help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1286
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yesilaltay, A.
Right arrow Articles by Krieger, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yesilaltay, A.
Right arrow Articles by Krieger, M.
Endocrinology Vol. 147, No. 4 1577-1588
Copyright © 2006 by The Endocrine Society

Effects of Hepatic Expression of the High-Density Lipoprotein Receptor SR-BI on Lipoprotein Metabolism and Female Fertility

Ayce Yesilaltay, María Gabriela Morales, Ludwig Amigo, Silvana Zanlungo, Attilio Rigotti, Sharon L. Karackattu, Mary H. Donahee, Karen F. Kozarsky and Monty Krieger

Department of Biology, Massachusetts Institute of Technology (A.Y., S.L.K., M.K.), Cambridge, Massachusetts 02139; Departamento de Gastroenterología, Facultad de Medicina, Pontificia Universidad Católica (M.G.M., L.A., S.Z., A.R.), Santiago 833-0024, Chile; and Biopharmaceuticals Center of Excellence for Drug Discovery, GlaxoSmithKline (M.H.D., K.F.K.), King of Prussia, Pennsylvania 19406

Address all correspondence and requests for reprints to: Dr. Monty Krieger, Department of Biology, Massachusetts Institute of Technology, Room 68-483, 77 Massachusetts Avenue, Cambridge, Massachusetts 02139. E-mail: krieger{at}mit.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The etiology of human female infertility is often uncertain. The sterility of high-density lipoprotein (HDL) receptor-negative (SR-BI–/–) female mice suggests a link between female infertility and abnormal lipoprotein metabolism. SR-BI–/– mice exhibit elevated plasma total cholesterol [with normal-sized and abnormally large HDL and high unesterified to total plasma cholesterol (UC:TC) ratio]. We explored the influence of hepatic SR-BI on female fertility by inducing hepatic SR-BI expression in SR-BI–/– animals by adenovirus transduction or stable transgenesis. For transgenes, we used both wild-type SR-BI and a double-point mutant, Q402R/Q418R (SR-BI-RR), which is unable to bind to and mediate lipid transfer from wild-type HDL normally, but retains virtually normal lipid transport activities with low-density lipoprotein. Essentially wild-type levels of hepatic SR-BI expression in SR-BI–/– mice restored to nearly normal the HDL size distribution and plasma UC:TC ratio, whereas approximately 7- to 40-fold overexpression dramatically lowered plasma TC and increased biliary cholesterol secretion. In contrast, SR-BI-RR overexpression had little effect on SR-BI+/+ mice, but in SR-BI–/– mice, it substantially reduced levels of abnormally large HDL and normalized the UC:TC ratio. In all cases, hepatic transgenic expression restored female fertility. Overexpression in SR-BI–/– mice of lecithin:cholesterol acyl transferase, which esterifies plasma HDL cholesterol, did not normalize the UC:TC ratio, probably because the abnormal HDL was a poor substrate, and did not restore fertility. Thus, hepatic SR-BI-mediated lipoprotein metabolism influences murine female fertility, raising the possibility that dyslipidemia might contribute to human female infertility and that targeting lipoprotein metabolism might complement current assisted reproductive technologies.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PLASMA LIPOPROTEINS TRANSPORT cholesterol [as unesterified cholesterol (UC) and cholesteryl esters (CE)] and other lipids to and from tissues where they play critical roles in maintaining cell integrity (e.g. membrane synthesis), endocrine functions (e.g. cholesterol is a precursor for steroid hormone synthesis), and fertility (1, 2, 44). Cellular UC levels are tightly regulated, not only because cholesterol is an essential component of cells and a precursor of important biomolecules (3), and thus deficiency would be deleterious, but also because excess UC can be cytotoxic (4, 5, 6). To prevent this toxicity, cells esterify cholesterol for storage in cytoplasmic lipid droplets or use a variety of transporter-mediated mechanisms to export UC to extracellular acceptors (2, 7, 8, 9, 10). In addition, high-density lipoprotein (HDL) appears to play an especially important role as an extracellular acceptor for cholesterol efflux (2, 11, 12), a function that is commonly thought to underlie, at least in part, the well-established association of elevated plasma HDL cholesterol with reduced risk for atherosclerotic disease (coronary heart disease and stroke) (13, 14, 15).

HDL may also have a particularly important role in mammalian female fertility, because in many species, including humans, HDL is the main class of lipoprotein found in substantial amounts in the follicular fluid enveloping oocytes in ovarian follicles (16, 17, 18, 19, 20, 21). This is presumably due to the size limit imposed by the follicular basement membrane, which is known as the blood-follicle barrier (20). The follicular HDL might deliver key lipids to follicular cells or mediate cholesterol efflux from those cells (22). An important mechanism by which HDL cholesterol is delivered to ovarian cells, especially steroidogenic cells, is called selective lipid uptake, which is mediated by the HDL receptor SR-BI (2, 23, 24, 25).

SR-BI mediates cellular selective lipid uptake from HDL by binding to HDL via its apolipoprotein components and subsequently facilitating the net transfer from the core of the particle CE, but not the protein or most of the lipid components of the lipoprotein’s outer shell (2, 24, 25, 26). SR-BI can also mediate the bi-directional movement of UC between lipoproteins and cells (10, 27, 28, 29), and thus, in the presence of a UC gradient between cells and extracellular HDL, can mediate net cellular cholesterol efflux. Therefore, SR-BI, which is most highly expressed in the liver and steroidogenic tissues (24, 30), serves as a cholesterol transporter protein on the surfaces of cells. In the ovary, SR-BI is expressed in thecal cells, luteinized granulosa cells, and interstitial tissue (30, 31, 32, 33). In liver, but not steroidogenic tissues, SR-BI protein expression depends on the presence of an adaptor protein, PDZK1, that binds via one of its four postsynaptic density protein (PSD-95)/Drosophila disc large tumor suppressor (dlg)/tight junction protein (ZO1) (PDZ) domains to the C-terminal cytoplasmic domain of SR-BI (34, 35, 36, 37).

Mice with targeted homozygous null mutations in the SR-BI gene exhibit approximately 2-fold elevated plasma cholesterol carried in both normal size and abnormally large HDL particles (38, 39). The ratio of UC to total cholesterol (TC; UC:TC ratio) in plasma is abnormally high in SR-BI–/– mice (~0.5 vs. ~0.25 in controls) (40, 41). When SR-BI–/– mice are crossed into an atherosclerosis-prone genetic background (39, 42) or fed an atherogenic diet (41, 43), they exhibit accelerated atherogenesis. Furthermore, SR-BI–/– females, but not males, are infertile (39, 44). SR-BI–/– females ovulate normal numbers of oocytes that are dead or defective and thus cannot be fertilized to form multicellular embryos. Although SR-BI plays a critical role in mediating the delivery of HDL cholesterol to steroidogenic cells to maintain CE stores and provide substrate for steroidogenesis (2, 45, 46, 47), insufficient ovarian steroid hormone synthesis does not appear to be responsible for the infertility of SR-BI–/– females (39, 44). For example, these animals exhibit a normal estrous cycle and a normal postmating increase in plasma progesterone (39, 44).

Our previous studies showed that when ovaries from SR-BI–/– mice are transplanted into otherwise SR-BI-positive recipients, they appear to function normally, and that genetic or pharmacological manipulation of lipoprotein metabolism in SR-BI–/– females can partially or fully restore fertility in the absence of SR-BI expression (44). These observations suggested that infertility of SR-BI–/– mice appears to be a direct consequence of abnormal lipoprotein metabolism and not due to ovarian SR-BI deficiency per se. In the current study we explored the hypothesis that hepatic SR-BI expression can play a critical role in murine female fertility by assessing the effects of adenovirus- or stable transgenesis-mediated hepatic expression of wild-type and mutant forms of SR-BI on the lipoprotein metabolism and fertility of SR-BI–/– mice. We found that hepatic SR-BI expression could correct the two main defects in the structure of HDL in SR-BI–/– mice (abnormally large size and UC:TC ratio) and restore female fertility to virtually wild-type levels. Thus, hepatic SR-BI-mediated lipoprotein metabolism influences murine female fertility, raising the possibility that some dyslipidemic disorders might contribute to human female infertility, and targeting lipoprotein metabolism in these conditions might provide a novel approach to complement current assisted reproductive technologies.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
All mice were fed a regular chow diet, either from Harlan Teklad (Indianapolis, IN; RMH 3000) or PMI Feeds, Inc. (St. Louis, MO; Prolab RMH3000), with water supplied ad libitum. Genotypes were determined by PCR as previously described (63) or with modifications (38) using the primers described below. Experiments were performed with 6- to 10-wk-old animals. All animal studies were approved by the Massachusetts Institute of Technology and the Pontificia Universidad Católica committees on animal care. Wild-type mice and mice carrying heterozygous or homozygous null mutations in the SR-BI gene on a mixed C57BL/6:129-S4 background (38) are referred to as SR-BI+/+, SR-BI+/–, and SR-BI–/– mice, respectively.

Generation of SR-BI-transgenic (SR-BI-Tg) mice
A 1.5-kb fragment spanning the wild-type murine SR-BI cDNA and a cDNA encoding a mutant form of SR-BI, SR-BIQ402R/Q418R (SR-BI-RR) were amplified by PCR from a plasmid (pDT188) that contains the cloned murine SR-BI cDNA (24) and from plasmid VM54 that have been described previously (48), respectively, using primers MunI-SRBI-new (TTATTCCAATTGCCGTCTCCTTCAGGTCCTGAGC) and SRBI-XhoI-rev (CAGCACCTCGAGGGCTTATAGTGTCTTCAGGACCCTA) and a DNA polymerase with proofreading activity, Pfu polymerase (Promega Corp., Madison, WI). A MunI site was introduced within the primer oligo at the 5' of the START codon of the SR-BI gene, and a XhoI site was introduced within the primer oligo at the 3' of the STOP codon of the SR-BI cDNA. The 1.5-kb cDNA fragment encoding the gene in its entirety was subcloned between the MunI and XhoI sites in the pLIV-LE6 plasmid, provided by Dr. John M. Taylor (Gladstone Institute of Cardiovascular Disease, University of California, San Francisco, CA). The SR-BI-coding region was confirmed by DNA sequencing using four primers spanning the gene. The pLiv-LE6 plasmid contains the promoter, first exon, first intron, and part of the second exon of the human apoE gene, and the polyadenylation sequence, and a part of the hepatic control region of the apoE/C-I gene locus (49). The new constructs harboring the wild-type and mutant copies of the SR-BI gene as well as the above-mentioned apoE/apoC-I control locus elements were linearized by NotI/SpeI digestion, and the resulting 6.5-kb fragments were used to generate transgenic mice by standard procedures (50) in C57BL/6 and 50:50 mixed C57BL/6 x 129-S4 background mice. Founder animals were backcrossed to 50:50 mixed C57BL/6 x 129-S4 background mice for three or four generations, and three transgenic mouse lines, SR-BI-Tghigh, SR-BI-Tglow, and SR-BI-RR-Tg, were established. The primers AB2 (GATGGGACATGGGACACGAAGCCATTCT) and AB3 (TCTGTCTCCGTCTCCTTCAGGTCCTGA) were used to amplify solely the genomic SR-BI. The presence of the SR-BI transgene was detected by primers B-Tg1 (TGAAGCTGATGATGACCTT) and B-Tg2 (AGCAGATGCGTGAAACTTGGTGA). Transgene expression was observed mainly in the liver, and some expression was observed in the kidney. The receptor in the kidney is expressed on the apical surfaces of the epithelial cells in the proximal tubules and therefore was found to face the tubular lumen, rather than the plasma, where it is not expected to influence substantially plasma lipoprotein metabolism. Indeed, results using liver-specific adenovirus-mediated transgenesis and these stable transgenic lines were concordant, fully supporting this assumption.

Lethicin:cholesterol acyl transferase (LCAT)-Tg mice that carry the human LCAT gene expressed from the albumin promoter on the C57BL/6 background (51) were purchased from The Jackson Laboratory (Bar Harbor, ME). These mice were crossed to SR-BI–/– males. The resulting offspring were crossed to each other to obtain the animals used in the study. Unless otherwise noted, all experimental animals and controls were on the same mixed C57BL/6:129-S4 background.

Recombinant adenovirus preparation and infection
The adenoviruses encoding wild-type murine SR-BI (Ad.SR-BI) and the control virus without a transgene (Ad.{Delta}E1) were described previously (52). The adenovirus encoding SR-BIQ402R/Q418R (Ad.SR-BI-RR) was prepared as previously described (53), where cDNA encoding SR-BIQ402R/Q418R was amplified by PCR from plasmid VM54 (48) and subcloned in the HindIII site of the pShuttle vector, then the recombinant adenoviral genome with the SR-BIQ402R/Q418R under control of the cytomegalovirus promoter was generated by homologous recombination in bacterial cells (65). Large-scale production of recombinant adenoviruses was performed using infected HEK293 cells as described previously (54). On d 0, SR-BI+/+ or SR-BI–/– mice (2–3 months old) on a 50:50 mixed C57BL/6 x 129-S4 background were injected via the femoral vein with PBS or 1 x 1011 viral particles of Ad.{Delta}E1 for control groups or 1 x 1011 particles of Ad.mSR-BI or Ad.SR-BI-RR for experimental groups. Plasma, hepatic bile, and liver samples were harvested on d 3 after infection.

Hepatic bile, blood and liver sampling and processing
Mice were anesthetized with ip injection of pentobarbital (4.5 mg/100 g body weight) for adenovirus injections or by 2.5% Avertin for other studies. Hepatic bile was collected for 30 min while mice were kept under anesthesia at 37 C with a heating lamp. Blood was collected by puncture of the inferior vena cava or by heart puncture with a heparinized syringe. Plasma was separated by low speed centrifugation for 10 min at 3000 x g. Hepatic bile flow, calculated by dividing the volume of bile (determined gravimetrically assuming a specific density of 1.0) by the collection time and the liver weight, was expressed as microliters per minute per gram of liver. Bile and some plasma were stored at –20 C for lipid analysis, whereas liver samples were kept at –80 C before analysis by Western blotting.

Analysis of plasma cholesterol and lipoproteins
Plasma samples from single animals or pooled plasma where indicated were size fractionated by fast performance liquid chromatography (FPLC) as previously described (38), and TC and UC in each fraction or in unfractionated total plasma were determined using commercial kits (Wako Chemical USA, Inc., Richmond, VA) or as described previously (55). Slight differences in the peak positions of the HDL from SR-BI+/+ mice are the result of using different FPLC instruments (Fig. 2Go vs. Figs. 5Go and 7Go).


Figure 2
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 2. Lipoprotein cholesterol profiles of adenovirus-treated SR-BI+/+ (A) and SR-BI–/– (B) mice. Mice were injected with the indicated adenoviruses on d 0; plasma was harvested on d 3 and then size fractionated using FPLC. The cholesterol content of the fractions was determined by enzymatic assay. Chromatograms represent average values of the TC content of FPLC fractions from independent analyses of four to seven individual mice for each experimental group. Approximate elution positions of native VLDL, intermediate-density lipoprotein (IDL)/LDL, and HDL particles are indicated by brackets and were determined as previously described (38 ).

 

Figure 5
View larger version (27K):
[in this window]
[in a new window]
 
FIG. 5. Exogenous (A and C) and endogenous (B) LCAT activities in plasma from nontransgenic (A and B) and LCAT-Tg (C) mice. A and C, Exogenous LCAT activities (nanomoles cholesterol esterified per hour per milliliter of plasma) in pooled plasma samples (n = 4) from the indicated nontransgenic (A) or LCAT-Tg (C) mice were measured in duplicate during either a 20-min (A) or 7.5-min (C) incubation at 37 C using thin layer chromatography as described in Materials and Methods. Similar results were observed when plasma samples from single animals were tested (not shown). B, Endogenous LCAT activities in plasma samples from individual SR-BI+/+ (n = 7) and SR-BI–/– (n = 4) mice were measured in duplicate for 30 min at 37 C after overnight equilibration with trace amounts of [3H]UC and were analyzed by thin layer chromatography as described in Materials and Methods. Similar results were obtained from samples with pooled plasma (not shown). Values represent means, and the error bars represent SEMs.

 

Figure 7
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 7. Effect of LCAT transgene expression on the fertility of SR-BI+/– and SR-BI–/– female mice. Individual virgin females with the indicated SR-BI genotype ((+/– or –/–) without (–) or with (+) the LCAT transgene were mated continuously for 4 months to nontransgenic SR-BI+/+ males. A, Fertility, expressed as the percentage of females producing litters (the numbers of females that produced litters compared with the number of females studied are shown above the bars). B, Average number of pups delivered per month per female (error bars represent the SEM). The mean litter sizes, which include only those females that delivered pups, are shown below. The values for the nontransgenic females, which had slightly different genetic backgrounds from the LCAT-Tg mice (C57BL/6:129-S4 ratios, 50:50 vs. 75:25 in LCAT-Tg animals), were taken from Fig. 6Go. The UC:TC values for females from the indicated genotypes are as follows: SR-BI–/–, 0.52 ± 0.02 (n = 11); SR-BI–/–[LCAT-Tg], 0.37 ± 0.01 (n = 8; P < 0.000001); and SR-BI+/–, 0.21 ± 0.01 (n = 6); SR-BI+/–[LCAT-Tg] 0.20 ± 0.01 (n = 14; P = 0.73). The P values represent statistical differences within each SR-BI genotype comparison with or without the LCAT transgene.

 
Biliary cholesterol analysis
After lipid extraction (56), biliary cholesterol concentrations were measured by an enzymatic assay as previously described (57). Biliary cholesterol secretion rates were calculated from biliary lipid concentrations and measured hepatic bile flows and were expressed as nanomoles per minute per gram of liver.

Immunoblotting analysis
Total liver membranes (40–50 µg protein/sample) were size-fractionated by 10% SDS-PAGE and immunoblotted on nitrocellulose or polyvinylidene fluoride membranes with either polyclonal antipeptide antibodies for SR-BI (24) or NB400–104 from Novus Biologicals (Littleton, CO) or {epsilon} coat protein subunit ({epsilon}-COP) of the coatomer complex COPI (58), used as a protein loading control. Antibody binding to protein samples was visualized by the enhanced chemiluminescence procedure (GE Healthcare/Amersham Biosciences, Arlington Heights, IL) and quantified with a Macintosh Color One scanner (Apple Computer, Cupertino, CA) and National Institutes of Health imaging software version 1.6. Relative levels of hepatic SR-BI protein expression were determined after normalization for {epsilon}-COP protein levels. To quantify the relative amounts of SR-BI in different tissues, tissue lysates were serially diluted and subjected to electrophoresis/immunoblotting, and the relative intensities of the signals were compared by visual examination of protein levels in these mice.

Immunohistochemical localization of hepatic SR-BI
For immunoperoxidase studies, tissues were fixed for 4 h in 4% paraformaldehyde in PBS (pH 7.4) at 4 C, then incubated overnight at 4 C in 30% sucrose in PBS (pH 7.4). Tissues were then frozen in OCT compound (Miles Diagnostics, Elkhart, IN) and stored in liquid nitrogen. Immunoperoxidase staining was performed on 5-µm frozen sections with primary anti-SR-BI antibody (24) and secondary biotinylated antirabbit IgG (1:200 dilution; Vector Laboratories, Inc., Burlingame, CA), and subsequently visualized with Vectastain ABC (Vector Laboratories, Inc.) and diaminobenzidine (Research Genetics, Inc., Huntsville, AL), according to the manufacturer’s protocol.

Fertility assays
Virgin females (6–8 wk of age) were housed continuously with wild-type males, and the numbers of litters and pups were recorded for a period of 4 months.

LCAT assays
We used two assays to measure LCAT activity in plasma samples.

Endogenous LCAT assay.
Trace amounts of [3H]cholesterol were equilibrated with the endogenous UC in the plasma lipoproteins, then LCAT activity was measured as previously described (59). Briefly, 10 µl plasma was diluted by addition of 40 µl TBS buffer [10 mM Tris (pH 8.0), 140 mM NaCl, 0.01% NaN3, and 0.01% EDTA] in a glass tube containing 500,000 cpm [3H]cholesterol (PerkinElmer, Inc., Wellesley, MA), which had been evaporated and dried at the bottom of the tube. The tubes were shaken vigorously overnight at 4 C. The distribution of labeled cholesterol among the plasma lipoproteins was found to be similar to that of the endogenous unlabeled cholesterol by FPLC chromatography (not shown). The samples were divided in half for simultaneous incubations with shaking for 30 min at either 37 C (experimental) or 4 C (controls). The reactions were stopped by the addition of 2 ml ethanol, and lipids were extracted twice with 4 ml hexane containing excess unlabeled cholesterol and cholesteryl oleate (50 µg each) as carriers. The amounts of labeled UC and CE were determined using thin layer chromatography and scintillation counting, and the percent cholesterol esterification rate (CE/TC) and the plasma cholesterol esterification rate (CER; nanomoles of cholesterol converted to cholesteryl ester per hour per milliliter of plasma) were calculated. The CER was calculated based on the specific activity of the unesterified cholesterol in the samples (determined from the mass of unesterified cholesterol in the samples measured by enzymatic methods), which varied significantly among the mouse strains used.

Exogenous LCAT assay.
LCAT activity was determined with an exogenous reconstituted discoidal HDL substrate prepared using the sodium cholate method with an initial molar ratio of 0.8:250:12.5 of apoA-I, egg phosphatidylcholine and [14C]cholesterol (60). Briefly, the reaction was initiated by adding 15 µl plasma to reconstituted HDL (22 µg human apoA-I), 0.5% BSA, and 5 mM ß-mercaptoethanol in a total volume of 0.515 ml. After a 20-min incubation at 37 C, the lipids were extracted and analyzed as described above. To ensure linearity, reactions did not proceed beyond 20% conversion of UC to CE. Esterification rates were corrected by subtracting values for reactions conducted without plasma. In addition, the specificity of the reaction was confirmed by complete inhibition with 1.3 mM 5',5'-dithio-bis(2-nitrobenzoic acid), an inhibitor of LCAT. Plasma LCAT activity with the exogenous substrate was determined by calculating the nanomoles of conversion of [14C]cholesterol to CE per hour per milliliter of plasma after correcting for the specific activity of the UC due to dilution by the endogenous UC present in the plasma samples, which was determined enzymatically as described above.

Statistical analysis
The statistical significance of the differences was determined by one-way ANOVA Tukey’s post hoc test, or two-tailed unpaired Student’s t test where appropriate. Differences were considered significant when P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous reports suggested that the influence on plasma lipoprotein metabolism of a homozygous null mutation in the SR-BI gene is responsible for the infertility of SR-BI–/– female mice (39, 44). The liver plays a central role in mediating the effects of SR-BI on lipoprotein metabolism (34, 52, 61, 62, 63). Thus, we used adenovirus-mediated and Tg-based approaches to increase the expression of SR-BI in the livers of SR-BI–/– and control mice and examined the effects on lipoprotein and lipid metabolism and on female fertility. We used as transgenes both wild-type SR-BI and a double-point mutation form of the receptor (Q402R/Q418R or SR-BI-RR). When expressed in cultured cells, SR-BI-RR is unable to bind to and mediate lipid transfer from normal HDL, but retains essentially wild-type binding and lipid transport activities when the larger lipoprotein low-density lipoprotein (LDL) serves as its ligand (48, 64). We hypothesized that the mutant SR-BI-RR might catabolize or prevent the formation of the abnormal, large HDL-like particles found in SR-BI–/– plasma (38), but not normal-sized HDL particles. Thus, it might help differentiate the influences of these two classes of HDL particles on the abnormal phenotypes of SR-BI–/– mice.

Our initial studies focused on adenovirus-mediated hepatic overexpression of SR-BI. Adenovirus treatment resulted in hepatic expression of the receptors that was approximately 7- to 10-fold greater than in control wild-type mice (see supplemental Fig. 1Go, published on The Endocrine Society’s Journals Online web site, http://endo.endojournals.org). We determined the effects of hepatic overexpression on plasma cholesterol levels and biliary cholesterol secretion rates (Fig. 1Go) and the distribution of cholesterol among plasma lipoproteins as determined by FPLC size fractionation (lipoprotein profiles; Fig. 2Go). As previously reported (52), Ad.SR-BI-mediated hepatic overexpression in wild-type SR-BI+/+ mice resulted in a dramatic reduction in plasma total cholesterol (primarily in HDL; Figs. 1AGo and 2AGo, bullet) and a 2.2-fold increase in biliary cholesterol secretion (Fig. 1AGo). Similar results were observed in SR-BI–/– animals (Fig. 1BGo). Thus, hepatic overexpression of wild-type SR-BI effectively removes the cholesterol from normal-sized and abnormally large HDL particles in the circulation and/or prevents the formation of these particles by rapidly clearing cholesterol from their precursors. As a consequence of accelerated hepatic HDL cholesterol clearance mediated by SR-BI, biliary secretion of cholesterol increased.


Figure 1
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 1. Effects of adenovirus-mediated hepatic overexpression of SR-BI and SR-BI-RR on plasma cholesterol levels and biliary cholesterol secretion in SR-BI+/+ (A) and SR-BI–/– (B) mice. On d 0, mice were injected with PBS or control adenovirus (Control) or adenoviruses encoding SR-BI or SR-BI-RR as indicated. Some controls were injected with PBS alone. On d 3, plasma TC levels and biliary secretion rates were determined as described in Materials and Methods. The 100% of control values for plasma cholesterol and biliary secretion, respectively, were: SR-BI+/+, 77.7 ± 6 mg/dl (n = 8), 0.88 ± 0.15 nmol/min/g liver (n = 8); and SR-BI–/–, 264.9 ± 13 mg/dl (n = 6), 0.6 ± 0.08 nmol/min/g liver (n = 5; n = 4–8 for the other values shown). The values for one-way ANOVA for TC values within each genotype are P < 0.0001 and P < 0.001 for biliary secretion values. Statistically significant differences by ANOVA Tukey post hoc test from the rest of the values within each genotype are indicated as: *, P < 0.01; **, P < 0.001.

 
As expected from our in vitro studies (48, 64), transduction of SR-BI+/+ mice with the Ad.SR-BI-RR virus had little effect on plasma TC levels, biliary cholesterol secretion (Fig. 1AGo), or the lipoprotein profile (Fig. 2AGo, {blacksquare}), because the bulk of the plasma cholesterol is in normal-sized HDL particles not recognized efficiently by this mutant receptor. Strikingly, in SR-BI–/– animals (Fig. 1BGo), hepatic overexpression of SR-BI-RR reduced plasma cholesterol by approximately 60% to the levels observed in control SR-BI+/+ animals, apparently as a consequence of either clearing cholesterol from or preventing the formation of the larger abnormal particles without dramatically influencing normal HDL particles (Fig. 2BGo, {diamondsuit}). This Ad.SR-BI-RR effect in SR-BI–/– mice was accompanied by a 2.6-fold increase in biliary cholesterol secretion (Fig. 1BGo). It was somewhat surprising to observe comparable rates of SR-BI-mediated biliary secretion in the Ad.SR-BI- and Ad.SR-BI-RR-treated SR-BI–/– mice, because the wild-type receptor is so much more effective in reducing total plasma cholesterol. This raises the possibility that there may be an upper limit to the rate of biliary cholesterol secretion in these animals that should be explored in future studies. These results indicate that SR-BI-RR behaves in vivo as it did in vitro, in that this mutant receptor cannot efficiently process normal-size HDL, but may be able to mediate lipid uptake from (or prevent the formation of) larger lipoproteins, both LDL (in vitro studies) and the abnormal, large HDL particles in SR-BI–/– mice. Thus, SR-BI-RR may be useful to differentially address the biological consequences of preventing the accumulation of these abnormal particles in the plasma.

Similar effects of hepatic transgene expression were seen in stable transgenic lines, which are more suitable for the long-term studies of female fertility. We generated Tg lines expressing wild-type SR-BI protein at either 40-fold (SR-BI-Tghigh; see supplemental Fig. 2Go, published on The Endocrine Society’s Journals Online web site, http://endo.endojournals.org, for immunoblotting data) or approximately 0.7-fold (SR-BI-Tglow; data not shown), and the SR-BI-RR mutant at 40-fold higher than normal (SR-BI-RR-Tg; supplemental Fig. 2Go). The Q402R/Q418R mutations did not appear to interfere with the ability of the receptor to reach the plasma membrane (see immunohistochemical analysis in supplemental Fig. 2Go). Table 1Go shows the influence of stable Tg expression of these receptors on plasma TC and UC levels and the UC:TC ratio in SR-BI+/– or SR-BI–/– mice (effects on lipoprotein profiles will be described in detail below). As was the case for adenovirus-mediated hepatic receptor overexpression, approximately 40-fold overexpression of wild-type SR-BI dramatically lowered plasma cholesterol levels in both SR-BI+/– and SR-BI–/– mice. Low level (~0.7-fold) expression of the wild-type SR-BI transgene also lowered plasma cholesterol levels, but not as dramatically. In contrast, the approximately 40-fold overexpression of the SR-BI-RR transgene resulted in only modest reductions in plasma cholesterol to values similar to those in nontransgenic wild-type control animals (143 to 89 mg/dl for SR-BI+/– mice and 206 to 109 mg/dl for SR-BI–/– mice). The levels of apoA-I, the major apolipoprotein in HDL, in SR-BI–/– mice were not substantially different from those in SR-BI+/+ mice (supplemental Fig. 3Go) (39). This was also the case for SR-BI–/– [SR-BI-Tglow] and SR-BI–/– [SR-BI-RR-Tg] mice. In contrast, plasma apoA-I levels were very low in SR-BI–/– [SR-BI-Tghigh] mice, consistent with the suggestion that small lipid poor apoA-I particles that may be generated in these mice are rapidly cleared from the circulation (52, 65, 66).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Total plasma cholesterol levels in stable transgenic animals

 

Figure 3
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. Effects of transgene expression on the lipoprotein cholesterol profiles of control SR-BI+/+, SR-BI–/–, and Tg SR-BI–/– mice. Plasma was harvested from the indicated control and Tg mice, then samples from individual animals were size fractionated using FPLC. The TC (A) and UC contents of the fractions were determined by enzymatic assays, and the UC:TC ratios for HDL-containing fractions 25–38 are shown in B. The chromatograms are representative of multiple, independent determinations. Approximate positions of VLDL, IDL/LDL, and HDL elutions are indicated by brackets and were determined as previously described (38 ). The UC values in fractions 25 and 26 from the control SR-BI+/+ mice were below detection limits. The error bars in B represent the range (n = 2).

 
The lipoprotein cholesterol profiles in Fig. 3AGo show that both low-level expression of wild-type SR-BI (SR-BI-Tglow) and approximately 40-fold overexpression of SR-BI-RR in SR-BI–/– mice substantially reduced the amounts of abnormally large HDL-like particles. The low level of wild-type SR-BI was more effective than the approximately 40-fold overexpression of SR-BI-RR. (The effects of stable high-level expression of wild-type SR-BI, almost undetectable levels of cholesterol in all fractions, are not shown.) Strikingly, both low-level expression of wild-type SR-BI and approximately 40-fold overexpression of SR-BI-RR not only reduced the plasma TC values in SR-BI–/– mice to nearly wild-type levels and resulted in lipoprotein profiles similar to those in wild-type mice, but also normalized the UC:TC ratio from its characteristically abnormally high value of 0.52 (40, 41) to 0.23–0.25 (Table 1Go). Figure 3BGo shows that the abnormally high UC:TC ratios present throughout the HDL size range in control SR-BI–/– mice were normalized by expression of the SR-BIlow and SR-BI-RR transgenes. (UC levels were below detection limits in SR-BI-Tghigh animals.)

Figure 4Go shows that Tg hepatic expression of wild-type SR-BI (both high and low levels) or SR-BI-RR restored nearly normal fertility to female SR-BI–/– mice, enumerated during 4-month mating periods either as the percentage of females producing litters (Fig. 4AGo) or the number of pups delivered per month per female (Fig. 4BGo). In addition, the times from the beginning of mating to delivery of the first litter were similar for the nontransgenic control SR-BI+/– and Tg SR-BI–/– females, ranging from 21–23 d. These results are consistent with our previous findings that SR-BI expression in the ovary or other female reproductive organs is not required per se for female fertility and strongly support the proposal that the presence of abnormal lipoproteins in female SR-BI–/– mice is responsible for their infertility (44). These findings were supported by preliminary studies using SR-BI–/– mice treated with adenoviruses. Fertility was restored in a large fraction of the mice injected with Ad.SR-BI encoding wild-type SR-BI and then mated 5 d later (our unpublished observations).


Figure 4
View larger version (35K):
[in this window]
[in a new window]
 
FIG. 4. Effect of stable hepatic transgene expression on the fertility of SR-BI–/– female mice. Six- to 8-wk-old, individual, virgin females with the indicated SR-BI genotypes (+/–) or (–/–) and transgenes were mated continuously for 4 months to nontransgenic SR-BI+/+ males. Females included SR-BI+/– ({blacksquare}; n = 5), SR-BI–/– (n = 7), SR-BI–/–[SR-BI-Tglow] ( Figure 4; n = 5), SR-BI–/–[SR-BI-Tghigh] ( Figure 4; n = 7), SR-BI–/–[SR-BI-RR-Tg] (Figure 4, n = 10). A, Fertility, expressed as the percentage of females producing litters (the numbers of females that produced litters relative to the number of females studied are shown above the bars). B, Average number of pups delivered per month per female mated (error bars represent the SEM). *, Statistically significant difference from the other values by ANOVA Tukey’s post hoc test (P < 0.05). The mean litter sizes, which include only those females that delivered pups, are shown below.

 
Given the potential causative role of the abnormally high UC:TC ratio in plasma lipoproteins in the infertility of SR-BI–/– females (see Discussion), we explored the mechanisms underlying this lipoprotein abnormality. LCAT is the plasma protein responsible for the esterification of cholesterol in HDL (67). We used two assays to measure LCAT activity in plasma samples from SR-BI–/– and control mice. The first involves the addition of an artificial, exogenous [14C]cholesterol-labeled reconstituted HDL substrate to plasma samples, followed by incubation and measurement of [14C]CE formation. This exogenous substrate assay is usually considered to provide a measure of the total active LCAT in the plasma sample (the amount of active enzyme is rate controlling) (60). The second LCAT assay involves the addition of trace amounts of [3H]cholesterol to the plasma samples, equilibration with the endogenous UC, and measurement of the rate of [3H]CE formation. Because the plasma UC levels varied depending on the genetic background of the mice examined, we calculated the specific activity of the 3H-labeled cholesterol in the reactions, and thus the rate of cholesterol esterification, based on the TC present in the plasma samples (endogenous alone for the endogenous assay, or sum of endogenous and exogenous cholesterol for the exogenous assay).

Figure 5AGo shows that the exogenous LCAT activities of control SR-BI+/+ and SR-BI–/– mice were similar (~35 and 33 nmol CE formed/h/ml plasma, respectively). Thus, reduced levels of LCAT activity are not responsible for the abnormally high UC:TC ratio in SR-BI–/– mice. Unlike the exogenous LCAT activity, the endogenous LCAT activity in plasma from SR-BI–/– mice was significantly less than that in SR-BI+/+ controls (Fig. 5BGo). Thus, it appears that the abnormal lipoproteins in SR-BI–/– plasma may be poor substrates for LCAT, and this might contribute to the abnormally high UC:TC ratio in these animals. Low endogenous LCAT activity was also reported by Ma et al. (68).

In an attempt to correct the abnormally high UC:TC ratio in SR-BI–/– mice and possibly restore fertility, we crossed these mice to Tg mice (SR-BI+/+[LCAT-Tg]) expressing a high level of the human LCAT enzyme in addition to the endogenous murine enzyme (51). The exogenous LCAT activities in the LCAT-Tg mice (Fig. 5CGo) were approximately 7- to 11-fold higher than those in nontransgenic controls (compare to Fig. 5AGo, note different scales of the y-axes), with the activity in the SR-BI–/–[LCAT-Tg] mice somewhat higher than that in the SR-BI+/+[LCAT-Tg] controls. Indeed, immunoblotting experiments indicated higher LCAT protein levels in the plasma of SR-BI–/–[LCAT-Tg] animals compared with those in SR-BI+/+[LCAT-Tg] controls, possibly due to the higher LCAT-binding capacity of the larger plasma lipoproteins in the receptor-deficient animals (data not shown). As expected from previous studies (51, 69), the LCAT transgene increased the plasma TC level in SR-BI+/+ mice by 60% (Table 2Go). Although the much smaller transgene-associated increase (18%) in SR-BI–/–[LCAT-Tg] mice was not statistically significant (Table 2Go), it was accompanied by an increase in the size of the already abnormally large HDL particles (FPLC analysis; shift to the left in Fig. 6Go). Analysis of the UC:TC ratios (Table 2Go) showed that expression of the LCAT transgene did not change this already low ratio (0.18) in SR-BI+/+ controls. The transgene significantly reduced the abnormally high UC:TC ratio from 0.44 in SR-BI–/– mice to 0.37 in SR-BI–/–[LCAT-Tg] mice; however, it was still twice that in SR-BI+/+[LCAT-Tg] controls. Thus, an approximately 10-fold increase in plasma LCAT activity was only able to partially overcome the apparent cholesterol esterification defect in SR-BI–/– mice.


View this table:
[in this window]
[in a new window]
 
TABLE 2. Plasma cholesterol levels in LCAT transgenic and nontransgenic animals

 

Figure 6
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 6. Effects of LCAT transgene expression on the lipoprotein cholesterol profiles of SR-BI+/+ and SR-BI–/– mice. Plasma was harvested from the indicated control and LCAT-Tg mice, then pooled plasma samples (n = 4) were size fractionated using FPLC. The TC contents of the fractions were determined by enzymatic assay. The chromatograms are representative of multiple, independent determinations, and similar results were observed for samples from individual animals. Approximate positions of VLDL, intermediate-density lipoprotein (IDL)/LDL, and HDL elutions are indicated by brackets and were determined as previously described (38 ).

 
Figure 7Go shows the effects of Tg human LCAT expression on the fertility of SR-BI–/– and SR-BI+/– females. There was virtually no effect of the LCAT transgene on the fertility of control SR-BI+/– mice. The LCAT transgene did not significantly restore fertility, as measured by pups per month per female (Fig. 7BGo). All SR-BI+/–[LCAT-Tg] females (five of five) produced litters, whereas only two of 15 SR-BI–/–[LCAT-Tg] females each produced a single litter, and those were very small (two vs. nine pups per litter). Thus, the very modest decrease in the abnormally high UC:TC ratio induced by the approximately 10-fold increase in plasma LCAT activity in SR-BI–/–[LCAT-Tg] mice was not associated with a substantial increase in female fertility.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The abnormal lipoprotein metabolism in SR-BI–/– mice appears to be responsible for their female, but not male, sterility (39, 44). The influence of hepatic SR-BI expression on female fertility has not previously been assessed directly, but would seem to be critical due to the key role hepatic SR-BI plays in plasma lipoprotein and cholesterol metabolism (2, 34, 52, 63, 70). In this study we employed two methods to induce hepatic expression of SR-BI in SR-BI–/– animals: transient adenovirus-mediated and long-term stable transgenic expression. We used as transgenes both wild-type SR-BI and a double-point mutation form of the receptor (Q402R/Q418R or SR-BI-RR). SR-BI-RR has lost the ability to bind to and mediate lipid transfer from HDL normally, but retains essentially wild-type binding and lipid transport activities for the larger lipoprotein LDL (48, 64).

As we (52) and others (63, 70, 71) previously showed, we found in this study that high level hepatic overexpression of wild-type SR-BI dramatically reduced plasma TC in wild-type and SR-BI–/– mice to nearly undetectable levels and increased biliary cholesterol levels or secretion rate. In contrast, high-level hepatic expression of the SR-BI-RR mutant had virtually no effect on plasma cholesterol levels or biliary cholesterol secretion in SR-BI+/+ mice, presumably because the normal-sized HDL that carries the bulk of the plasma cholesterol in these mice is not an efficient ligand for the mutant receptor. However, in SR-BI–/– mice, hepatic overexpression of SR-BI-RR was able to reduce plasma cholesterol to nearly wild-type levels, lower to essentially wild-type values the abnormally high UC:TC ratio, correct the lipoprotein profile, and induce a substantial increase in biliary cholesterol secretion. Thus, in SR-BI–/– mice high-level hepatic expression of the SR-BI-RR mutant substantially normalizes the otherwise abnormal lipoprotein size and lipid composition by effectively removing cholesterol from abnormally large HDL particles and/or preventing the formation of these particles or their precursors. Therefore, in addition to LDL particles that are larger than normal HDL, and in contrast to normal-sized HDL, the abnormally large HDL particles in SR-BI–/– mice (or their precursors) appear to serve as effective substrates for the SR-BI-RR mutant. The SR-BI–/–[SR-BI-RR-Tg] Tg mice should prove useful for future analysis of the pathophysiological properties of abnormal HDL in SR-BI–/– mice, including defective red blood cell maturation and enhanced susceptibility to atherosclerosis and coronary heart disease (39, 40, 72).

Concurrent with the changes in the plasma lipoprotein profiles, stable Tg hepatic expression of high or low levels of wild-type SR-BI or high levels of the SR-BI-RR mutant restored essentially normal fertility to SR-BI–/– females. Together with our previous studies involving ovary transplantation, inactivation of the apoA-I gene, or treatment with the hypocholesterolemia drug probucol, all of which restored production of functional oocytes by SR-BI-deficient ovaries and thus partially (apoA-I–/–) or fully (ovary transplantation or probucol treatment) restored fertility (44), these results establish that a primary mechanism by which SR-BI maintains murine female fertility is its control of plasma lipoprotein metabolism rather than its expression in reproductive organs.

The two most distinctive abnormal features of the HDL in SR-BI–/– mice that may influence female fertility are the substantial fraction of HDL that is abnormally large and the high UC:TC ratio in both large and normal-sized particles. However, several lines of evidence indicate that large HDL particles per se are not responsible for female infertility in SR-BI–/– mice. First, treatment of SR-BI–/– mice with the antioxidant and hypocholesterolemic drug probucol, which lowers plasma TC by approximately 50%, normalizes the UC:TC ratio and fully restores fertility, does not substantially alter the abnormally large HDL particle size distribution (40, 44). Second, inactivation of the apoA-I gene in SR-BI–/– mice, which lowers total plasma cholesterol by approximately 50% and partially restores fertility, reduced the amounts of normal, smaller HDL particles relative to the abnormal large particles, resulting in a mean particle size somewhat greater than that in apoA-I-replete controls (44). Third, female PDZK1–/– mice are fertile (34, 73). Hepatic SR-BI protein levels in PDZK1–/– mice are approximately 5% those in wild-type controls, whereas SR-BI protein levels in the ovary and other steroidogenic organs are normal (34). As a consequence of the reduced hepatic SR-BI activity, plasma cholesterol is elevated in abnormally large HDL particles, somewhat reminiscent of those in SR-BI–/– animals. However, the UC:TC ratio is essentially normal in PDZK1–/– mice (34), perhaps as a consequence of the nearly normal extrahepatic SR-BI expression or the normal hepatic expression of the minor, alternatively spliced mRNA isoform called SR-BII that is not present in SR-BI–/– mice. Thus, large HDL particles in PDZK1–/– mice are not associated with reduced fertility.

Although the presence of abnormally large HDLs per se is unlikely to cause female infertility in SR-BI–/– mice, there is a striking correlation between infertility and the abnormal UC:TC ratio. A key determinant of the UC:TC ratio is the activity of LCAT, which is the plasma enzyme responsible for esterification of UC in HDL particles (51, 69, 74). Although the absolute level of LCAT in SR-BI–/– mice appears to be the same as that in control SR-BI+/+ animals when measured using an exogenous reconstituted HDL substrate (this study; also see Ref.68), there was significantly reduced LCAT activity in SR-BI–/– mice (~50%) when assessed using the abnormal endogenous lipoproteins as the substrate. Previous studies (38, 39), confirmed here, have shown that the plasma levels of apoA-I, the major activator of LCAT in plasma, are normal in SR-BI–/– and SR-BI–/–/apoE–/– mice. Furthermore, hepatic SR-BI or SR-BI-RR transgene expression, which restored fertility, did not increase plasma apoA-I levels. Thus, reduced apoA-I-mediated activation of LCAT due to lower plasma apoA-I levels is unlikely to be responsible for the high UC:TC ratio. We conclude that the abnormal plasma lipoproteins in SR-BI–/– are poor substrates for LCAT, and that this substantially contributes to the abnormally high UC:TC ratio. While this manuscript was in preparation, similar findings (essentially wild-type levels of LCAT protein, but reduced LCAT activity with endogenous substrate) were reported by Ma et al. (68). In SR-BI–/–/apoE–/– double-knockout mice, the HDL-like particles are even larger than those in SR-BI–/– single knockout mice, forming lamellar/vesicular and stacked discoidal particles, and the UC:TC ratio is higher (~0.8 vs. ~0.5) (40). It seems likely that the particles in SR-BI–/–/apoE–/– double-knockout mice are especially poor LCAT substrates.

In an attempt to correct the high UC:TC ratio, we crossed SR-BI–/– mice with Tg mice expressing human LCAT in addition to endogenous murine LCAT. Although this resulted in an approximately 10-fold increase in LCAT activity (determined using exogenous substrate), the LCAT transgene only reduced the UC:TC by 16% to 0.37 and failed to restore female fertility. Although species differences in the specificities of the human and murine LCAT enzymes (75) may have influenced the results, our findings suggest that the abnormal lipoproteins in SR-BI–/– mice exhibit a high UC:TC ratio because they are poor LCAT substrates and that SR-BI activity normally helps maintain HDL in a state in which it can serve as an efficient LCAT substrate.

Determination of the precise mechanism by which abnormal lipoprotein metabolism in SR-BI–/– mice results in female infertility will require additional studies. The key lipoprotein-dependent step appears to occur before or immediately during ovulation, because SR-BI–/– females ovulate dysfunctional oocytes that are dead at ovulation or die shortly thereafter (39, 44). There appear to be two general classes of mechanisms by which the abnormal lipoproteins in SR-BI–/– mice might contribute to female infertility. The first involves gain of function mechanisms, in which the abnormal lipoproteins are somehow ovariotoxic. In the absence of ovarian SR-BI, the abnormal lipoproteins might deliver molecules to ovarian cells that are directly toxic (this could include delivery of excessive amounts of cholesterol) (76, 77, 78, 79) or remove essential compounds, the depletion of which would be toxic, resulting in defects in oocyte development/ovulation.

Alternatively, female infertility could be a consequence of a loss of function mechanism in which the abnormal lipoproteins are unable to perform the function(s) of wild-type lipoproteins. In the absence of SR-BI, the abnormal lipoproteins might be unable to deliver, or remove by efflux, key compounds to/from the ovary, for example, HDL-facilitated vitamin E uptake (80) or HDL-mediated efflux of cholesterol. Particularly, the abnormal lipoproteins in SR-BI–/– mice might be unable to facilitate removal of excess cellular cholesterol, because their high UC:TC ratio would prevent thermodynamically driven cellular cholesterol efflux down a cholesterol concentration gradient (10, 28, 29, 81). The pathogenic accumulation of intracellular cholesterol, due to either defective cholesterol efflux or abnormal enhanced delivery, appears to contribute to defective red blood cell maturation in SR-BI–/–/apoE–/– double-knockout mice (79). UC efflux from the cells in the ovary may be particularly important during the preovulatory period when granulosa cells produce progesterone after the LH surge. Progesterone has been shown to inhibit cholesterol esterification in vitro (82, 83) at concentrations that are present in the ovary (84). Thus, it has been suggested that cholesterol efflux may help cells avoid UC accumulation (85). In humans, HDL in follicular fluid is in the cholesterol-poor pre-ß form (86), a good acceptor for cellular efflux of excess UC from the ABCA1 transporter (8). In addition, LCAT is present in follicular fluid and may contribute to efficient efflux by preventing UC accumulation in the HDL (85, 87). Because of the limited size of murine follicles, it has been difficult to characterize their lipoprotein composition and metabolism.

The role of HDL-mediated cholesterol efflux may be especially relevant in SR-BI–/– mice, because SR-BI can directly mediate cholesterol efflux (10, 28, 81) as well as selective lipid uptake (24) and thus contribute to the bidirectional flow of lipids to maintain a local balanced environment of cholesterol. The relationship between female infertility in SR-BI–/– mice and the functions of two other cell surface proteins that mediate cholesterol efflux, ABCA1 (88, 89) and ABCG1 (90), is unclear. However, it is noteworthy that although ABCG1–/– mice exhibit normal fertility (90), ABCA1–/– females exhibit impaired fertility (placental malformation) (91) and have very low plasma HDL levels (92, 93). It is possible that the normal ovarian expression of SR-BI itself, even if it were to occur in the context of the abnormal lipoproteins present in SR-BI–/– mice, might mitigate the deleterious influence of these lipoproteins on female fertility (e.g. by facilitating lipid transport between the lipoproteins and ovarian cells). Thus, ovarian SR-BI expression might contribute to the fertility of PDZK1–/– female mice even though hepatic SR-BI expression is dramatically reduced, and abnormally large HDLs accumulate in the circulation (34). Our observation that Tg hepatic expression of SR-BI or SR-BI-RR in SR-BI–/– females at least partially corrects their lipoprotein abnormalities and restores fertility is compatible with either class of mechanism. It is clear that not all variations in HDL structure or metabolism will substantially reduce female fertility. For example, there is no evidence of female infertility in species with naturally low HDL levels (e.g. guinea pigs) or in animals with experimentally generated low plasma HDL, such as apoA-I-deficient or Tg, hepatic SR-BI-overexpressing mice (63, 70, 94). Thus, even small steady-state levels of plasma HDL, provided these particles have the appropriate size and composition or metabolic fates, can be sufficient to prevent ovarian toxicity (e.g. accumulation of toxic cholesterol levels).

In summary, the current studies confirmed the importance of the hepatic expression of SR-BI for murine lipoprotein metabolism and support our conclusion that the structure of HDL and its role in cholesterol transport and metabolism may be critical in determining mammalian female fertility. These findings raise the possibility that dyslipidemia might contribute to some cases of human female infertility, and in such cases, targeting dyslipidemia might complement current assisted reproductive technologies.


    Acknowledgments
 
We thank Michael Brown, Olivier Kocher, Rinku Pal, Sara Vassallo, Thomas Nieland, and John M. Taylor for gifts of reagents or for help with experiments, and Krieger laboratory members for helpful discussions.


    Footnotes
 
This work was supported by grants from the National Institutes of Health [HL-64737 (to M.K.), HL-66105 to (M.K.), and TW-006153 (to M.K. and A.R.)] and Fondo Nacional de Desarrollo Científico y Tecnológico Grant 1030416 (to A.R.).

All authors have nothing to declare.

First Published Online January 12, 2006

Abbreviations: Ad, Adenovirus; apoA-I, apolipoprotein A-I; apoE, apolipoprotein E; CE, cholesteryl ester; CER, cholesterol esterification rate; FPLC, fast performance liquid chromatography; HDL, high-density lipoprotein; LCAT, lethicin:cholesterol acyl transferase; LDL, low-density lipoprotein; PDZ, postsynaptic density protein (PSD-95)/Drosophila disc large tumor suppressor (dlg)/tight junction protein (ZO1); SR-BI, scavenger receptor, class B, type I; TBS, Tris-buffered saline; TC, total cholesterol; Tg, transgenic; UC, unesterified cholesterol; VLDL, very low-density lipoprotein.

Received October 11, 2005.

Accepted for publication January 4, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Farese Jr RV, Herz J 1998 Cholesterol metabolism and embryogenesis. Trends Genet 14:115–120[CrossRef][Medline]
  2. Rigotti A, Miettinen HE, Krieger M 2003 The role of the high-density lipoprotein receptor SR-BI in the lipid metabolism of endocrine and other tissues. Endocr Rev 24:357–387[Abstract/Free Full Text]
  3. Lodish H, Berk A, Matsudaira P, Kaiser CA, Krieger M, Scott MP, Zipursky L, Darnell J 2003 Molecular cell biology. 5th ed. New York: W. H. Freeman and Co.
  4. Simons K, Ikonen E 2000 How cells handle cholesterol. Science 290:1721–1726[Abstract/Free Full Text]
  5. Tabas I 2002 Consequences of cellular cholesterol accumulation: basic concepts and physiological implications. J Clin Invest 110:905–911[CrossRef][Medline]
  6. Tabas I, Krieger M 1999 Lipoprotein receptors and cellular cholesterol metabolism in health and disease. In: Chien KR, ed. Molecular basis of heart disease. New York: Saunders; 428–457
  7. Klucken J, Buchler C, Orso E, Kaminski WE, Porsch-Ozcurumez M, Liebisch G, Kapinsky M, Diederich W, Drobnik W, Dean M, Allikmetz R, Schmitz G 2000 ABCG1 (ABC8), the human homolog of the Drosophila white gene, is a regulator of macrophage cholesterol and phospholipid transport. Proc Natl Acad Sci USA 97:817–822[Abstract/Free Full Text]
  8. Aiello RJ, Brees D, Francone OL 2003 ABCA1-deficient mice: insights into the role of monocyte lipid efflux in HDL formation and inflammation. Arterioscler Thromb Vasc Biol 23:972–980[Abstract/Free Full Text]
  9. Wang N, Lan D, Chen W, Matsuura F, Tall AR 2004 ATP-binding cassette transporters G1 and G4 mediate cellular cholesterol efflux to high-density lipoproteins. Proc Natl Acad Sci USA 101:9774–9779[Abstract/Free Full Text]
  10. Jian B, de la Llera-Moya M, Ji Y, Wang N, Phillips MC, Swaney JB, Tall AR, Rothblat GH 1998 Scavenger receptor class B type I as a mediator of cellular cholesterol efflux to lipoproteins and phospholipid acceptors. J Biol Chem 273:5599–5606[Abstract/Free Full Text]
  11. von Eckardstein A, Nofer JR, Assmann G 2001 High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport. Arterioscler Thromb Vasc Biol 21:13–27[Abstract/Free Full Text]
  12. Nicholls SJ, Rye KA, Barter PJ 2005 High-density lipoproteins as therapeutic targets. Curr Opin Lipidol 16:345–349[Medline]
  13. Rhoads GG, Gulbrandsen CL, Kagan A 1976 Serum lipoproteins and coronary heart disease in a population study of Hawaii Japanese men. N Engl J Med 294:293–298[Abstract]
  14. Kannel WB, Dawber TR, Kagan A, Revotskie N, Stokes III J1961 Factors of risk in the development of coronary heart disease–six year follow-up experience. The Framingham Study. Ann Intern Med 55:33–50
  15. Gordon DJ, Rifkind BM 1989 High-density lipoprotein–the clinical implications of recent studies. N Engl J Med 321:1311–1316[Medline]
  16. Volpe A, Coukos G, Uccelli E, Droghini F, Adamo R, Artini PG 1991 Follicular fluid lipoproteins in preovulatory period and their relationship with follicular maturation and progesterone production by human granulosa-luteal cells in vivo and in vitro. J Endocrinol Invest 14:737–742[Medline]
  17. Simpson ER, Rochelle DB, Carr BR, MacDonald PC 1980 Plasma lipoproteins in follicular fluid of human ovaries. J Clin Endocrinol Metab 51:1469–1471[Abstract/Free Full Text]
  18. Jaspard B, Fournier N, Vieitez G, Atger V, Barbaras R, Vieu C, Manent J, Chap H, Perret B, Collet X 1997 Structural and functional comparison of HDL from homologous human plasma and follicular fluid. A model for extravascular fluid. Arterioscler Thromb Vasc Biol 17:1605–1613[Abstract/Free Full Text]
  19. Le Goff D 1994 Follicular fluid lipoproteins in the mare: evaluation of HDL transfer from plasma to follicular fluid. Biochim Biophys Acta 1210:226–232[Medline]
  20. Shalgi R, Kraicer P, Rimon A, Pinto M, Soferman N 1973 Proteins of human follicular fluid: the blood-follicle barrier. Fertil Steril 24:429–434[Medline]
  21. Perret BP, Parinaud J, Ribbes H, Moatti JP, Pontonnier G, Chap H, Douste-Blazy L 1985 Lipoprotein and phospholipid distribution in human follicular fluids. Fertil Steril 43:405–409[Medline]
  22. Azhar S, Reaven E 2002 Scavenger receptor class BI and selective cholesteryl ester uptake: partners in the regulation of steroidogenesis. Mol Cell Endocrinol 195:1–26[CrossRef][Medline]
  23. Reaven E, Chen YD, Spicher M, Azhar S 1984 Morphological evidence that high density lipoproteins are not internalized by steroid-producing cells during in situ organ perfusion. J Clin Invest 74:1384–1397[Medline]
  24. Acton S, Rigotti A, Landschulz KT, Xu S, Hobbs HH, Krieger M 1996 Identification of scavenger receptor SR-BI as a high density lipoprotein receptor. Science 271:518–520[Abstract]
  25. Glass C, Pittman RC, Weinstein DB, Steinberg D 1983 Dissociation of tissue uptake of cholesterol ester from that of apoprotein A-I of rat plasma high density lipoprotein: selective delivery of cholesterol ester to liver, adrenal, and gonad. Proc Natl Acad Sci USA 80:5435–5439[Abstract/Free Full Text]
  26. Stein Y, Dabach Y, Hollander G, Halperin G, Stein O 1983 Metabolism of HDL-cholesteryl ester in the rat, studied with a nonhydrolyzable analog, cholesteryl linoleyl ether. Biochim Biophys Acta 752:98–105[Medline]
  27. Ji Y, Jian B, Wang N, Sun Y, Moya ML, Phillips MC, Rothblat GH, Swaney JB, Tall AR 1997 Scavenger receptor BI promotes high density lipoprotein-mediated cellular cholesterol efflux. J Biol Chem 272:20982–20985[Abstract/Free Full Text]
  28. Yancey PG, de la Llera-Moya M, Swarnakar S, Monzo P, Klein SM, Connelly MA, Johnson WJ, Williams DL, Rothblat GH 2000 High density lipoprotein phospholipid composition is a major determinant of the bi-directional flux and net movement of cellular free cholesterol mediated by scavenger receptor BI. J Biol Chem 275:36596–36604[Abstract/Free Full Text]
  29. Yancey PG, Bortnick AE, Kellner-Weibel G, de la Llera-Moya M, Phillips MC, Rothblat GH 2003 Importance of different pathways of cellular cholesterol efflux. Arterioscler Thromb Vasc Biol 23:712–719[Abstract/Free Full Text]
  30. Landschulz KT, Pathak RK, Rigotti A, Krieger M, Hobbs HH 1996 Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat. J Clin Invest 98:984–995[Medline]
  31. Svensson PA, Johnson MS, Ling C, Carlsson LM, Billig H, Carlsson B 1999 Scavenger receptor class B type I in the rat ovary: possible role in high density lipoprotein cholesterol uptake and in the recognition of apoptotic granulosa cells. Endocrinology 140:2494–2500[Abstract/Free Full Text]
  32. Li X, Peegel H, Menon KM 1998 In situ hybridization of high density lipoprotein (scavenger, type 1) receptor messenger ribonucleic acid (mRNA) during folliculogenesis and luteinization: evidence for mRNA expression and induction by human chorionic gonadotropin specifically in cell types that use cholesterol for steroidogenesis. Endocrinology 139:3043–3049[Abstract/Free Full Text]
  33. Reaven E, Nomoto A, Leers-Sucheta S, Temel R, Williams DL, Azhar S 1998 Expression and microvillar localization of scavenger receptor, class B, type I (a high density lipoprotein receptor) in luteinized and hormone-desensitized rat ovarian models. Endocrinology 139:2847–2856[Abstract/Free Full Text]
  34. Kocher O, Yesilaltay A, Cirovic C, Pal R, Rigotti A, Krieger M 2003 Targeted disruption of the PDZK1 gene in mice causes tissue-specific depletion of the HDL receptor SR-BI and altered lipoprotein metabolism. J Biol Chem 278:52820–52825[Abstract/Free Full Text]
  35. Yesilaltay A, Kocher O, Rigotti A, Krieger M 2005 Regulation of SR-BI-mediated high-density lipoprotein metabolism by the tissue-specific adaptor protein PDZK1. Curr Opin Lipidol 16:147–152[Medline]
  36. Ikemoto M, Arai H, Feng D, Tanaka K, Aoki J, Dohmae N, Takio K, Adachi H, Tsujimoto M, Inoue K 2000 Identification of a PDZ-domain-containing protein that interacts with the scavenger receptor class B type I. Proc Natl Acad Sci USA 97:6538–6543[Abstract/Free Full Text]
  37. Silver DL 2002 A carboxyl-terminal PDZ-interacting domain of scavenger receptor B, type I is essential for cell surface expression in liver. J Biol Chem 277:34042–34047[Abstract/Free Full Text]
  38. Rigotti A, Trigatti BL, Penman M, Rayburn H, Herz J, Krieger M 1997 A targeted mutation in the murine gene encoding the high density lipoprotein (HDL) receptor scavenger receptor class B type I reveals its key role in HDL metabolism. Proc Natl Acad Sci USA 94:12610–12615[Abstract/Free Full Text]
  39. Trigatti B, Rayburn H, Vinals M, Braun A, Miettinen H, Penman M, Hertz M, Schrenzel M, Amigo L, Rigotti A, Krieger M 1999 Influence of the high density lipoprotein receptor SR-BI on reproductive and cardiovascular pathophysiology. Proc Natl Acad Sci USA 96:9322–9327[Abstract/Free Full Text]
  40. Braun A, Zhang S, Miettinen HE, Ebrahim S, Holm TM, Vasile E, Post MJ, Yoerger DM, Picard MH, Krieger JL, Andrews NC, Simons M, Krieger M 2003 Probucol prevents early coronary heart disease and death in the high-density lipoprotein receptor SR-BI/apolipoprotein E double knockout mouse. Proc Natl Acad Sci USA 100:7283–7288[Abstract/Free Full Text]
  41. Van Eck M, Twisk J, Hoekstra M, Van Rij BT, Van der Lans CA, Bos IS, Kruijt JK, Kuipers F, Van Berkel TJ 2003 Differential effects of scavenger receptor BI deficiency on lipid metabolism in cells of the arterial wall and in the liver. J Biol Chem 278:23699–23705[Abstract/Free Full Text]
  42. Covey SD, Krieger M, Wang W, Penman M, Trigatti BL 2003 Scavenger receptor class B type I-mediated protection against atherosclerosis in LDL receptor-negative mice involves its expression in bone marrow-derived cells. Arterioscler Thromb Vasc Biol 23:1589–1594[Abstract/Free Full Text]
  43. Zhang S, Picard MH, Vasile E, Zhu Y, Raffai RL, Weisgraber KH, Krieger M 2005 Diet-induced occlusive coronary atherosclerosis, myocardial infarction, cardiac dysfunction, and premature death in scavenger receptor class B type I-deficient, hypomorphic apolipoprotein ER61 mice. Circulation 111:3457–3464[Abstract/Free Full Text]
  44. Miettinen HE, Rayburn H, Krieger M 2001 Abnormal lipoprotein metabolism and reversible female infertility in HDL receptor (SR-BI)-deficient mice. J Clin Invest 108:1717–1722[CrossRef][Medline]
  45. Azhar S, Nomoto A, Leers-Sucheta S, Reaven E 1998 Simultaneous induction of an HDL receptor protein (SR-BI) and the selective uptake of HDL-cholesteryl esters in a physiologically relevant steroidogenic cell model. J Lipid Res 39:1616–1628[Abstract/Free Full Text]
  46. Temel RE, Trigatti B, DeMattos RB, Azhar S, Krieger M, Williams DL 1997 Scavenger receptor class B, type I (SR-BI) is the major route for the delivery of high density lipoprotein cholesterol to the steroidogenic pathway in cultured mouse adrenocortical cells. Proc Natl Acad Sci USA 94:13600–13605[Abstract/Free Full Text]
  47. Wu Q, Sucheta S, Azhar S, Menon KM 2003 Lipoprotein enhancement of ovarian theca-interstitial cell steroidogenesis: relative contribution of scavenger receptor class B (type I) and adenosine 5'-triphosphate- binding cassette (type A1) transporter in high-density lipoprotein-cholesterol transport and androgen synthesis. Endocrinology 144:2437–2445[Abstract/Free Full Text]
  48. Gu X, Lawrence R, Krieger M 2000 Dissociation of the high density lipoprotein and low density lipoprotein binding activities of murine scavenger receptor class B type I (mSR-BI) using retrovirus library-based activity dissection. J Biol Chem 275:9120–9130[Abstract/Free Full Text]
  49. Simonet WS, Bucay N, Lauer SJ, Taylor JM 1993 A far-downstream hepatocyte-specific control region directs expression of the linked human apolipoprotein E and C-I genes in transgenic mice. J Biol Chem 268:8221–8229[Abstract/Free Full Text]
  50. Palmiter RD, Brinster RL 1986 Germ-line transformation of mice. Annu Rev Genet 20:465–499[CrossRef][Medline]
  51. Francone OL, Haghpassand M, Bennett JA, Royer L, McNeish J 1997 Expression of human lecithin:cholesterol acyltransferase in transgenic mice: effects on cholesterol efflux, esterification, and transport. J Lipid Res 38:813–822[Abstract]
  52. Kozarsky KF, Donahee MH, Rigotti A, Iqbal SN, Edelman ER, Krieger M 1997 Overexpression of the HDL receptor SR-BI alters plasma HDL and bile cholesterol levels. Nature 387:414–417[CrossRef][Medline]
  53. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, Vogelstein B 1998 A simplified system for generating recombinant adenoviruses. Proc Natl Acad Sci USA 95:2509–2514[Abstract/Free Full Text]
  54. Kozarsky KF, Jooss K, Donahee M, Strauss III JF, Wilson JM 1996 Effective treatment of familial hypercholesterolaemia in the mouse model using adenovirus-mediated transfer of the VLDL receptor gene. Nat Genet 13:54–62[CrossRef][Medline]
  55. Mardones P, Quinones V, Amigo L, Moreno M, Miquel JF, Schwarz M, Miettinen HE, Trigatti B, Krieger M, VanPatten S, Cohen DE, Rigotti A 2001 Hepatic cholesterol and bile acid metabolism and intestinal cholesterol absorption in scavenger receptor class B type I-deficient mice. J Lipid Res 42:170–180[Abstract/Free Full Text]
  56. Nervi F, Marinovic I, Rigotti A, Ulloa N 1988 Regulation of biliary cholesterol secretion. Functional relationship between the canalicular and sinusoidal cholesterol secretory pathways in the rat. J Clin Invest 82:1818–1825[CrossRef][Medline]
  57. Allain CC, Poon LS, Chan CS, Richmond W, Fu PC 1974 Enzymatic determination of total serum cholesterol. Clin Chem 20:470–475[Abstract]
  58. Guo Q, Penman M, Trigatti BL, Krieger M 1996 A single point mutation in {epsilon}-COP results in temperature-sensitive, lethal defects in membrane transport in a Chinese hamster ovary cell mutant. J Biol Chem 271:11191–11196[Abstract/Free Full Text]
  59. Furbee Jr JW, Francone O, Parks JS 2001 Alteration of plasma HDL cholesteryl ester composition with transgenic expression of a point mutation (E149A) of human LCAT. J Lipid Res 42:1626–1635[Abstract/Free Full Text]
  60. Chen CH, Albers JJ 1982 Characterization of proteoliposomes containing apoprotein A-I: a new substrate for the measurement of lecithin: cholesterol acyltransferase activity. J Lipid Res 23:680–691[Abstract]
  61. Ji Y, Wang N, Ramakrishnan R, Sehayek E, Huzsar D, Breslow JL, Tall AR 1999 Hepatic scavenger receptor BI promotes rapid clearance of high density lipoprotein free cholesterol and its transport into bile. J Biol Chem 274:33398–33402[Abstract/Free Full Text]
  62. Arai T, Wang N, Bezouevski M, Welch C, Tall AR 1999 Decreased atherosclerosis in heterozygous low density lipoprotein receptor-deficient mice expressing the scavenger receptor BI transgene. J Biol Chem 274:2366–2371[Abstract/Free Full Text]
  63. Wang N, Arai T, Ji Y, Rinninger F, Tall AR 1998 Liver-specific overexpression of scavenger receptor BI decreases levels of very low density lipoprotein ApoB, low density lipoprotein ApoB, and high density lipoprotein in transgenic mice. J Biol Chem 273:32920–32926[Abstract/Free Full Text]
  64. Gu X, Kozarsky K, Krieger M 2000 Scavenger receptor class B, type I-mediated [3H]cholesterol efflux to high and low density lipoproteins is dependent on lipoprotein binding to the receptor. J Biol Chem 275:29993–30001[Abstract/Free Full Text]
  65. Horowitz BS, Goldberg IJ, Merab J, Vanni TM, Ramakrishnan R, Ginsberg HN 1993 Increased plasma and renal clearance of an exchangeable pool of apolipoprotein A-I in subjects with low levels of high density lipoprotein cholesterol. J Clin Invest 91:1743–1752[Medline]
  66. Brinton EA, Eisenberg S, Breslow JL 1989 Elevated high density lipoprotein cholesterol levels correlate with decreased apolipoprotein A-I and A-II fractional catabolic rate in women. J Clin Invest 84:262–269[Medline]
  67. Glomset JA 1962 The mechanism of the plasma cholesterol esterification reaction: plasma fatty acid transferase. Biochim Biophys Acta 65:128–135[Medline]
  68. Ma K, Forte T, Otvos JD, Chan L 2005 Differential additive effects of endothelial lipase and scavenger receptor-class B type I on high-density lipoprotein metabolism in knockout mouse models. Arterioscler Thromb Vasc Biol 25:149–154[Abstract/Free Full Text]
  69. Vaisman BL, Klein HG, Rouis M, Berard AM, Kindt MR, Talley GD, Meyn SM, Hoyt RF, Marcovina SM, Albers JJ, Hoeg JM, Brewer HB, Santamarina-Fojo S 1995 Overexpression of human lecithin cholesterol acyltransferase leads to hyperalphalipoproteinemia in transgenic mice. J Biol Chem 270:12269–12275[Abstract/Free Full Text]
  70. Ueda Y, Royer L, Gong E, Zhang J, Cooper PN, Francone O, Rubin EM 1999 Lower plasma levels and accelerated clearance of high density lipoprotein (HDL) and non-HDL cholesterol in scavenger receptor class B type I transgenic mice. J Biol Chem 274:7165–7171[Abstract/Free Full Text]
  71. Sehayek E, Ono JG, Shefer S, Nguyen LB, Wang N, Batta AK, Salen G, Smith JD, Tall AR, Breslow JL 1998 Biliary cholesterol excretion: a novel mechanism that regulates dietary cholesterol absorption. Proc Natl Acad Sci USA 95:10194–10199[Abstract/Free Full Text]
  72. Braun A, Trigatti BL, Post MJ, Sato K, Simons M, Edelberg JM, Rosenberg RD, Schrenzel M, Krieger M 2002 Loss of SR-BI expression leads to the early onset of occlusive atherosclerotic coronary artery disease, spontaneous myocardial infarctions, severe cardiac dysfunction, and premature death in apolipoprotein E-deficient mice. Circ Res 90:270–276[Abstract/Free Full Text]
  73. Kocher O, Pal R, Roberts M, Cirovic C, Gilchrist A 2003 Targeted disruption of the PDZK1 gene by homologous recombination. Mol Cell Biol 23:1175–1180[Abstract/Free Full Text]
  74. Ng DS, Francone OL, Forte TM, Zhang J, Haghpassand M, Rubin EM 1997 Disruption of the murine lecithin:cholesterol acyltransferase gene causes impairment of adrenal lipid delivery and up-regulation of scavenger receptor class B type I. J Biol Chem 272:15777–15781[Abstract/Free Full Text]
  75. Liu M, Bagdade JD, Subbaiah PV 1995 Specificity of lecithin:cholesterol acyltransferase and atherogenic risk: comparative studies on the plasma composition and in vitro synthesis of cholesteryl esters in 14 vertebrate species. J Lipid Res 36:1813–1824[Abstract]
  76. Kellner-Weibel G, Geng YJ, Rothblat GH 1999 Cytotoxic cholesterol is generated by the hydrolysis of cytoplasmic cholesteryl ester and transported to the plasma membrane. Atherosclerosis 146:309–319[CrossRef][Medline]
  77. Kellner-Weibel G, Jerome WG, Small DM, Warner GJ, Stoltenborg JK, Kearney MA, Corjay MH, Phillips MC, Rothblat GH 1998 Effects of intracellular free cholesterol accumulation on macrophage viability: a model for foam cell death. Arterioscler Thromb Vasc Biol 18:423–431[Abstract/Free Full Text]
  78. Warner GJ, Stoudt G, Bamberger M, Johnson WJ, Rothblat GH 1995 Cell toxicity induced by inhibition of acyl coenzyme A:cholesterol acyltransferase and accumulation of unesterified cholesterol. J Biol Chem 270:5772–5778[Abstract/Free Full Text]
  79. Holm TM, Braun A, Trigatti BL, Brugnara C, Sakamoto M, Krieger M, Andrews NC 2002 Failure of red blood cell maturation in mice with defects in the high-density lipoprotein receptor SR-BI. Blood 99:1817–1824[Abstract/Free Full Text]
  80. Mardones P, Rigotti A 2004 Cellular mechanisms of vitamin E uptake: relevance in {alpha}-tocopherol metabolism and potential implications for disease. J Nutr Biochem 15:252–260[CrossRef][Medline]
  81. de la Llera-Moya M, Rothblat GH, Connelly MA, Kellner-Weibel G, Sakr SW, Phillips MC, Williams DL 1999 Scavenger receptor BI (SR-BI) mediates free cholesterol flux independently of HDL tethering to the cell surface. J Lipid Res 40:575–580[Abstract/Free Full Text]
  82. Mazzone T, Krishna M, Lange Y 1995 Progesterone blocks intracellular translocation of free cholesterol derived from cholesteryl ester in macrophages. J Lipid Res 36:544–551[Abstract]
  83. Lange Y, Steck TL 1994 Cholesterol homeostasis. Modulation by amphiphiles. J Biol Chem 269:29371–29374[Abstract/Free Full Text]
  84. Christenson LK, Devoto L 2003 Cholesterol transport and steroidogenesis by the corpus luteum. Reprod Biol Endocrinol 1:90[CrossRef][Medline]
  85. Balestrieri M, Cigliano L, Simone ML, Dale B, Abrescia P 2001 Haptoglobin inhibits lecithin-cholesterol acyltransferase in human ovarian follicular fluid. Mol Reprod Dev 59:186–191[CrossRef][Medline]
  86. Jaspard B, Collet X, Barbaras R, Manent J, Vieu C, Parinaud J, Chap H, Perrett B 1996 Biochemical characterization of pre-ß1 high-density lipoprotein from human ovarian follicular fluid: evidence for the presence of a lipid core. Biochemistry 35:1352–1357[CrossRef][Medline]
  87. Cigliano L, Spagnuolo MS, Dale B, Balestrieri M, Abrescia P 2001 Estradiol esterification in the human preovulatory follicle. Steroids 66:889–896[CrossRef][Medline]
  88. Denis M, Haidar B, Marcil M, Bouvier M, Krimbou L, Genest Jr J2004 Molecular and cellular physiology of apolipoprotein A-I lipidation by the ATP-binding cassette transporter A1 (ABCA1). J Biol Chem 279:7384–7394
  89. Liu L, Bortnick AE, Nickel M, Dhanasekaran P, Subbaiah PV, Lund-Katz S, Rothblat GH, Phillips MC 2003 Effects of apolipoprotein A-I on ATP-binding cassette transporter A1-mediated efflux of macrophage phospholipid and cholesterol: formation of nascent high density lipoprotein particles. J Biol Chem 278:42976–42984[Abstract/Free Full Text]
  90. Kennedy MA, Barrera GC, Nakamura K, Baldan A, Tarr P, Fishbein MC, Frank J, Francone OL, Edwards PA 2005 ABCG1 has a critical role in mediating cholesterol efflux to HDL and preventing cellular lipid accumulation. Cell Metabolism 1:121–131
  91. Christiansen-Weber TA, Voland JR, Wu Y, Ngo K, Roland BL, Nguyen S, Peterson PA, Fung-Leung WP 2000 Functional loss of ABCA1 in mice causes severe placental malformation, aberrant lipid distribution, and kidney glomerulonephritis as well as high-density lipoprotein cholesterol deficiency. Am J Pathol 157:1017–1029[Abstract/Free Full Text]
  92. McNeish J, Aiello RJ, Guyot D, Turi T, Gabel C, Aldinger C, Hoppe KL, Roach ML, Royer LJ, de Wet J, Broccardo C, Chimini G, Francone OL 2000 High density lipoprotein deficiency and foam cell accumulation in mice with targeted disruption of ATP-binding cassette transporter-1. Proc Natl Acad Sci USA 97:4245–4250[Abstract/Free Full Text]
  93. Orso E, Broccardo C, Kaminski WE, Bottcher A, Liebisch G, Drobnik W, Gotz A, Chambenoit O, Diederich W, Langmann T, Spruss T, Luciani MF, Rothe G, Lackner KJ, Chimini G, Schmitz G 2000 Transport of lipids from golgi to plasma membrane is defective in tangier disease patients and Abc1-deficient mice. Nat Genet 24:192–196[CrossRef][Medline]
  94. Williamson R, Lee D, Hagaman J, Maeda N 1992 Marked reduction of high density lipoprotein cholesterol in mice genetically modified to lack apolipoprotein A-I. Proc Natl Acad Sci USA 89:7134–7138[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Hum Reprod UpdateHome page
V. Y. Fujimoto, J. P. Kane, B. Y. Ishida, M. S. Bloom, and R. W. Browne
High-density lipoprotein metabolism and the human embryo
Hum. Reprod. Update, January 1, 2010; 16(1): 20 - 38.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Fenske, A. Yesilaltay, R. Pal, K. Daniels, C. Barker, V. Quinones, A. Rigotti, M. Krieger, and O. Kocher
Normal Hepatic Cell Surface Localization of the High Density Lipoprotein Receptor, Scavenger Receptor Class B, Type I, Depends on All Four PDZ Domains of PDZK1
J. Biol. Chem., February 27, 2009; 284(9): 5797 - 5806.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. A. Fenske, A. Yesilaltay, R. Pal, K. Daniels, A. Rigotti, M. Krieger, and O. Kocher
Overexpression of the PDZ1 Domain of PDZK1 Blocks the Activity of Hepatic Scavenger Receptor, Class B, Type I by Altering Its Abundance and Cellular Localization
J. Biol. Chem., August 8, 2008; 283(32): 22097 - 22104.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
R.W. Browne, W.B. Shelly, M.S. Bloom, A.J. Ocque, J.R. Sandler, H.G. Huddleston, and V.Y. Fujimoto
Distributions of high-density lipoprotein particle components in human follicular fluid and sera and their associations with embryo morphology parameters during IVF
Hum. Reprod., August 1, 2008; 23(8): 1884 - 1894.
[Abstract] [Full Text] [PDF]


Home page
Arterioscler. Thromb. Vasc. Bio.Home page
V. S. Dole, J. Matuskova, E. Vasile, A. Yesilaltay, W. Bergmeier, M. Bernimoulin, D. D. Wagner, and M. Krieger
Thrombocytopenia and Platelet Abnormalities in High-Density Lipoprotein Receptor-Deficient Mice
Arterioscler Thromb Vasc Biol, June 1, 2008; 28(6): 1111 - 1116.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
L. Miranda-Jimenez and B. D. Murphy
Lipoprotein receptor expression during luteinization of the ovarian follicle
Am J Physiol Endocrinol Metab, October 1, 2007; 293(4): E1053 - E1061.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
J.-Y. Lee, R. M. Badeau, A. Mulya, E. Boudyguina, A. K. Gebre, T. L. Smith, and J. S. Parks
Functional LCAT deficiency in human apolipoprotein A-I transgenic, SR-BI knockout mice
J. Lipid Res., May 1, 2007; 48(5): 1052 - 1061.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Yesilaltay, O. Kocher, R. Pal, A. Leiva, V. Quinones, A. Rigotti, and M. Krieger
PDZK1 Is Required for Maintaining Hepatic Scavenger Receptor, Class B, Type I (SR-BI) Steady State Levels but Not Its Surface Localization or Function
J. Biol. Chem., September 29, 2006; 281(39): 28975 - 28980.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. D. Attie
A liver-high-density lipoprotein-ovarian axis of fertility.
Endocrinology, April 1, 2006; 147(4): 1575 - 1576.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yesilaltay, A.
Right arrow Articles by Krieger, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yesilaltay, A.
Right arrow Articles by Krieger, M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals