, 5 mM NaF, 2 mM dithiothreitol, 100 µg/ml BSA]. Labeling of these proteins was performed in 100 µl of kinase buffer containing 100 U of the catalytic subunit of protein kinase A from bovine heart (Sigma) and 300 µCi of [{gamma}-32P]-labeled-ATP for 1 h at room temperature. After blocking, [{gamma}-32P]-ATP-labeled TRß1-LBD or TRß1-N+DBD was incubated in the absence or presence of 1 x 10–6 M of T3 for 1 h at room temperature. After extensive washing with cold buffer, the membrane was subjected to autoradiography.

In vitro-translated proteins and GST pull-down assays
The GST and GST-fusion proteins were produced in E. coli BL21 (DE3) and purified. Mutants of SRC-1 in pBK/CMV were transcribed and translated in rabbit reticulocyte lysates (Promega, Madison, WI) with [35S]-methionine according to the manufacturer’s instructions. GST pull-down assays were performed as described previously (31). Briefly, GST-fusion proteins containing wild-type and cognate mutant TRß1 were bound to glutathione-Sepharose beads (Amersham Biosciences). Similar amounts of loading proteins bound to the beads were used, as determined by Coomassie Blue staining/SDS-PAGE analysis. The beads were resuspended in the binding buffer [20 mM HEPES (pH 7.7), 75 mM KCl, 0.1 mM EDTA, 2.5 mM MgCl2, 0.05% Nonidet P-40, 2 mM dithiothreitol, 10% glycerol], and incubated with 5 µl of in vitro-translated, [35S]-labeled proteins in the presence or absence of 1 x 10–6 M of T3 for 1 h at room temperature. Beads were then washed with the binding buffer three times in the presence or absence of the ligands, followed by resuspension in 20 µl of sodium dodecyl sulfate sample buffer, and analysis by SDS-PAGE and autoradiography.

Cell culture and transient transfection assay
CV-1 cells were maintained in DMEM supplemented with 10% TH-free fetal bovine serum and penicillin/streptomycin at 37 C, 5% CO2. Cells were plated in six- or 24-well plates 2 d before transfection. Cells were transfected with the indicated expression and reporter vectors using the calcium phosphate method as described previously (31). Sixteen to 24 h after transfection, cells were refilled with fresh medium containing the indicated concentration of ligand. After 36–48 h, cells were harvested for luciferase activities as described (31). Total amounts of DNA for each well were normalized by adding vector pBK/CMV (STRATAGENE). Data shown represent means of triplicate transfections ± SEs. Statistical analysis was performed using ANOVA, followed by post hoc comparison with Duncan’s multiple range test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TRß1-N+DBD bound to SRC-1 in vitro
To investigate whether TRß1-N+DBD binds to SRC-1, we first performed far-Western studies. Radiolabeled TRß1-N+DBD (aa 1–174) bound to NBD-1 of SRC-1 (aa 595–780) without T3 (Fig. 1Go), whereas it did not bind to GST. In contrast, TRß1-LBD (aa 174–461) did not bind to SRC-1 without T3, whereas it bound to SRC-1 with T3 as expected. These results suggest that SRC-1 binds to TRß1-N or DBD in a ligand-independent manner.


Figure 1
View larger version (34K):
[in this window]
[in a new window]
 
FIG. 1. In vitro binding of TRß1-N terminus + DBD and SRC-1 in the absence of ligand in far-Western studies. Indicated amount of GST or GST-SRC-1-NBD-1 (aa 595–780) was spotted on nitrocellulose membrane followed by incubation with [{gamma}-32P]-ATP-labeled-TRß1-N+DBD (aa 1–174). Numbers indicated amounts of spotted proteins.

 
TRß1-N+DBD bound to SRC-1 in vivo
To confirm in vivo interaction of TR-N+DBD and SRC-1, we constructed a series of Gal4-SRC-1 and VP16-TRß1-N+DBD constructs as shown in Fig. 2AGo. VP16 did not influence the transcription when Gal4-NBD-1, NBD-2, or NBD-(1 + 2) was cotransfected with 5xUAS-LUC. On the other hand, VP16-TRß1-N+DBD activated the transcription when Gal4-NBD-1 or NBD- (1 + 2) was transfected (Fig. 2BGo). When Gal4-NBD-2 was transfected, the transcription was not significantly activated (Fig. 2BGo). These results suggest that TRß1-N+DBD binds to SRC-1 in the absence of ligand in vivo.


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. In vivo interaction of TR-N terminus and SRC-1 in the absence of ligand. A, Gal4-SRC-1 and VP16-TRß1 constructs used in the present study. B, Expression vectors encoded Gal4-DBD-SRC-1 (0.05 µg) were cotranfected with VP16-TRß1 (0.3 µg) and 5xUAS-LUC (0.1 µg) into CV-1 cells. Cells were grown in the absence or presence of 10–7 M of T3. Data represent mean ± SE of experiments performed in triplicate. *, Statistically significant (P < 0.01 by ANOVA VS Gal4-NBD-1, -2, -(1 + 2), and VP16 columns).

 
TRß1-N terminus binds to SRC-1 in vitro
Next, we constructed a series of truncation mutants of TRß1 and SRC-1, shown in Fig. 3Go, A and B, and examined which region(s) of TRß1 bind(s) to SRC-1, using GST pull-down assays. We also investigated which region(s) of SRC-1 bind(s) to TRß1. TRß1-LBD (aa 174–461) has been shown to interact with two nuclear receptor-binding domains (NBDs) in a ligand-dependent manner (31). As predicted by far-Western studies, the TRß1-N (aa 1–105) bound to the SRC-1 at residue aa 595-1440. (Fig. 3BGo). On the other hand, TRß1-DBD did not bind to SRC-1 (aa 595-1440), suggesting that the major binding surface to SRC-1 may be N terminus, not DBD, in the absence of T3. The deletion of either aa 1–54 or aa 55–105 region result in reduction of binding to SRC-1 (aa 595-1440), suggesting that relatively broad region of N terminus may contribute the binding to SRC-1. SRC-1 (aa 1154–1440), which is corresponding to NBD-2, did not bind to either TRß1-N or DBD. These results indicate that SRC-1 (aa 1154–1440) is insufficient for binding, and that aa 595-1440 does bind to TRß1-N (aa 1–105).


Figure 3
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 3. N terminus of TRß1 (aa 1–105) interacts with broad range of SRC-1-C terminus in vitro in the absence of ligand. A, GST-TRß1 constructs used in the present study. B, SRC-1 fragments used in vitro translation are shown on the left panel. A series of GST-fused-TRß1 (aa 1–105, 1–54, 55–105, 106–174, and 174–461) were incubated with in vitro-translated [35S]-methionine-labeled SRC-1 fragments (aa 595-1440 and 1154–1440) in the presence or absence of ligand.

 
TRß1-N terminus is required for the full activation function of SRC-1-mediated transcription on both artificial TREs and native ME response element
Next, we made a series of truncation and/or point mutants of TRß1 (Fig. 4AGo) to investigate the contribution of the TRß1-N terminus on SRC-1-mediated transcription on F2-TRE in CV-1 cells. To investigate the effect of the binding between N terminus of TRß1 and SRC-1 on the native response element, we used ME promoter fragment containing three half-sites of TREs. This fragment was inserted into PT109 vector containing TK minimum promoter at N terminus of luciferase gene (ME-LUC). Without transfecting SRC-1, significant differences were observed in the magnitude of T3-activated transcription between wild-type and {Delta}N-TRß1 on both F2-TRE-LUC and ME-LUC (Fig. 4BGo). These results suggest that a little amount of intrinsic SRC-1 may contribute to the activation of transcription. When SRC-1 was cotransfected, {Delta}N-TRß1 showed lower activity than that of wild-type TRß1 in the presence of T3; however, no significant difference was observed without T3 (Fig. 4CGo). The magnitude of SRC-1 activated transcription of constructs were wild-type> {Delta}N (77.3%; ratio of wild-type and {Delta}N-TRß1 interacting with SRC-1 in the presence of T3) > AF2 (E457A) (37.2%) > {Delta}N-AF2 (E457A) (30.4%). {Delta}N-TRß1-AF2 (E457A) showed the lowest activity of the mutants we tested (Fig. 4CGo). Using DR4-TRE-LUC, we obtained similar results (data not shown). In the presence of SRC-1, as on F2-TRE, {Delta}N-TRß1 showed lower activity than that of wild-type on ME fragment (Fig. 4CGo). The difference of activity is greater (47.7% of that of wild type) than that on F2-TRE (77.3%). The activities of the mutants were wild-type> {Delta}N (47.7%; ratio of wild-type and {Delta}N-TRß1 interacting with SRC-1 in the presence of T3) > AF2 (E457A) (37.5%) > {Delta}N-AF2 (E457A) (29.9%). No significant difference was observed between AF2 (E457A) and {Delta}N-AF2 (E457A). Finally, cotransfection of the increasing amount of TRß1 showed similar results (Fig. 4DGo) on F2-TRE, suggesting that this suppression is due to lack of the N terminus. These observations support the idea that the TRß1-N terminus is required for the full activation of SRC-1-mediated transcription on TRE.


Figure 4
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 4. N terminus of TRß1 contributes full activation function of SRC-1 in CV-1 cells. A, Truncated and point mutants of TRß1 used in the present study. B, Expression vectors encoding either wild-type or {Delta}N-TRß1 (0.1 µg) were cotransfected with F2-TRE-LUC (1.7 µg) or ME-LUC into CV-1 cells. Cells were grown in the absence or presence of 10–7 M of T3. Total amounts of DNA for each well were balanced by adding vector pBK/CMV. Data represent mean ± SE of experiments performed in triplicate. *, Statistically significant (P < 0.01 by ANOVA). C, Expression vectors encoding either wild-type or mutants of TRß1 (0.1 µg) and SRC-1 (1.5 µg) were cotransfected with F2-TRE-LUC (1.7 µg) or ME-LUC into CV-1 cells. Cells were grown in the absence or presence of 10–7 M of T3. Total amounts of DNA for each well were balanced by adding vector pBK/CMV. Data represent mean ± SE of experiments performed in triplicate. *, Statistically significant (P < 0.01 by ANOVA). D, Indicated amount of expression vectors encoding wild-type TRß1 or {Delta}N-TRß1 and SRC-1 (0.15 µg) were cotransfected with F2-TRE-LUC (0.1 µg) reporter plasmid into CV-1 cells. Cells were grown in the absence or presence of 10–7 M of T3. Total amounts of DNA for each well were balanced by adding vector pBK/CMV. Data represent mean ± SE of experiments performed in triplicate. *, Statistically significant (P < 0.01 by ANOVA vs. TRß1 (+), SRC-1 (+), T3 (+) columns).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the present study, we show that the TRß1-N terminus (aa 1–105) binds to a region of SRC-1 (aa 595-1440), and this binding may permit the full activity of SRC-1 on TRß1-mediated transcription in the presence of ligand.

Several investigators have previously demonstrated the interaction between N termini of NRs and SRC-1. For instance, progesterone receptor-N terminus synergistically interacts with SRC-1 with progesterone receptor-LBD (33). Recent data also detail the enhancement of androgen receptor AF-1 activities by SRC-1 (34, 35). Thus, the activity of an NR cannot be viewed in the context of the AF-2 domain alone because the AF-1 domain may influence AF-2 function either through allosteric effects, or recruitment of other nuclear factors independently. In case of TRs, it has also been reported that TRß2 binds to SRC-1 through its N terminus (36), and this binding promotes a greater activity than that seen with the other TRs in the absence of ligand (36). The present study shows that TRß1-N terminus may also play an important role in SRC-1-mediated transactivation.

In the present study, we have demonstrated that the TRß1-N+DBD bound to SRC-1-NBD-1 (aa 595–780) in the absence of T3 in far-Western studies (Fig. 1Go). In mammalian two-hybrid studies, we showed the binding of TRß1-N+DBD to SRC-1-NBD-1 (aa 595–780) and NBD-(1 + 2) (aa 595-1440), but not to NBD-2 (aa 1237–1440) (Fig. 2Go). We further investigated the main binding site of the interaction between TRß1-N terminus and SRC-1 using GST-pull-down studies (Fig. 3Go). The TRß1-N terminus (aa 1–105) but not DBD mainly bound to the SRC-1 (aa 595-1440). On the other hand, TRß1-N (aa 55–105) containing previously mapped AF-1 domain of TRß1 (aa 69–89) (29), only very weakly bound to SRC-1 (aa 595-1440) (Fig. 3BGo). These results suggest that a broad range of N terminus of TRß1 may contribute to the binding to SRC-1. On the other hand, SRC-1 (aa 1154–1440), which is corresponding to NBD-2, did not bind to either TRß1-N terminus or -DBD, suggesting that SRC-1 (aa 1154–1440) is insufficient for binding, and that aa 595-1440 does bind to TRß1-N terminus. This result is compatible to the mammalian two-hybrid studies. Therefore, we concluded that TRß1-N terminus (aa 1–105) binds to relatively broad region of SRC-1.

Although our binding studies have shown the interaction between TRß1-N terminus and SRC-1, SRC-1-mediated transcriptional activation in the presence of ligand was only modestly reduced with {Delta}N-TRß1. This indicates that binding between N terminus of TRß1 and SRC-1 may not play dominant roles in activation of TR-mediated transcription in CV-1 cells. Using native ME promoter containing fragment, we observed more efficient reduction by deleting the N terminus of TRß1 (Fig. 4CGo). On the other hand, no significant difference was observed between AF2 (E457A) and {Delta}N-AF2 (E457A) on ME-LUC. Because ME promoter containing fragment contains three TRE half-sites, an additional effect may be involved. Increasing number of TRE half-sites may affect the transcription on different TREs. On the other hand, our results show that TRß1 may be able to recruit both corepressors and coactivators (through the amino terminus) in the absence of ligand. Interaction of SRC-1 at TRß1-N terminus alone may not be able to activate transcription. However, this binding may facilitate binding between AF-2 of TRß1 and SRC-1 by apparently increasing the local concentration of SRC-1 relative to TRß1. Thus, once ligand binds, transcription may be activated to a greater extent in the presence of the N terminus. There are several lines of evidence indicating that AF-2 is not the only region that mediates ligand-dependent activation. First, a number of ligand-dependent TR-interacting proteins do not contain LXXLL motifs (37), which are necessary for TR-AF-2 binding. Second, SRC-1 is able to enhance estrogen-stimulated transcriptional activity of an AF-2 mutant of ER (38). Third, it has been shown that SRC-1 functions as a general integrator like CBP/p300 (39). The apparent cooperativity of the two activation function (AFs) within a single receptor to achieve optimal transcriptional regulation, suggests that the proper assembly of the individual AFs of the TR is required to render the TR-DNA complex transcriptionally fully productive.

In conclusion, coactivators provide, in part, a mechanism by which the separate AFs of the TR collaborate within a transcriptional complex on target DNA elements to lead to full activation of gene expression in the presence of T3.


    Acknowledgments
 
We thank Dr. M. Ikeda for kindly preparing the constructs. We thank M. Ohta for technical assistance throughout the study.


    Footnotes
 
Present address for W.W.C.: Lilly Research Laboratories, Lilly Corporate Center, Indianapolis, Indianapolis 46285.

This work was supported by Grant-in-Aid for Scientific Research 14370020 (to N.K.) and 17510039 (to T.I.) from the Japanese Ministry of Education, Science, Sports and Culture, and a fund from CREST, Japan Science and Technology Corporation (JST) (to N.K.).

First Published Online December 15, 2005

Abbreviations: aa, Amino acid; AF-1, activation function-1; CBP, cAMP response element binding protein-binding protein; DBD, DNA binding domain; GST, gluthathione-S-transferase; LBD, ligand binding domain; LUC, luciferase; ME, malic enzyme; NBD, nuclear receptor binding domain; NR, nuclear receptor; SRC-1, steroid receptor coactivator-1; TH, thyroid hormone; TK, thymidine kinase; TR; thyroid hormone receptor; TRE, thyroid hormone response element; UAS, upstream activation signal.

Received June 28, 2005.

Accepted for publication December 2, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. McKenna NJ, Xu J, Nawaz Z, Tsai SY, Tsai MJ, O’Malley BW 1999 Nuclear receptor coactivators: multiple enzymes, multiple complexes, multiple functions. J Steroid Biochem Mol Biol 69:3–12[CrossRef][Medline]
  2. Oppenheimer JH, Schwartz HL, Mariash CN, Kinlaw WB, Wong NC, Freake HC 1987 Advances in our understanding of thyroid hormone action at the cellular level. Endocr Rev 8:288–308[Medline]
  3. Lazar MA, Chin WW 1990 Nuclear thyroid hormone receptors. J Clin Invest 86:1777–1782
  4. Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184–193[CrossRef][Medline]
  5. Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:1097–1142[Abstract/Free Full Text]
  6. Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1995 Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270:1354–1357[Abstract/Free Full Text]
  7. Takeshita A, Yen PM, Misiti S, Cardona GR, Liu Y, Chin WW 1996 Molecular cloning and properties of a full-length putative thyroid hormone receptor coactivator. Endocrinology 137:3594–3597[Abstract]
  8. Glass CK, Rosenfeld MG 2000 The coregulator exchange in transcriptional functions of nuclear receptors. Genes Dev 14:121–141[Free Full Text]
  9. Wagner RL, Apriletti JW, McGrath ME, West BL, Baxter JD, Fletterick RJ 1995 A structural role for hormone in the thyroid hormone receptor. Nature 378:690–697[CrossRef][Medline]
  10. Spencer TE, Jenster G, Burcin MM, Allis CD, Zhou J, Mizzen CA, McKenna NJ, Onate SA, Tsai SY, Tsai MJ, O’Malley BW 1997 Steroid receptor coactivator-1 is a histone acetyltransferase. Nature 389:194–198[CrossRef][Medline]
  11. Leo C, Chen JD 2000 The SRC family of nuclear receptor coactivators. Gene 245:1–11[CrossRef][Medline]
  12. Chen H, Lin RJ, Schiltz RL, Chakravarti D, Nash A, Nagy L, Privalsky ML, Nakatani Y, Evans RM 1997 Nuclear receptor coactivator ACTR is a novel histone acetyltransferase and forms a multimeric activation complex with P/CAF and CBP/p300. Cell 90:569–580[CrossRef][Medline]
  13. Takeshita A, Cardona GR, Koibuchi N, Suen CS, Chin WW 1997 TRAM-1, a novel 160-kDa thyroid hormone receptor activator molecule, exhibits distinct properties from steroid receptor coactivator-1. J Biol Chem 272:27629–27634[Abstract/Free Full Text]
  14. Ogryzko VV, Schiltz RL, Russanova V, Howard BH, Nakatani Y 1996 The transcriptional coactivators p300 and CBP are histone acetyltransferases. Cell 87:953–959[CrossRef][Medline]
  15. Yang XJ, Ogryzko VV, Nishikawa J, Howard BH, Nakatani Y 1996 A p300/CBP-associated factor that competes with the adenoviral oncoprotein E1A. Nature 382:319–324[CrossRef][Medline]
  16. Chen D, Ma H, Hong H, Koh SS, Huang SM, Schurter BT, Aswad DW, Stallcup MR 1999 Regulation of transcription by a protein methyltransferase. Science 284:2174–2177[Abstract/Free Full Text]
  17. Ko L, Cardona GR, Chin WW 2000 Thyroid hormone receptor-binding protein, an LXXLL motif-containing protein, functions as a general coactivator. Proc Natl Acad Sci USA 97:6212–6217[Abstract/Free Full Text]
  18. Guan XY, Xu J, Anzick SL, Zhang H, Trent JM, Meltzer PS 1996 Hybrid selection of transcribed sequences from microdissected DNA: isolation of genes within amplified region at 20q11–q13.2 in breast cancer. Cancer Res 56:3446–3450[Abstract/Free Full Text]
  19. Lee SK, Anzick SL, Choi JE, Bubendorf L, Guan XY, Jung YK, Kallioniemi OP, Kononen J, Trent JM, Azorsa D, Jhun BH, Cheong JH, Lee YC, Meltzer PS, Lee JW 1999 A nuclear factor, ASC-2, as a cancer-amplified transcriptional coactivator essential for ligand-dependent transactivation by nuclear receptors in vivo. J Biol Chem 274:34283–34293[Abstract/Free Full Text]
  20. Caira F, Antonson P, Pelto-Huikko M, Treuter E, Gustafsson JA 2000 Cloning and characterization of RAP250, a novel nuclear receptor coactivator. J Biol Chem 275:5308–5317[Abstract/Free Full Text]
  21. Zhu Y, Kan L, Qi C, Kanwar YS, Yeldandi AV, Rao MS, Reddy JK 2000 Isolation and characterization of peroxisome proliferator-activated receptor (PPAR) interacting protein (PRIP) as a coactivator for PPAR. J Biol Chem 275:13510–13516[Abstract/Free Full Text]
  22. Mahajan MA, Samuels HH 2000 A new family of nuclear receptor coregulators that integrate nuclear receptor signaling through CREB-binding protein. Mol Cell Biol 20:5048–5063[Abstract/Free Full Text]
  23. Lees JA, Fawell SE, Parker MG 1989 Identification of two transactivation domains in the mouse oestrogen receptor. Nucleic Acids Res 17:5477–5488[Abstract/Free Full Text]
  24. Pham TA, Hwung YP, Santiso-Mere D, McDonnell DP, O’Malley BW 1992 Ligand-dependent and -independent function of the transactivation regions of the human estrogen receptor in yeast. Mol Endocrinol 6:1043–1050[Abstract]
  25. Tzukerman MT, Esty A, Santiso-Mere D, Danielian P, Parker MG, Stein RB, Pike JW, McDonnell DP 1994 Human estrogen receptor transactivational capacity is determined by both cellular and promoter context and mediated by two functionally distinct intramolecular regions. Mol Endocrinol 8:21–30[Abstract]
  26. Hollenberg SM, Evans RM 1988 Multiple and cooperative trans-activation domains of the human glucocorticoid receptor. Cell 55:899–906[CrossRef][Medline]
  27. Tomura H, Lazar J, Phyillaier M, Nikodem VM 1995 The N-terminal region (A/B) of rat thyroid hormone receptors {alpha} 1, ß 1, but not ß 2 contains a strong thyroid hormone-dependent transactivation function. Proc Natl Acad Sci USA 92:5600–5604[Abstract/Free Full Text]
  28. Nagpal S, Saunders M, Kastner P, Durand B, Nakshatri H, Chambon P 1992 Promoter context- and response element-dependent specificity of the transcriptional activation and modulating functions of retinoic acid receptors. Cell 70:1007–1019[CrossRef][Medline]
  29. Wilkinson JR, Towle HC 1997 Identification and characterization of the AF-1 transactivation domain of thyroid hormone receptor ß1. J Biol Chem 272:23824–23832[Abstract/Free Full Text]
  30. Ron D, Dressler H 1992 pGSTag—a versatile bacterial expression plasmid for enzymatic labeling of recombinant proteins. Biotechniques 13:866–869[Medline]
  31. Takeshita A, Yen PM, Ikeda M, Cardona GR, Liu Y, Koibuchi N, Norwitz ER, Chin WW 1998 Thyroid hormone response elements differentially modulate the interactions of thyroid hormone receptors with two receptor binding domains in the steroid receptor coactivator-1. J Biol Chem 273:21554–21562[Abstract/Free Full Text]
  32. Ikeda M, Kawaguchi A, Takeshita A, Chin WW, Endo T, Onaya T 1999 CBP-dependent and independent enhancing activity of steroid receptor coactivator-1 in thyroid hormone receptor-mediated transactivation. Mol Cell Endocrinol 147:103–112[CrossRef][Medline]
  33. Onate SA, Boonyaratanakornkit V, Spencer TE, Tsai SY, Tsai MJ, Edwards DP, O’Malley BW 1998 The steroid receptor coactivator-1 contains multiple receptor interacting and activation domains that cooperatively enhance the activation function 1 (AF-1) and AF-2 domains of steroid receptors. J Biol Chem 273:12101–12108[Abstract/Free Full Text]
  34. Tremblay GB, Tremblay A, Labrie F, Giguere V 1999 Dominant activity of activation function 1 (AF-1) and differential stoichiometric requirements for AF-1 and -2 in the estrogen receptor {alpha}-ß heterodimeric complex. Mol Cell Biol 19:1919–1927[Abstract/Free Full Text]
  35. Ikonen T, Palvimo JJ, Janne OA 1997 Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 272:29821–29828[Abstract/Free Full Text]
  36. Oberste-Berghaus C, Zanger K, Hashimoto K, Cohen RN, Hollenberg AN, Wondisford FE 2000 Thyroid hormone-independent interaction between the thyroid hormone receptor ß2 amino terminus and coactivators. J Biol Chem 275:1787–1792[Abstract/Free Full Text]
  37. Lee JW, Choi HS, Gyurist J, Brent R, Moore DD 1995 Two classes of proteins dependent on either the presence or absence of thyroid hormone for interaction with the thyroid hormone receptor. Mol Endocrinol 9:243–254[Abstract]
  38. Smith CL, Nawaz Z, O’Malley BW 1997 Coactivator and corepressor regulation of the agonist/antagonist activity of the mixed antiestrogen, 4-Hydroxytamoxifen. Mol Endocrinol 11:657–666[Abstract/Free Full Text]
  39. Lee SK, Kim HJ, Na SY, Kim TS, Choi HS, Im SY, Lee JW 1998 Steroid receptor coactivator-1 coactivates activating protein-1-mediated transactivations through interaction with the c-Jun and c-Fos subunits. J Biol Chem 273:16651–16654[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol EndocrinolHome page
A. Wulf, M. G Wetzel, M. Kebenko, M. Kroger, A. Harneit, J. Merz, and J. M Weitzel
The role of thyroid hormone receptor DNA binding in negative thyroid hormone-mediated gene transcription
J. Mol. Endocrinol., July 1, 2008; 41(1): 25 - 34.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. ProteomicsHome page
M. D. M. Huq, P. Gupta, N.-P. Tsai, and L.-N. Wei
Modulation of Testicular Receptor 4 Activity by Mitogen-activated Protein Kinase-mediated Phosphorylation
Mol. Cell. Proteomics, November 1, 2006; 5(11): 2072 - 2082.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/3/1452    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Iwasaki, T.
Right arrow Articles by Koibuchi, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Iwasaki, T.
Right arrow Articles by Koibuchi, N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals