help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1080
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vesper, A. H.
Right arrow Articles by Camper, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vesper, A. H.
Right arrow Articles by Camper, S. A.
Endocrinology Vol. 147, No. 4 1654-1663
Copyright © 2006 by The Endocrine Society

Role of Prophet of Pit1 (PROP1) in Gonadotrope Differentiation and Puberty

Amanda H. Vesper, Lori T. Raetzman and Sally A. Camper

Department of Human Genetics (A.H.V., S.A.C.), University of Michigan, Ann Arbor, Michigan 48109-0638; and Department of Molecular and Integrative Physiology (L.T.R.), University of Illinois at Urbana-Champaign, Urbana, Illinois 61801

Address all correspondence and requests for reprints to: Sally A. Camper, Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109-0618. E-mail: scamper{at}umich.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The prophet of Pit1 (PROP1) gene is essential for normal gonadotropin production in both humans and mice. Transgenic mice that overexpress PROP1 in gonadotropes and thyrotropes have transient hypogonadotropic hypogonadism and increased risk of pituitary adenomas. Here we report a temporal study of pituitary gonadotrope terminal differentiation and hypogonadism, delayed onset of puberty, and transient growth insufficiency in the transgenic males. The Prop1 transgenic mice recover from their abnormalities and exhibit normal size and fertility at 3 months. The relatively normal expression pattern of GnRH receptor (Gnrhr) suggests that the pituitary gonadotrope cell lineage is appropriately specified, but the ability to synthesize LH and FSH is impaired by excess PROP1. We report no obvious abnormalities in expression of the transcription factors early growth response 1, NR5A1, GATA2, TBX19, and NR0B1, or the TGFß pathway members including activin, inhibin, and activin receptors. Thus, overexpression of PROP1 may influence gonadotrope development by a novel mechanism. Microarray analysis identified the inhibitory transmembrane receptor gene Klrg1 and the protease gene Prss28 as candidates for involvement in this process. We hypothesize that variation in PROP1 expression could affect the growth spurt and the onset of puberty in humans.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
FERTILITY IN BOTH males and females relies on complex physiological and molecular processes with many levels of regulation. The hypothalamic-pituitary-gonadal (HPG) axis is fundamental to the onset of puberty and the endocrine system’s control of spatial and temporal events regulating gametogenesis in mammals. The pituitary gonadotropins, FSH and LH, are produced within gonadotrope cells of the anterior pituitary, and act at the level of the gonads, where they bind G protein-coupled transmembrane receptors to regulate follicular development, ovulation, and steroidogenesis in females, and spermatogenesis, testicular growth, and steroidogenesis in males. Although they are structurally related and produced within the same cells, FSH and LH have different functions and are regulated and posttranscriptionally processed in different ways. The functional differences are evident from FSH and LH ligand and receptor knockout mouse phenotypes. Fshb knockout males have normal fertility with decreased testis size, and females are sterile (1). Similarly, FSH receptor knockout males are fertile with low sperm count, small testicles, and delayed puberty compared with wild-type males, and females are infertile due to preantral block in folliculogenesis (2). Both male and female Lhb knockouts and LH receptor knockouts have hypogonadism and infertility (3, 4, 5). Hypothalamic production of GnRH and signaling through pituitary GnRH receptors is essential for maintenance of serum gonadotropin levels, and ultimately for fertility in mammals. Mutations in the GnRH receptor (Gnrhr) gene cause hypogonadotrophic hypogonadism (HHG) in humans (6).

Gonadotropes are among the last of the five distinct hormone-producing cell types to be fully differentiated in rodent pituitary development (7). Lhb transcripts are normally detected by e16.5 and Fshb by e18.5 in the mouse pituitary. The commitment of gonadotropes is thought to depend on the production of bone morphogenetic protein (BMP) 2 in the ventral mesenchyme, which induces GATA binding protein 2 (GATA2) expression in the ventral aspect of the adjacent pituitary primordium at embryonic d 10.5 (e10.5) (8). GATA2 and PIT1 may act antagonistically to regulate cell fate choice between gonadotropes and the Pit1 lineage. In the absence of PIT1, more precursor cells differentiate into gonadotropes, presumably because of the unopposed action of GATA2.

Several pituitary transcription factors have been shown to be important in gonadotrope development or gonadotrope production by analysis of knockout mouse models. Unlike the absolute requirement for Pit1 in specification of somatotropes, thyrotropes, and lactotropes, no single transcription factor clearly directs gonadotrope commitment. The genes Nr5a, Nrob1, Egr1, and Nupr1 are tied to gonadotropin subunit gene expression. The nuclear receptor NR5A1 (steroidogenic factor 1) regulates Lhb expression directly (9), and pituitary-specific Nr5a1 knockout mice have no detectable LH or FSH (10). The requirement for NR5A1 is not absolute because GnRH stimulation is sufficient to induce LH and FSH expression in NR5A1-deficient mice (11). Lack of the orphan nuclear receptor NR0B1 [dosage-sensitive sex reversal congenital adrenal hypoplasia 1 (DAX1)] also causes LH and FSH deficiency (12). The zinc finger transcription factor early growth response 1 (EGR1) is required for Lhb but not Fshb transcription (13). The HMG box transcription factor p8 (NUPR1) is proposed to have a role in terminal differentiation of gonadotropes and expression of Lhb, but the requirement for this factor in gonadotrope development is still under investigation (14).

Recently, the T-box transcription factor TBX19 and the homeobox-containing transcription factors OTX1 (orthodenticle homolog 1) and PITX2 (paired-like homeodomain transcription factor 2) (15, 16, 17) have been implicated in gonadotrope differentiation. In the absence of Tbx19, the intermediate lobe cells of the pituitary differentiate into gonadotropes and PIT1-independent thyrotropes, instead of melanotropes. Also, overexpression of Tbx19 in mouse pituitaries represses the gonadotrope lineage, suggesting that Tbx19 is a negative regulator of gonadotrope differentiation (16). Hypomorphic Pitx2 mutant mice fail to activate several transcription factors critical for gonadotrope cell lineage specification including Gata2, Nr5a1, and Egr1, revealing the importance of Pitx2 dosage for gonadotrope differentiation (17). In addition, the Otx1 null mice exhibit a prepubescent period of dwarfism and hypogonadism owing to decreases in GH, FSH, and LH; the condition corrects itself by 4 months of age (15). The basis for eventual compensation in Otx1-deficient mice is unknown, but it suggests that gonadotrope transcription factors may have overlapping roles or varying importance at different developmental times.

Signaling molecules play an important role in gonadotrope function and may also be important in stimulating terminal differentiation (18). Members of the TGF-ß family regulate FSH production. For example, activin up-regulates Fshb, and this effect is antagonized by inhibin (19, 20). Follistatin binds and inactivates activin, resulting in reduced FSH production (21).

Prop1 encodes a paired-like homeodomain transcription factor required for pituitary organogenesis and is expressed from e10.5–e16.5 (22, 23, 24). Ames dwarf mice (Prop1 df/df) have an inactivating missense mutation that causes growth insufficiency, hypothyroidism, and infertility. In the absence of Prop1, the POU-homeodomain transcription factor gene Pit1 is not activated, resulting in failure to specify three cell types: somatotropes, lactotropes, and thyrotropes. LH and FSH levels are reduced in Prop1 mutant mice, but the mechanism underlying this deficiency is still not clear (23).

Mutations in the prophet of Pit1 (PROP1) gene are the most common known cause of multiple pituitary hormone deficiency (MPHD) in humans (25, 26). The clinical features of MPHD patients vary, and the hormone deficiencies tend to be progressive, usually presenting with GH, TSH, prolactin (PRL), and gonadotropin deficiency and developing more severe hormone deficiencies over time, eventually including ACTH insufficiency (27). One documented 15-yr-old patient with an Arg120Cys mutation in PROP1 had not undergone puberty and was 2 SDs below normal height at the age of 15 due to a failed pubertal growth spurt. The patients’ basal serum concentrations of GH, LH, and FSH, were low and unresponsive to stimulation, whereas ACTH, PRL, and TSH levels were modestly low (28). The features of this patient emphasize the role of PROP1 plays in the production of gonadotropins and the onset of puberty.

To study the influence of Prop1 on gonadotropes and puberty we generated a Prop1 transgenic mouse line that overexpresses Prop1 persistently. The mice have decreased expression of Lhb and Fshb and exhibit transient hypogonadism (29). These findings suggest that Prop1 repression is important for the development and differentiation of gonadotropes. Here we report a thorough investigation of the physiological consequences of excess Prop1 and describe the mechanism whereby Prop1 inhibits gonadotrope development.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animal husbandry
Mice carrying the {alpha}-glycoprotein hormone subunit (GSU)-Prop1 transgene were generated by microinjection as described (29), and the TgN(Cga-Prop1)D6Sac line was bred at the University of Michigan on to the C57BL/6J background (B6) for seven generations. Male mice were separately housed and females were housed five animals per cage. All mice were fed LabDiet 5020 (Richmond, IN) high-fat chow. Transgenic mice were identified by PCR amplification of genomic DNA from tail biopsies (29). Blood was collected by cardiac puncture after the mice were euthanized, and their heart was still beating. After collection, the blood clotted at room temperature for 90 min and then centrifuged at 200 x g for 15 min. After centrifugation, the serum was placed in a polypropylene tube and sent to the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core and analyzed for mouse FSH concentrations by RIA. All the mice were maintained according to the National Institutes of Health guidelines for the Care and Use of Experimental Animals.

Urinalysis for major urinary proteins (MUPs)
Urine was collected from transgenic and wild-type mice every 5 d starting at 20 d of age to 40 d of age. Urine samples where placed on ice for 5 min and centrifuged at ~13,000 rpm for 5 min and supernatant was removed from pellet. One microliter of urine supernatant was mixed with 19 µl 1x Stacking Gel Buffer [4x Stacking gel buffer: 0.5 M Tris HCl (pH 6.8)] and 4 µl 6x SDS-PAGE Gel Loading Dye. Samples were boiled for 5 min and cooled on ice. A total of 2.4 µl of sample was loaded onto a 10% SDS-PAGE gel and ran at 25 mA constant current until bromophenol blue dye front was about 1 cm from bottom of gel. Gel was stained with Coomassie Blue dye overnight. Gel was destained with De-stain Solution I (40% methanol, 7% acetic acid) for approximately 1 h, while changing solution every 20 min. Gel was destained with De-stain Solution II (5% methanol, 7% acetic acid) following the same method used with De-stain Solution I. Gel was photographed using visible light.

Immunochemistry and in situ hybridization
Timed pregnancies were produced using sexually mature females. The morning after mating was designated as e0.5 and the day of birth as P1. Collected testes, embryos, P1, and P8 heads were fixed for 2–4 h in 4% paraformaldehyde in PBS (pH 7.2) at room temperature, dehydrated in a graded series of ethanol, and embedded in paraffin. Six-micrometer sections were prepared for immunochemistry and in situ hybridization.

Pituitary cell populations were examined by immunochemistry with antibodies against different pituitary hormone markers. Immunostaining was carried out with polyclonal antisera against rat LHß (1:1500, AFP22238790GPOLHB), rat TSHß (1:1000, AFP1274789TSHb), and rat FSHß (1:1800, 85GP9691bFSHb) (National Hormone and Pituitary Program, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD).

Antiserum against NR0B1 was provided by Dr. Paolo Sassone-Corsi (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Centre National de la Recherche Scientifique/Institut National de la Santé et de la Recherche Médicale/Université Louis Pasteur, College de France, Illkirch, Strasbourg, France) and was used at a 1:1000 dilution on paraffin sections. Antisera against NR5A1 was provided by Dr. Ken-Ichirou Morohashi (National Institute for Basic Biology, Okazaki, Japan) and was used on paraffin sections at a 1:1500 dilution (30). Antisera for PIT1 was provided by Dr. Simon Rhodes (Department of Biology, Indiana University-Purdue University, Indianapolis, IN) and was used on paraffin sections at a 1:2000 dilution (31). Antiserum against ActR-1 was provided by Dr. Kenji Okazaki (Department of Molecular Biology, Biomolecular Institute, Osaka, Japan) and was used on paraffin sections at a 1:5000 dilution. The sections were incubated with hypoxanthine guanine phosphoribosyl transferase (HPRT)-conjugated sheep antirat Ig.

All other sections were incubated in biotinylated secondary antibodies in conjunction with avidin, biotinylated peroxidase, Mouse on Mouse, guinea pig, and rabbit kits (Vector Laboratories, Burlingame, CA) and were amplified by using tyramide signal amplification: tetramethylrhodamine kit (PerkinElmer Life Sciences, Foster City, CA) or diaminobenzidine (Sigma, St. Louis, MO) which produces a brown precipitate. Most slides where counterstained with Methyl Green (Vector Labs).

Dr. David Gordon (University of Colorado Health Science Center, Denver, CO) provided a plasmid-containing mouse Gata2 genomic sequence in pGEM13. Mouse Egr1 cDNA was provided by Dr. Vikas Sukhatme (Harvard Medical Center, Boston, MA) and was subcloned into pBLUESCRIPT SK (+) (pSK+; Stratagene, La Jolla, CA). A plasmid-containing mouse Prss28 genomic series in pBK-CMV vector was provided by Dr. Derrick Rancourt (University of Calgary, Alberta, Canada). RNA isolated from P1 {alpha}GSU-Prop1 pituitaries (as described below) and the Klrg1 riboprobe was generated by PCR amplification of a 360-bp product using the forward primer, 5' TGGGTCTGGGGAATCTTTGTC 3' and the reverse primer, 5'GGTGTTTGCGTCTTTCTGTCTTG 3'. The PCR was performed under the following conditions: 92 C for 3 min, followed by 40 cycles of 92 C for 30 sec, followed by annealing temperature of 56 C for 30 sec, and 72 C for 30 sec, followed by a final extension at 72 C for 10 min. PCR products were purified using a QIAquick PCR Purifaction kit (QIAGEN, Valencia, CA) and sequenced to confirm identity. The purified fragment was cloned into pGEM-T Easy cloning vector (Promega, Madison, WI). Klrg1 was linearized with ApaI and labeled with SP6 polymerase. The probed was diluted 1:100 and hybridized at 50 C. Both the Gata2 and Egr1 plasmids where linearized, riboprobe generated, labeled, and hybridized as previously described (17, 29). All riboprobes were generated and labeled with digoxigenin and precipitated with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (Roche Molecular Biochemicals, Indianapolis, IN) following previously described methods (17, 29).

Isolation of total RNA from newborn pituitaries
These studies involved two experimental groups: wild-type and {alpha}GSU-Prop1 transgenic mice. For each experimental group, we pooled pituitaries from 8 P1 mice to isolate RNA and collected three independent RNA samples for each experimental group. Pituitaries were collected and stored immediately in RNAlater (Ambion, Austin, TX) at –20 C. After the genotypes of the pituitaries were determined, the RNAlater was removed and the pituitaries of the same genotype were pooled in 500 µl lysis buffer form the RNAqueous Micro Kit (Ambion). Pooled pituitaries were homogenized using an Ultra-Turrax T8 homogenizer (IKA, Wilmington, NC). Total RNA was isolated with the RNAqueous Micro Kit (Ambion) according to manufacturer’s instructions. RNA was also isolated from pools of two wild-type and two {alpha}GSU-Prop1 transgenic P1 pituitaries of the same genotype for validation by RT quantitative PCR (RT-qPCR). Homogenization and RNA isolation was done as described above. To assess RNA quality for the microarray, total RNA was analyzed by capillary electrophoresis on an Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, Ca) in the UMCCC Affymetrix (Santa Clara, CA) and cDNA Microarray Core to visualize and quantitate 18S and 28S ribosomal bands. UV spectrophotometry was used to access the quality and concentration of total RNA for RT-qPCR.

Microarray analysis
Pituitary gene expression was determined with Mouse Genome 430 2.0 GeneChip oligonucleotide arrays (Affymetrix). Total RNA (2–5 µg) from eight pools of pituitary tissue was used. Synthesis of cRNA, hybridization to chips, and washes were performed in the University of Michigan Affymetrix and cDNA Microarray Core according to the manufacturer’s protocol and as described previously (32). RNA samples were processed together, three RNA samples for each of the two experimental groups (wild-type and {alpha}GSU-Prop1 transgenic). After hybridization, GeneChips were scanned at 1.5-µm density with GeneChip Scanner 3000 (Affymetrix).

Data analysis
Data analysis was performed in the University of Michigan Affymetrix and cDNA Microarray Core. Perfect match values, not the differences between perfect match and mismatch values, were normalized using a quantile normalization procedure. Expression values were calculated using Robust Multiarray average in the Bioconductor library of R statistical language (33). We used RT-qPCR to validate gene expression changes for genes that exhibited a fold change of 1.5 or greater on the microarray.

Quantitative RT-PCR (RT-qPCR)
First-strand cDNA was synthesized from total RNA (1 µg) using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

For each gene assayed, real-time PCR was performed on duplicate cDNA samples in a Prism 7000 Sequence Detection System with TaqMan probes (Assays-on-Demand, Applied Biosystems, Foster City, CA). We determined the level of HPRT, a housekeeping gene whose expression remained relatively constant between the two experimental groups, for each RNA sample as an internal control. CT, the threshold cycle, is defined as the PCR cycle at which the fluorescence intensity crosses a manually determined threshold value, at a level where the fluorescent signal is appreciably above the background level but is still in the early exponential phase of amplification. The same threshold was used for all genes of interest and HPRT (internal control) across all samples. The difference in CT between the gene of interest (gene "X") and HPRT for any given RNA sample was defined as {Delta}CT(X). The difference in {Delta}CT(x) between two samples was defined as {Delta}{Delta}CT(X), which represented a relative difference in expression of gene X. The fold change of gene X relative to HPRT was defined as 2-{Delta}{Delta}CT (X) (34).

Statistical analysis
We used StatView software (Cary, NC) to calculate statistical significance and to create graphs of mouse weight vs. age.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Overexpression of Prop1 affects LH and FSH production in the anterior pituitary
We previously reported analysis of two Prop1-expressing transgenic mouse lines on a mixed genetic background (29). To reduce the effects of genetic background, we back-crossed the D6 line to B6 seven times, which gives a theoretical purification of 99.2%. On the mixed background, the D6 {alpha}GSU-Prop1 transgenic mice have incomplete gonadotrope differentiation at age P1 but apparently normally differentiation by 4 wk of age. We characterized the gonadotrope phenotype of the D6 line on the B6 background using quantitative PCR (Q-PCR), in situ hybridization, and immunohistochemistry at multiple developmental time points. Q-PCR revealed that Prop1 transcripts are approximately 100-fold more abundant in the transgenic pituitaries at P1 compared with wild type (Table 1Go). In situ hybridization revealed similar levels of Gnrhr transcripts in wild-type and {alpha}GSU-Prop1 transgenic P1 mice (data not shown), and we confirmed this by Q-PCR (Table 1Go). This indicates gonadotrope commitment has taken place. Hormone expression was assessed by immunohistochemistry of pituitary sections from wild-type and {alpha}GSU-Prop1Tg mice at e16.5 and P1 (Fig. 1Go). TSH was detectable at e16.5, but LH and FSH were not (Fig. 1Go, A–F). At P1, wild types had more LH immunoreactive cells than transgenics, and FSH-positive cells were detected in wild types, but none were detected in transgenics (Fig. 1Go, G–L). We used Q-PCR to confirm that Tshb mRNA levels are unchanged at P1, and we detected a 9-fold decrease in Lhb, and a 32-fold decrease in Fshb compared with P1 wild-type pituitaries (Table 1Go). At P7, both FSH and LH are detectable in the {alpha}GSU-Prop1 transgenic mice and the number of immunoreactive cells appears similar. (Fig. 1Go, M–S).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Fold change of RNA between postnatal d 1 wild-type and transgenic pituitaries

 

Figure 1
View larger version (110K):
[in this window]
[in a new window]
 
FIG. 1. Persistent Prop1 expression results in delay of gonadotrope differentiation. A–R, Immunohistochemistry with antibodies for various anterior pituitary hormones was performed in {alpha}GSU-Prop1 transgenic and nontransgenic animals at the ages of e16.5, postnatal d 1 (P1), and P7. Immunohistochemical staining with a TSHß antibody is visualized by the brown precipitate of diaminobenzidine (DAB). There is no difference in the TSHß IHC between transgenic and nontransgenic animals at all investigated ages (C, F, I, L, O, and R). LHß immunohistochemistry suggests a slight delay in differentiation of LH-specific gonadotropes, but differentiation seems to fully recover by age P7 (A, D, G, J, M, and P). FSHß immonohistochemistry reveals a total lack in development of FSH-positive gonadotropes in the transgenic mice at age P1 compared with the nontransgenic mice (H and K). At 7 d of age the gonadotropes appear to have caught up in differentiation and production of FSHß (N and Q). P, Posterior lobe; I, intermediate Lobe; A, anterior lobe; wt, wild type; Tg, transgenic.

 
Persistent Prop1 expression results in delayed growth in male mice
On a mixed background, the physical growth of the D4 and D6 {alpha}-GSU-Prop1Tg mice appeared similar relative to the wild-type littermates. However, on the B6 background, the D6 {alpha}GSU-Prop1Tg mice looked visibly smaller than wild-type mice at time of weaning. We weighed the B6 (n = 7) {alpha}GSU-Prop1Tg and wild-type mice of both sexes once a week, from 2–12 wk of age. The {alpha}GSU-Prop1Tg male body weights were significantly (P < 0.05) lower than the wild-type male body weights from the age of 5–8 wk (Fig 2AGo). The transgenic males caught up to the size of the wild-type male mice completely by 12 wk of age. In contrast, the female transgenic and wild-type mouse weights did not differ significantly at any time during development. The weight difference between the male transgenic mice and male wild-type mice is consistent with the expectation for low testosterone levels (35). Q-PCR of GH at age P1 showed no significant decrease in the amount of transcripts in the transgenic mice compared with the wild-type mice (Table 1Go).


Figure 2
View larger version (36K):
[in this window]
[in a new window]
 
FIG. 2. Evidence of delayed puberty in male transgenic mice. A, Persistent Prop1 expression delays growth in male mice. The weights of {alpha}GSU-Prop1 transgenic (black shape) and nontransgenic (white shape) male (square) and female (circle) mice were weighed once a week over a 15-wk period. A significant weight difference (marked with asterisk) was observed between male wild-type and transgenic mice between the ages of 5 and 8 wk (P < 0.05). B, The delay in gonadotrope differentiation and suspected low testosterone levels in {alpha}GSU-Prop1 transgenic males causes a delay in seminal vesicle development. At 6 wk of age the seminal vesicles in transgenic animals are significantly smaller than those in wild-type (wt) littermates. By 12 wk of age, no size difference can be detected in the seminal vesicles of transgenic (Tg) and wild-type mice. C, Overexpression of Prop1 causes delayed MUPs expression in male mice. MUP proteins (~20 kDa) excreted in urine obtained from individual mice were analyzed on a 10% SDS-PAGE gel. Shown are gels of representative urine samples after staining with Coomassie blue. Lane 1, Kaleidoscope Prestained Standards; lanes 2–6, wild-type male urine (n = 5); lanes 7–11, {alpha}GSUProp1 Transgenic male urine (n = 5); lane 12, water.

 
Persistent Prop1 expression results in delayed puberty
Testosterone is necessary for the development of the seminal vesicles (36). At 6 wk of age the seminal vesicles of {alpha}GSU-Prop1 transgenic males (n = 4) are smaller and less developed than the wild types, suggesting that puberty is delayed (Fig 2BGo). However, by the age of 12 wk, the transgenic males exhibit normal seminal vesicle development (Fig. 2BGo).

Male mice exhibit high levels of MUPs at the onset of sexual maturity (35, 37). MUPs are synthesized in the liver in response to the male-specific pattern of pulsatile GH secretion, which requires testosterone. MUPs are ultimately excreted into the urine at approximately 3-fold higher levels in male than female mice. Prop1 transgenic male mice excreted low and/or undetectable levels of MUPs compared with wild-type mice at 30 d of age, consistent with delayed puberty (Fig. 2CGo). At the time point where we documented smaller, underdeveloped seminal vesicles, serum FSH was measured by RIA in eight wild-type and seven transgenic 6-wk-old males averaged 43.5 ng/ml ± 11.1 ng/ml and 21.5 ng/ml ± 25.9 ng/ml, respectively. The difference is statistically significant, with a P value less then 0.05. By 12 wk of age, the level of MUPs protein in the urine of transgenic and wild-type mice is indistinguishable. This supports the hypothesis that Prop1 transgenic male mice initially have decreased levels of testosterone and pulsatile GH, which causes their delay in puberty and pubertal growth spurt.

In female mice, the development of a vaginal opening is indicative of the onset of puberty (38), and reduced gonadotropins causes a variable delay in the opening of the vagina (39). All of the wild-type females analyzed (n = 5) had easily detectable vaginal openings by 25 d. However, three of the five {alpha}GSU-Prop1Tg females did not have vaginal openings until d 30. Serum LH levels were not detectable in either transgenic or wild-type females at 25 d of age. FSH levels measured by RIA in seven wild-type and seven transgenic 25-d-old females averaged 7.27 ng/ml ± 1.42 ng/ml and 3.64 ng/ml ± 1.19 ng/ml, respectively. This difference is statistically significant with a P value less than 0.01. These data support the idea that the B6 {alpha}GSU-Prop1 mice have a variably delayed puberty phenotype as a result of delayed gonadotropin production.

Although there is a delay in gonadotrope differentiation, both male and female {alpha}GSU-Prop1 transgenic mice are fertile. Pups were born from matings between wild-type B6 females and transgenic males and from matings of wild-type B6 males with transgenic females. This indicates that gonadotrope differentiation and gonadotrope production are established in the {alpha}GSU-Prop1 transgenic mice in time for functional reproduction.

Unaltered expression of gonadotrope-specific transcription factors in {alpha}GSU-Prop1 transgenics
NR0B1, NR5A1, EGR1, PITX2, T-PIT [T-box pituitary transcription factor 19 (TBX19)], and GATA2 are thought to be important for differentiation and/or function of gonadotropes (8, 12, 16, 17, 40). We examined the expression of these transcription factors in {alpha}GSU-Prop1 transgenics to determine whether Prop1 affected Lhb and Fshb transcription by influencing the expression of these transcription factors. NR0B1 and NR5A1 are nuclear receptors that regulate the development and function of the HPG axis (41, 42). Nr0b1 is expressed in the diencephalon at e14.5 and in the anterior lobe of the pituitary by e16.5. Nr5a1 has a similar expression pattern, although transcription initiates earlier in the anterior lobe, at e14.5 (Fig 3Go). We examined Nr0b1 and Nr5a1 expression during embryogenesis using immunohistochemistry and found no significant difference between wild-type and transgenic mice (Fig 3Go).


Figure 3
View larger version (87K):
[in this window]
[in a new window]
 
FIG. 3. Transcription factors, known to affect gonadotropes are unaltered in {alpha}GSU-Prop1 transgenic mice. NR0B1 (A–F), protein is not evident at e14 but at e16.5 and at day of birth (P1) it is present in the ventral aspect of the anterior lobe in both wild-type and transgenic mice. NR5A1 (G–L) protein is also expressed in the ventral aspect of the anterior lobe at e14.5, e16.5, and P1 in both wild-type and transgenic mice. PIT1 (M–R), restricts gonadotropes to the most ventral region of the pituitary. It appears to have a similar expression pattern in wild-type (wt) and transgenic (Tg) mice at e14.5, e16.5, and P1.

 
Antagonism between TBX19 and NR5A1 may play a role in gonadotrope lineage specification (16). Immunohistochemical staining for TBX19 expression is unaltered in the transgenic mice compared with wild-type mice during embryonic development (data not shown).

Prop1 is necessary for the activation of Pit1, which in turn is necessary for the development of somatotropes, thyrotropes, and lactotropes. If Prop1 is overexpressed, then Pit1 may be overexpressed, resulting in an increased number of somatotropes, thyrotropes, and lactotropes and decreased number of gonadotropes. To test whether Pit1 is also being overexpressed we used immunohistochemistry at d e14.5, e16.5, and P1 in wild-type and transgenic mice. We observed no difference in the overall intensity or pattern of expression (Fig 3Go).

We used in situ hybridization to assess whether the delayed gonadotrope differentiation in the transgenic mice was the result of absent or delayed initiation of the transcription factors Gata2 or Egr1 (Fig 4Go). No change in the expression pattern of either transcript was observed. We used Q-PCR to measure the levels of Gata2 and Egr1 transcripts and confirmed that they are equal in transgenic and wild-type P1 pituitaries (Table 1Go).


Figure 4
View larger version (101K):
[in this window]
[in a new window]
 
FIG. 4. In situ hybridization for the gonadotrope-specific transcription factors Gata2 and Egr1 indicates that neither are affected by the over expression of Prop1. Gata2 expression appears mostly in the future rostral tip region of the pituitary at e14.5 in both wild-type and transgenic mice (A and B). At e17.5, the Gata2 expression is still in the rostral tip of the pituitary and in some of the most ventral cells of the anterior pituitary in wild-type (wt) and transgenic (Tg) mice (C and D). Egr1 expression at e14.5 is primarily restricted to the developing posterior lobe of the pituitary in the wild-type and transgenic mice (E and F). At the day of birth (P1), the Egr1 expression is throughout the posterior and anterior lobes of the pituitary in wild-type and transgenic mice (G and H).

 
We examined expression of several TGFß family members in the pituitaries of transgenic and wild-type mice using in situ hybridization. We found similar expression patterns of activin receptor-I, inhibin-{alpha}, and inhibin-ß at e14.5 and P1 in wild-type and transgenic mice (data not shown). Activin receptor-IIa (Acvr2a), activin receptor-IIb (Acvr2b), and follistatin (Fst) transcripts were quantified using Q-PCR. No significant alterations were detected (Table 1Go).

Microarray analysis revealed novel pituitary genes
Due to the fact that many of the factors known to affect gonadotrope development appear unaffected in the {alpha}GSU-Prop1 transgenic pituitaries, we conducted a microarray experiment to look for novel genes that could be either up- or down-regulated by overexpression of Prop1 and cause the delay of Fsh and Lh expression. Genes with the highest fold change in the microarray included Prop1, components of the Prop1 transgene, Lhb, Fshb, Prl, and several novel genes. We used Q-PCR to confirm altered expression in pituitary RNA of wild-type and transgenic mice. Prl transcripts are reduced 3.4-fold, protease serine 28 (Prss28) transcripts are increased 6.3-fold, and killer cell lectin-like receptor G1 (Klrg1) transcripts are increased 57.7-fold in {alpha}GSU-Prop1 transgenic P1 pituitaries compared with wild-type pituitaries (Table 1Go).

Expression timing and patterning suggests a role of Prss28 and Klrg1 in pituitary function
We examined the expression pattern of Prss28 in the wild-type and {alpha}GSU-Prop1Tg mouse pituitary by in situ hybridization. At P1, no Prss28 transcripts are detectable in the wild-type pituitary, but transgenic littermates contained strong Prss28 hybridization signals in aggregates along the ventral aspect of the anterior lobe (Fig. 5Go). These data are consistent with the microarray and quantitative PCR findings (Table 1Go). At P7, both wild-type and transgenic anterior pituitaries exhibit expression of Prss28 (Fig. 5Go). Q-PCR analysis at this time reveals that the fold change between wild-type and transgenic pituitaries decreased from 6.3 at P1 to 4.4 at P7 (data not shown). Furthermore, when concurrent staining of pituitary hormones and Prss28 was done, the Prss28-positive cells colocalized with thyrotropes and gonadotropes, but not with corticotropes or somatotropes (data not shown). This suggests that Prss28 could be a marker for gonadotrope differentiation in normal pituitary development. Klrg1 expression is below our limit of detection by in situ hybridization at the time of P1; however, it is detectable in the adult pituitary in the transgenic animals (Fig 5Go). The evidence that Klrg1 is persistently expressed along with Prop1 suggests that Klrg1 could play a role in pituitary function.


Figure 5
View larger version (128K):
[in this window]
[in a new window]
 
FIG. 5. Transgenic (Tg) Prop1 causes premature expression of Prss28. Premature expression of Prss28 is detected by in situ hybridization in Prop1Tg postnatal d 1 (P1) anterior pituitary, but there is no expression in the wild-type (wt) P1 pituitary (A and B). At P7 the Prop1Tg and wild-type pituitaries express Prss28 in a similar pattern along the anterior lobe (C and D). Klrg1 is not detected in the adult wild-type pituitary (E), but its transcripts are detected throughout the posterior, intermediate, and anterior lobes of the transgenic adult pituitary (F).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Despite the clinical importance of delayed puberty, understanding of this condition is limited. In most cases, delayed puberty is not due to an underlying pathology, but instead represents an extreme end of the normal spectrum of pubertal timing, a developmental pattern referred to as constitutional delay of growth and maturation (CD) (43, 44). A genetic predisposition to delayed pubertal development is common, with both parents contributing to positive family histories (43). We find that the {alpha}GSU-Prop1 transgenic mice exhibit many characteristics of CD patients, such as delayed gonadal development and late onset of gonadotropin expression (44) .

The physiological phenotypes exhibited by the {alpha}GSU-Prop1 transgenic mice are due to a 7-d delay of Fshb expression. The smaller seminal vesicles and delay of growth spurt in transgenic males at 6 wk of age and delayed vaginal opening and lower FSH serum levels in females correlate with findings in human patients. A major increase in gonadotropin levels actually occurs well before the appearance of secondary sex characteristics. Initiation of this process probably goes back to age seven or eight in humans (44). Therefore, it is reasonable that a 7-d delay in initiation of puberty affects mice 6 wk later.

The complex genetic causes of delayed puberty are largely due to the differential regulation of Lhb and Fshb gene expression and cross talk of intracellular signaling pathways. Transcription factors that control gonadotropin gene expression by direct basal expression, such as Nr5a1 and GATA2, bind directly to their cognate DNA elements in the gonadotropin subunit gene promoters, and stimulating {alpha}- and ß-subunit gene expression (45, 46). The binding of GnRH to GnRHR triggers signal transduction that results in phosphorylation of transcription factors, which enhances their activity (47). Gonadotropin gene expression is also regulated by feedback loops of gonadal steroids and peptides that act at the pituitary and hypothalamus. Fshb transcription is highly sensitive to negative feedback by the steroids estradiol and progesterone (48). It has also been previously noted that Fshb expression is regulated by the TGFß family members (19, 49). The myriad levels of transcriptional regulation of Lhb and Fshb indicate the complexity involved in the differentiation and secretion of gonadotropes and the onset of puberty in mammals. Our experiments indicate that none of the mechanisms mentioned above are responsible for the delay of puberty in the {alpha}GSU-Prop1 transgenic mice.

The increased gene expression of the Prss28 and Klrg1 genes in the P1 Prop1 transgenic pituitaries suggests novel players that could participate in the regulation of gonadotrope differentiation and Prop1 action. The Prss28 gene encodes strypsin, which is necessary for blastocyst hatching in vitro and initiation of implantation (50). It is expressed in several other tissues, although no complete expression studies have been done (51). We found no expression of Prss28 in normal mouse pituitaries at e14.5, e16.5, and P1. Prss28 expression is detectable at P7 after gonadotropes express Lhb and Fshb. The persistent expression of Prop1 in transgenic mice causes precocious expression of Prss28 at P1, and a concomitant delay in gonadotrope differentiation.

Proteases constitute a large family of proteins encoded by over 500 different genes (52). They control a myriad of events with known roles in embryonic development, coagulation, immunity, cell proliferation, differentiation, migration, adhesion, and death. Given the diversity of processes that involve proteases, it is premature to speculate on the possible role Prss28 in the pituitary gland. Indeed, there is no obvious simple correspondence between Prss28 and gonadotrope expression levels. It is particularly intriguing that serine proteases affect cell differentiation through effects on Notch signaling or growth factor-receptor activities, by inhibiting signaling by TGFß family members like activin and BMP, by activating prohormones, or by cleaving transcription factors and affecting gene expression (53, 54, 55, 56, 57).

Klrg1 expression is profoundly elevated in newborn Prop1 transgenics relative to normal mice. KLRG1 is the homolog of the mast cell function-associated antigen, which is expressed on natural killer (NK) cells and activated CD8 T cells in the mouse (58, 59) and on basophils and NK cells in humans (60). KLRG1 activation inhibits effector functions of a murine NK cell line (61) and exerts effector functions on CD8+ T cells (62). These functions include the production of the different cytokines such as interferon {gamma} and TFN-{alpha} (61). A number of different cytokines, including IL-1, IL-2, IL-6, IL-11, IL-12, leukemia inhibitory factor, interferon {gamma}, and TNF{alpha}, are expressed in the pituitary gland and have effects on hormone transcription and secretion, and the initiation or progression of pituitary tumors (63, 64, 65, 66). It is intriguing that Rathke’s cleft cysts are caused by pituitary-directed leukemia inhibitory factor expression and Prop1 expression (29, 67). Investigations of KLRG1 expression and its effects on cytokine responses in the pituitary will be important for understanding the physiological role of KLRG1 in vivo.

In summary, we present a well-characterized animal model of transient hypogonadotropic hypogonadism and uncovered two novel genes that may be involved in PROP1 mediated suppression of gonadotrope development.


    Acknowledgments
 
We thank the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core (NICHD Grant 454-HD28934), A. Parlow (UCLA), and the University of Michigan Comprehensive Cancer Center Affymetrix and cDNA Microarray Core Facility, especially Jim MacDonald and Joseph Washburn, for their contributions to the experiments. We thank Drs. Paolo Sassone-Corsi, Ken-Ichirou Morohashi, Simon Rhodes, Kenji Okazaki, David Gordon, Vikas Sukhtme, Derrick Rancourt, and the National Hormone Pituitary Program for providing us with critical reagents. We also thank Drs. T. Rajendra Kumar, Phil Gage, Rowena Angeles, Christopher Krebs, Buffy Ellsworth, and Diane Robins for suggestions and advice.


    Footnotes
 
This work was supported by National Institutes of Health Grants HD34283 and R37HD30428 (to S.A.C.) and 5 P30 CA46592.

First Published Online December 29, 2005

Abbreviations: BMP, Bone morphogenetic protein; CD, constitutional delay; e10.5, embryonic d 10.5; EGR1, early growth response 1; GATA2, GATA binding protein 2; Gnrhr, GnRH receptor; GSU, glycoprotein hormone subunit; HHG, hypogonadotrophic hypogonadism; HPG, hypothalamic-pituitary-gonadal; HPRT, hypoxanthine guanine phosphoribosyl transferase; Klrg1, killer cell lectin-like receptor subfamily G, member 1; MPHD, multiple pituitary hormone deficiency; MUPs, major urinary proteins; NK, natural killer; NR0B1, nuclear receptor, subfamily 0, group B, member 1; NR5A1, nuclear receptor, subfamily 5, group A, member 1; Nupr1, nuclear protein 1; Otx1, orthodenticle homolog 1; Pit1, pituitary-specific transcription factor 1; Pitx2, paired-like homeodomain transcription factor 2; PRL, prolactin; PROP1, prophet of Pit1; Prss28, protease serine 28; Q-PCR, quantitative PCR; RT-qPCR, real-time quantitative PCR; TBX19, T-box 19.

Received August 24, 2005.

Accepted for publication December 19, 2005.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kumar TR, Wang Y, Lu N, Matzuk MM 1997 Follicle stimulating hormone is required for ovarian follicle maturation but not male fertility. Nat Genet 15:201–204[CrossRef][Medline]
  2. Dierich A, Sairam MR, Monaco L, Fimia GM, Gansmuller A, LeMeur M, Sassone-Corsi P 1998 Impairing follicle-stimulating hormone (FSH) signaling in vivo: targeted disruption of the FSH receptor leads to aberrant gametogenesis and hormonal imbalance. Proc Natl Acad Sci USA 95:13612–13617[Abstract/Free Full Text]
  3. Lei ZM, Mishra S, Zou W, Xu B, Foltz M, Li X, Rao CV 2001 Targeted disruption of luteinizing hormone/human chorionic gonadotropin receptor gene. Mol Endocrinol 15:184–200[Abstract/Free Full Text]
  4. Ma X, Dong Y, Matzuk MM, Kumar TR 2004 Targeted disruption of luteinizing hormone ß-subunit leads to hypogonadism, defects in gonadal steroidogenesis, and infertility. Proc Natl Acad Sci USA 101:17294–17299[Abstract/Free Full Text]
  5. Zhang FP, Poutanen M, Wilbertz J, Huhtaniemi I 2001 Normal prenatal but arrested postnatal sexual development of luteinizing hormone receptor knockout (LuRKO) mice. Mol Endocrinol 15:172–183[Abstract/Free Full Text]
  6. de Roux N, Milgrom E 2001 Inherited disorders of GnRH and gonadotropin receptors. Mol Cell Endocrinol 179:83–87[CrossRef][Medline]
  7. Japon MA, Rubinstein M, Low MJ 1994 In situ hybridization analysis of anterior pituitary hormone gene expression during fetal mouse development. J Histochem Cytochem 42:1117–1125[Abstract]
  8. Dasen JS, O’Connell SM, Flynn SE, Treier M, Gleiberman AS, Szeto DP, Hooshmand F, Aggarwal AK, Rosenfeld MG 1999 Reciprocal interactions of Pit1 and GATA2 mediate signaling gradient-induced determination of pituitary cell types. Cell 97:587–598[CrossRef][Medline]
  9. Keri RA, Nilson JH 1996 A steroidogenic factor-1 binding site is required for activity of the luteinizing hormone ß subunit promoter in gonadotropes of transgenic mice. J Biol Chem 271:10782–10785[Abstract/Free Full Text]
  10. Zhao L, Bakke M, Krimkevich Y, Cushman LJ, Parlow AF, Camper SA, Parker KL 2001 Steroidogenic factor 1 (SF1) is essential for pituitary gonadotrope function. Development 128:147–154[Abstract]
  11. Ikeda Y, Luo X, Abbud R, Nilson JH, Parker KL 1995 The nuclear receptor steroidogenic factor 1 is essential for the formation of the ventromedial hypothalamic nucleus. Mol Endocrinol 9:478–486[Abstract/Free Full Text]
  12. Muscatelli F, Strom TM, Walker AP, Zanaria E, Recan D, Meindl A, Bardoni B, Guioli S, Zehetner G, Rabl W, et al 1994 Mutations in the DAX-1 gene give rise to both X-linked adrenal hypoplasia congenita and hypogonadotropic hypogonadism. Nature 372:672–676[CrossRef][Medline]
  13. Topilko P, Schneider-Maunoury S, Levi G, Trembleau A, Gourdji D, Driancourt MA, Rao CV, Charnay P 1998 Multiple pituitary and ovarian defects in Krox-24 (NGFI-A, Egr-1)-targeted mice. Mol Endocrinol 12:107–122
  14. Quirk CC, Seachrist DD, Nilson JH 2003 Embryonic expression of the luteinizing hormone beta gene appears to be coupled to the transient appearance of p8, a high mobility group-related transcription factor. J Biol Chem 278:1680–1685[Abstract/Free Full Text]
  15. Acampora D, Mazan S, Tuorto F, Avantaggiato V, Tremblay JJ, Lazzaro D, di Carlo A, Mariano A, Macchia PE, Corte G, Macchia V, Drouin J, Brulet P, Simeone A 1998 Transient dwarfism and hypogonadism in mice lacking Otx1 reveal prepubescent stage-specific control of pituitary levels of GH, FSH and LH. Development 125:1229–1239[Abstract]
  16. Pulichino AM, Vallette-Kasic S, Tsai JP, Couture C, Gauthier Y, Drouin J 2003 Tpit determines alternate fates during pituitary cell differentiation. Genes Dev 17:738–747[Abstract/Free Full Text]
  17. Suh H, Gage PJ, Drouin J, Camper SA 2002 Pitx2 is required at multiple stages of pituitary organogenesis: pituitary primordium formation and cell specification. Development 129:329–337
  18. Kumar TR, Varani S, Wreford NG, Telfer NM, de Kretser DM, Matzuk MM 2001 Male reproductive phenotypes in double mutant mice lacking both FSHß and activin receptor IIA. Endocrinology 142:3512–3518[Abstract/Free Full Text]
  19. Clarke IJ, Rao A, Fallest PC, Shupnik MA 1993 Transcription rate of the follicle stimulating hormone (FSH) ß subunit gene is reduced by inhibin in sheep but this does not fully explain the decrease in mRNA. Mol Cell Endocrinol 91:211–216[CrossRef][Medline]
  20. Weiss J, Guendner MJ, Halvorson LM, Jameson JL 1995 Transcriptional activation of the follicle-stimulating hormone ß-subunit gene by activin. Endocrinology 136:1885–1891[Abstract]
  21. Ueno N, Ling N, Ying SY, Esch F, Shimasaki S, Guillemin R 1987 Isolation and partial characterization of follistatin: a single-chain Mr 35,000 monomeric protein that inhibits the release of follicle-stimulating hormone. Proc Natl Acad Sci USA 84:8282–8286[Abstract/Free Full Text]
  22. Sornson MW, Wu W, Dasen JS, Flynn SE, Norman DJ, O’Connell SM, Gukovsky I, Carriere C, Ryan AK, Miller AP, Zuo L, Gleiberman AS, Andersen B, Beamer WG, Rosenfeld MG 1996 Pituitary lineage determination by the Prophet of Pit-1 homeodomain factor defective in Ames dwarfism. Nature 384:327–333[CrossRef][Medline]
  23. Nasonkin IO, Ward RD, Raetzman LT, Seasholtz AF, Saunders TL, Gillespie PJ, Camper SA 2004 Pituitary hypoplasia and respiratory distress syndrome in Prop1 knockout mice. Hum Mol Genet 13:2727–2735[Abstract/Free Full Text]
  24. Ward RD, Raetzman LT, Suh H, Stone BM, Nasonkin IO, Camper SA 2005 Role of PROP1 in pituitary gland growth. Mol Endocrinol 19:698–710[Abstract/Free Full Text]
  25. Cogan JD, Wu W, Phillips 3rd JA, Arnhold IJ, Agapito A, Fofanova OV, Osorio MG, Bircan I, Moreno A, Mendonca BB 1998 The PROP1 2-base pair deletion is a common cause of combined pituitary hormone deficiency. J Clin Endocrinol Metab 83:3346–3349[Abstract/Free Full Text]
  26. Parks JS, Brown MR, Hurley DL, Phelps CJ, Wajnrajch MP 1999 Heritable disorders of pituitary development. J Clin Endocrinol Metab 84:4362–4370[Abstract/Free Full Text]
  27. Bottner A, Keller E, Kratzsch J, Stobbe H, Weigel JF, Keller A, Hirsch W, Kiess W, Blum WF, Pfaffle RW 2004 PROP1 mutations cause progressive deterioration of anterior pituitary function including adrenal insufficiency: a longitudinal analysis. J Clin Endocrinol Metab 89:5256–5265[Abstract/Free Full Text]
  28. Arroyo A, Pernasetti F, Vasilyev VV, Amato P, Yen SS, Mellon PL 2002 A unique case of combined pituitary hormone deficiency caused by a PROP1 gene mutation (R120C) associated with normal height and absent puberty. Clin Endocrinol (Oxf) 57:283–291[CrossRef][Medline]
  29. Cushman LJ, Watkins-Chow DE, Brinkmeier ML, Raetzman LT, Radak AL, Lloyd RV, Camper SA 2001 Persistent Prop1 expression delays gonadotrope differentiation and enhances pituitary tumor susceptibility. Hum Mol Genet 10:1141–1153[Abstract/Free Full Text]
  30. Nomura M, Kawabe K, Matsushita S, Oka S, Hatano O, Harada N, Nawata H, Morohashi K 1998 Adrenocortical and gonadal expression of the mammalian Ftz-F1 gene encoding Ad4BP/SF-1 is independent of pituitary control. J Biochem (Tokyo) 124:217–224[Abstract/Free Full Text]
  31. Simmons DM, Voss JW, Ingraham HA, Holloway JM, Broide RS, Rosenfeld MG, Swanson LW 1990 Pituitary cell phenotypes involve cell-specific Pit-1 mRNA translation and synergistic interactions with other classes of transcription factors. Genes Dev 4:695–711[Abstract/Free Full Text]
  32. Giordano BC, Ferrance J, Swedberg S, Huhmer AF, Landers JP 2001 Polymerase chain reaction in polymeric microchips: DNA amplification in less than 240 seconds. Anal Biochem 291:124–132[CrossRef][Medline]
  33. Irizarry RA, Bolstad BM, Collin F, Cope LM, Hobbs B, Speed TP 2003 Summaries of Affymetrix GeneChip probe level data. Nucleic Acids Res 31:e15
  34. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-{Delta}{Delta}C(T)) method. Methods 25:402–408[CrossRef][Medline]
  35. Davey HW, Park SH, Grattan DR, McLachlan MJ, Waxman DJ 1999 STAT5b-deficient mice are growth hormone pulse-resistant. Role of STAT5b in sex-specific liver p450 expression. J Biol Chem 274:35331–35336[Abstract/Free Full Text]
  36. Cunha GR 1972 Epithelio-mesenchymal interactions in primordial gland structures which become responsive to androgenic stimulation. Anat Rec 172:179–195[CrossRef][Medline]
  37. Szoka PR, Paigen K 1978 Regulation of mouse major urinary protein production by the Mup-A gene. Genetics 90:597–612[Abstract/Free Full Text]
  38. Jameson JL 1996 Inherited disorders of the gonadotropin hormones. Mol Cell Endocrinol 125:143–149[CrossRef][Medline]
  39. Charlton HM, Halpin DM, Iddon C, Rosie R, Levy G, McDowell IF, Megson A, Morris JF, Bramwell A, Speight A, Ward BJ, Broadhead J, Davey-Smith G, Fink G 1983 The effects of daily administration of single and multiple injections of gonadotropin-releasing hormone on pituitary and gonadal function in the hypogonadal (hpg) mouse. Endocrinology 113:535–544[Abstract/Free Full Text]
  40. Ingraham HA, Lala DS, Ikeda Y, Luo X, Shen WH, Nachtigal MW, Abbud R, Nilson JH, Parker KL 1994 The nuclear receptor steroidogenic factor 1 acts at multiple levels of the reproductive axis. Genes Dev 8:2302–3212[Abstract/Free Full Text]
  41. Achermann JC, Weiss J, Lee EJ, Jameson JL 2001 Inherited disorders of the gonadotropin hormones. Mol Cell Endocrinol 179:89–96[CrossRef][Medline]
  42. Hoyle C, Narvaez V, Alldus G, Lovell-Badge R, Swain A 2002 Dax1 expression is dependent on steroidogenic factor 1 in the developing gonad. Mol Endocrinol 16:747–756[Abstract/Free Full Text]
  43. Sedlmeyer IL, Palmert MR 2002 Delayed puberty: analysis of a large case series from an academic center. J Clin Endocrinol Metab 87:1613–1620[Abstract/Free Full Text]
  44. Kulin HE 1996 Delayed puberty. J Clin Endocrinol Metab 81:3460–3464[CrossRef][Medline]
  45. Barnhart KM, Mellon PL 1994 The orphan nuclear receptor, steroidogenic factor-1, regulates the glycoprotein hormone {alpha}-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878–885[Abstract/Free Full Text]
  46. Steger DJ, Hecht JH, Mellon PL 1994 GATA-binding proteins regulate the human gonadotropin {alpha}-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:5592–5602[Abstract/Free Full Text]
  47. Brown P, McNeilly AS 1999 Transcriptional regulation of pituitary gonadotrophin subunit genes. Rev Reprod 4:117–124[Abstract]
  48. Phillips CL, Lin LW, Wu JC, Guzman K, Milsted A, Miller WL 1988 17ß-Estradiol and progesterone inhibit transcription of the genes encoding the subunits of ovine follicle-stimulating hormone. Mol Endocrinol 2:641–649[Abstract/Free Full Text]
  49. Strahl BD, Huang HJ, Sebastian J, Ghosh BR, Miller WL 1998 Transcriptional activation of the ovine follicle-stimulating hormone ß-subunit gene by gonadotropin-releasing hormone: involvement of two activating protein-1-binding sites and protein kinase C. Endocrinology 139:4455–4465[Abstract/Free Full Text]
  50. O’Sullivan CM, Rancourt SL, Liu SY, Rancourt DE 2001 A novel murine tryptase involved in blastocyst hatching and outgrowth. Reproduction 122:61–71[Abstract]
  51. O’Sullivan CM, Ungarian JL, Singh K, Liu S, Hance J, Rancourt DE 2004 Uterine secretion of ISP1, 2 tryptases is regulated by progesterone and estrogen during pregnancy and the endometrial cycle. Mol Reprod Dev 69:252–259[CrossRef][Medline]
  52. Richard I 2005 The genetic and molecular bases of monogenic disorders affecting proteolytic systems. J Med Genet 42:529–539[Abstract/Free Full Text]
  53. Duan Z, Li FQ, Wechsler J, Meade-White K, Williams K, Benson KF, Horwitz M 2004 A novel notch protein, N2N, targeted by neutrophil elastase and implicated in hereditary neutropenia. Mol Cell Biol 24:58–70[Abstract/Free Full Text]
  54. Hunter MG, Druhan LJ, Massullo PR, Avalos BR 2003 Proteolytic cleavage of granulocyte colony-stimulating factor and its receptor by neutrophil elastase induces growth inhibition and decreased cell surface expression of the granulocyte colony-stimulating factor receptor. Am J Hematol 74:149–155[CrossRef][Medline]
  55. Lane AA, Ley TJ 2003 Neutrophil elastase cleaves PML-RAR{alpha} and is important for the development of acute promyelocytic leukemia in mice. Cell 115:305–318[CrossRef][Medline]
  56. Oka C, Tsujimoto R, Kajikawa M, Koshiba-Takeuchi K, Ina J, Yano M, Tsuchiya A, Ueta Y, Soma A, Kanda H, Matsumoto M, Kawaichi M 2004 HtrA1 serine protease inhibits signaling mediated by Tgfß family proteins. Development 131:1041–1053[Abstract/Free Full Text]
  57. Vincent M, Guz Y, Rozenberg M, Webb G, Furuta M, Steiner D, Teitelman G 2003 Abrogation of protein convertase 2 activity results in delayed islet cell differentiation and maturation, increased {alpha}-cell proliferation, and islet neogenesis. Endocrinology 144:4061–4069[Abstract/Free Full Text]
  58. Blaser C, Kaufmann M, Pircher H 1998 Virus-activated CD8 T cells and lymphokine-activated NK cells express the mast cell function-associated antigen, an inhibitory C-type lectin. J Immunol 161:6451–6454[Abstract/Free Full Text]
  59. Hanke T, Corral L, Vance RE, Raulet DH 1998 2F1 antigen, the mouse homolog of the rat "mast cell function-associated antigen", is a lectin-like type II transmembrane receptor expressed by natural killer cells. Eur J Immunol 28:4409–4417[CrossRef][Medline]
  60. Butcher S, Arney KL, Cook GP 1998 MAFA-L, an ITIM-containing receptor encoded by the human NK cell gene complex and expressed by basophils and NK cells. Eur J Immunol 28:3755–3762[CrossRef][Medline]
  61. Robbins SH, Nguyen KB, Takahashi N, Mikayama T, Biron CA, Brossay L 2002 Cutting edge: inhibitory functions of the killer cell lectin-like receptor G1 molecule during the activation of mouse NK cells. J Immunol 168:2585–2589[Abstract/Free Full Text]
  62. Beyersdorf NB, Ding X, Karp K, Hanke T 2001 Expression of inhibitory "killer cell lectin-like receptor G1" identifies unique subpopulations of effector and memory CD8 T cells. Eur J Immunol 31:3443–3452[CrossRef][Medline]
  63. Asa SL, Ezzat S 2004 Molecular basis of pituitary development and cytogenesis. Front Horm Res 32:1–19[Medline]
  64. Bernton EW, Beach JE, Holaday JW, Smallridge RC, Fein HG 1987 Release of multiple hormones by a direct action of interleukin-1 on pituitary cells. Science 238:519–521[Abstract/Free Full Text]
  65. Cano P, Cardinali DP, Jimenez V, Alvarez MP, Cutrera RA, Esquifino AI 2005 Effect of interferon-{gamma} treatment on 24-hour variations in plasma ACTH, growth hormone, prolactin, luteinizing hormone and follicle-stimulating hormone of male rats. Neuroimmunomodulation 12:146–151[CrossRef][Medline]
  66. Spangelo BL, Judd AM, Isakson PC, MacLeod RM 1989 Interleukin-6 stimulates anterior pituitary hormone release in vitro. Endocrinology 125:575–577[Abstract/Free Full Text]
  67. Akita S, Readhead C, Stefaneanu L, Fine J, Tampanaru-Sarmesiu A, Kovacs K, Melmed S 1997 Pituitary-directed leukemia inhibitory factor transgene forms Rathke’s cleft cysts and impairs adult pituitary function. A model for human pituitary Rathke’s cysts. J Clin Invest 99:2462–2469[Medline]



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld
Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks
Physiol Rev, July 1, 2007; 87(3): 933 - 963.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
L. T. Raetzman, B. S. Wheeler, S. A. Ross, P. Q. Thomas, and S. A. Camper
Persistent Expression of Notch2 Delays Gonadotrope Differentiation
Mol. Endocrinol., November 1, 2006; 20(11): 2898 - 2908.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
R. D. Ward, B. M. Stone, L. T. Raetzman, and S. A. Camper
Cell Proliferation and Vascularization in Mouse Models of Pituitary Hormone Deficiency
Mol. Endocrinol., June 1, 2006; 20(6): 1378 - 1390.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vesper, A. H.
Right arrow Articles by Camper, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vesper, A. H.
Right arrow Articles by Camper, S. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals