| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Human Genetics (A.H.V., S.A.C.), University of Michigan, Ann Arbor, Michigan 48109-0638; and Department of Molecular and Integrative Physiology (L.T.R.), University of Illinois at Urbana-Champaign, Urbana, Illinois 61801
Address all correspondence and requests for reprints to: Sally A. Camper, Department of Human Genetics, University of Michigan, Ann Arbor, Michigan 48109-0618. E-mail: scamper{at}umich.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Gonadotropes are among the last of the five distinct hormone-producing cell types to be fully differentiated in rodent pituitary development (7). Lhb transcripts are normally detected by e16.5 and Fshb by e18.5 in the mouse pituitary. The commitment of gonadotropes is thought to depend on the production of bone morphogenetic protein (BMP) 2 in the ventral mesenchyme, which induces GATA binding protein 2 (GATA2) expression in the ventral aspect of the adjacent pituitary primordium at embryonic d 10.5 (e10.5) (8). GATA2 and PIT1 may act antagonistically to regulate cell fate choice between gonadotropes and the Pit1 lineage. In the absence of PIT1, more precursor cells differentiate into gonadotropes, presumably because of the unopposed action of GATA2.
Several pituitary transcription factors have been shown to be important in gonadotrope development or gonadotrope production by analysis of knockout mouse models. Unlike the absolute requirement for Pit1 in specification of somatotropes, thyrotropes, and lactotropes, no single transcription factor clearly directs gonadotrope commitment. The genes Nr5a, Nrob1, Egr1, and Nupr1 are tied to gonadotropin subunit gene expression. The nuclear receptor NR5A1 (steroidogenic factor 1) regulates Lhb expression directly (9), and pituitary-specific Nr5a1 knockout mice have no detectable LH or FSH (10). The requirement for NR5A1 is not absolute because GnRH stimulation is sufficient to induce LH and FSH expression in NR5A1-deficient mice (11). Lack of the orphan nuclear receptor NR0B1 [dosage-sensitive sex reversal congenital adrenal hypoplasia 1 (DAX1)] also causes LH and FSH deficiency (12). The zinc finger transcription factor early growth response 1 (EGR1) is required for Lhb but not Fshb transcription (13). The HMG box transcription factor p8 (NUPR1) is proposed to have a role in terminal differentiation of gonadotropes and expression of Lhb, but the requirement for this factor in gonadotrope development is still under investigation (14).
Recently, the T-box transcription factor TBX19 and the homeobox-containing transcription factors OTX1 (orthodenticle homolog 1) and PITX2 (paired-like homeodomain transcription factor 2) (15, 16, 17) have been implicated in gonadotrope differentiation. In the absence of Tbx19, the intermediate lobe cells of the pituitary differentiate into gonadotropes and PIT1-independent thyrotropes, instead of melanotropes. Also, overexpression of Tbx19 in mouse pituitaries represses the gonadotrope lineage, suggesting that Tbx19 is a negative regulator of gonadotrope differentiation (16). Hypomorphic Pitx2 mutant mice fail to activate several transcription factors critical for gonadotrope cell lineage specification including Gata2, Nr5a1, and Egr1, revealing the importance of Pitx2 dosage for gonadotrope differentiation (17). In addition, the Otx1 null mice exhibit a prepubescent period of dwarfism and hypogonadism owing to decreases in GH, FSH, and LH; the condition corrects itself by 4 months of age (15). The basis for eventual compensation in Otx1-deficient mice is unknown, but it suggests that gonadotrope transcription factors may have overlapping roles or varying importance at different developmental times.
Signaling molecules play an important role in gonadotrope function and may also be important in stimulating terminal differentiation (18). Members of the TGF-ß family regulate FSH production. For example, activin up-regulates Fshb, and this effect is antagonized by inhibin (19, 20). Follistatin binds and inactivates activin, resulting in reduced FSH production (21).
Prop1 encodes a paired-like homeodomain transcription factor required for pituitary organogenesis and is expressed from e10.5e16.5 (22, 23, 24). Ames dwarf mice (Prop1 df/df) have an inactivating missense mutation that causes growth insufficiency, hypothyroidism, and infertility. In the absence of Prop1, the POU-homeodomain transcription factor gene Pit1 is not activated, resulting in failure to specify three cell types: somatotropes, lactotropes, and thyrotropes. LH and FSH levels are reduced in Prop1 mutant mice, but the mechanism underlying this deficiency is still not clear (23).
Mutations in the prophet of Pit1 (PROP1) gene are the most common known cause of multiple pituitary hormone deficiency (MPHD) in humans (25, 26). The clinical features of MPHD patients vary, and the hormone deficiencies tend to be progressive, usually presenting with GH, TSH, prolactin (PRL), and gonadotropin deficiency and developing more severe hormone deficiencies over time, eventually including ACTH insufficiency (27). One documented 15-yr-old patient with an Arg120Cys mutation in PROP1 had not undergone puberty and was 2 SDs below normal height at the age of 15 due to a failed pubertal growth spurt. The patients basal serum concentrations of GH, LH, and FSH, were low and unresponsive to stimulation, whereas ACTH, PRL, and TSH levels were modestly low (28). The features of this patient emphasize the role of PROP1 plays in the production of gonadotropins and the onset of puberty.
To study the influence of Prop1 on gonadotropes and puberty we generated a Prop1 transgenic mouse line that overexpresses Prop1 persistently. The mice have decreased expression of Lhb and Fshb and exhibit transient hypogonadism (29). These findings suggest that Prop1 repression is important for the development and differentiation of gonadotropes. Here we report a thorough investigation of the physiological consequences of excess Prop1 and describe the mechanism whereby Prop1 inhibits gonadotrope development.
| Materials and Methods |
|---|
|
|
|---|
-glycoprotein hormone subunit (GSU)-Prop1 transgene were generated by microinjection as described (29), and the TgN(Cga-Prop1)D6Sac line was bred at the University of Michigan on to the C57BL/6J background (B6) for seven generations. Male mice were separately housed and females were housed five animals per cage. All mice were fed LabDiet 5020 (Richmond, IN) high-fat chow. Transgenic mice were identified by PCR amplification of genomic DNA from tail biopsies (29). Blood was collected by cardiac puncture after the mice were euthanized, and their heart was still beating. After collection, the blood clotted at room temperature for 90 min and then centrifuged at 200 x g for 15 min. After centrifugation, the serum was placed in a polypropylene tube and sent to the University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core and analyzed for mouse FSH concentrations by RIA. All the mice were maintained according to the National Institutes of Health guidelines for the Care and Use of Experimental Animals.
Urinalysis for major urinary proteins (MUPs)
Urine was collected from transgenic and wild-type mice every 5 d starting at 20 d of age to 40 d of age. Urine samples where placed on ice for 5 min and centrifuged at
13,000 rpm for 5 min and supernatant was removed from pellet. One microliter of urine supernatant was mixed with 19 µl 1x Stacking Gel Buffer [4x Stacking gel buffer: 0.5 M Tris HCl (pH 6.8)] and 4 µl 6x SDS-PAGE Gel Loading Dye. Samples were boiled for 5 min and cooled on ice. A total of 2.4 µl of sample was loaded onto a 10% SDS-PAGE gel and ran at 25 mA constant current until bromophenol blue dye front was about 1 cm from bottom of gel. Gel was stained with Coomassie Blue dye overnight. Gel was destained with De-stain Solution I (40% methanol, 7% acetic acid) for approximately 1 h, while changing solution every 20 min. Gel was destained with De-stain Solution II (5% methanol, 7% acetic acid) following the same method used with De-stain Solution I. Gel was photographed using visible light.
Immunochemistry and in situ hybridization
Timed pregnancies were produced using sexually mature females. The morning after mating was designated as e0.5 and the day of birth as P1. Collected testes, embryos, P1, and P8 heads were fixed for 24 h in 4% paraformaldehyde in PBS (pH 7.2) at room temperature, dehydrated in a graded series of ethanol, and embedded in paraffin. Six-micrometer sections were prepared for immunochemistry and in situ hybridization.
Pituitary cell populations were examined by immunochemistry with antibodies against different pituitary hormone markers. Immunostaining was carried out with polyclonal antisera against rat LHß (1:1500, AFP22238790GPOLHB), rat TSHß (1:1000, AFP1274789TSHb), and rat FSHß (1:1800, 85GP9691bFSHb) (National Hormone and Pituitary Program, National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD).
Antiserum against NR0B1 was provided by Dr. Paolo Sassone-Corsi (Institut de Genetique et de Biologie Moleculaire et Cellulaire, Centre National de la Recherche Scientifique/Institut National de la Santé et de la Recherche Médicale/Université Louis Pasteur, College de France, Illkirch, Strasbourg, France) and was used at a 1:1000 dilution on paraffin sections. Antisera against NR5A1 was provided by Dr. Ken-Ichirou Morohashi (National Institute for Basic Biology, Okazaki, Japan) and was used on paraffin sections at a 1:1500 dilution (30). Antisera for PIT1 was provided by Dr. Simon Rhodes (Department of Biology, Indiana University-Purdue University, Indianapolis, IN) and was used on paraffin sections at a 1:2000 dilution (31). Antiserum against ActR-1 was provided by Dr. Kenji Okazaki (Department of Molecular Biology, Biomolecular Institute, Osaka, Japan) and was used on paraffin sections at a 1:5000 dilution. The sections were incubated with hypoxanthine guanine phosphoribosyl transferase (HPRT)-conjugated sheep antirat Ig.
All other sections were incubated in biotinylated secondary antibodies in conjunction with avidin, biotinylated peroxidase, Mouse on Mouse, guinea pig, and rabbit kits (Vector Laboratories, Burlingame, CA) and were amplified by using tyramide signal amplification: tetramethylrhodamine kit (PerkinElmer Life Sciences, Foster City, CA) or diaminobenzidine (Sigma, St. Louis, MO) which produces a brown precipitate. Most slides where counterstained with Methyl Green (Vector Labs).
Dr. David Gordon (University of Colorado Health Science Center, Denver, CO) provided a plasmid-containing mouse Gata2 genomic sequence in pGEM13. Mouse Egr1 cDNA was provided by Dr. Vikas Sukhatme (Harvard Medical Center, Boston, MA) and was subcloned into pBLUESCRIPT SK (+) (pSK+; Stratagene, La Jolla, CA). A plasmid-containing mouse Prss28 genomic series in pBK-CMV vector was provided by Dr. Derrick Rancourt (University of Calgary, Alberta, Canada). RNA isolated from P1
GSU-Prop1 pituitaries (as described below) and the Klrg1 riboprobe was generated by PCR amplification of a 360-bp product using the forward primer, 5' TGGGTCTGGGGAATCTTTGTC 3' and the reverse primer, 5'GGTGTTTGCGTCTTTCTGTCTTG 3'. The PCR was performed under the following conditions: 92 C for 3 min, followed by 40 cycles of 92 C for 30 sec, followed by annealing temperature of 56 C for 30 sec, and 72 C for 30 sec, followed by a final extension at 72 C for 10 min. PCR products were purified using a QIAquick PCR Purifaction kit (QIAGEN, Valencia, CA) and sequenced to confirm identity. The purified fragment was cloned into pGEM-T Easy cloning vector (Promega, Madison, WI). Klrg1 was linearized with ApaI and labeled with SP6 polymerase. The probed was diluted 1:100 and hybridized at 50 C. Both the Gata2 and Egr1 plasmids where linearized, riboprobe generated, labeled, and hybridized as previously described (17, 29). All riboprobes were generated and labeled with digoxigenin and precipitated with nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indolyl phosphate (Roche Molecular Biochemicals, Indianapolis, IN) following previously described methods (17, 29).
Isolation of total RNA from newborn pituitaries
These studies involved two experimental groups: wild-type and
GSU-Prop1 transgenic mice. For each experimental group, we pooled pituitaries from 8 P1 mice to isolate RNA and collected three independent RNA samples for each experimental group. Pituitaries were collected and stored immediately in RNAlater (Ambion, Austin, TX) at 20 C. After the genotypes of the pituitaries were determined, the RNAlater was removed and the pituitaries of the same genotype were pooled in 500 µl lysis buffer form the RNAqueous Micro Kit (Ambion). Pooled pituitaries were homogenized using an Ultra-Turrax T8 homogenizer (IKA, Wilmington, NC). Total RNA was isolated with the RNAqueous Micro Kit (Ambion) according to manufacturers instructions. RNA was also isolated from pools of two wild-type and two
GSU-Prop1 transgenic P1 pituitaries of the same genotype for validation by RT quantitative PCR (RT-qPCR). Homogenization and RNA isolation was done as described above. To assess RNA quality for the microarray, total RNA was analyzed by capillary electrophoresis on an Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, Ca) in the UMCCC Affymetrix (Santa Clara, CA) and cDNA Microarray Core to visualize and quantitate 18S and 28S ribosomal bands. UV spectrophotometry was used to access the quality and concentration of total RNA for RT-qPCR.
Microarray analysis
Pituitary gene expression was determined with Mouse Genome 430 2.0 GeneChip oligonucleotide arrays (Affymetrix). Total RNA (25 µg) from eight pools of pituitary tissue was used. Synthesis of cRNA, hybridization to chips, and washes were performed in the University of Michigan Affymetrix and cDNA Microarray Core according to the manufacturers protocol and as described previously (32). RNA samples were processed together, three RNA samples for each of the two experimental groups (wild-type and
GSU-Prop1 transgenic). After hybridization, GeneChips were scanned at 1.5-µm density with GeneChip Scanner 3000 (Affymetrix).
Data analysis
Data analysis was performed in the University of Michigan Affymetrix and cDNA Microarray Core. Perfect match values, not the differences between perfect match and mismatch values, were normalized using a quantile normalization procedure. Expression values were calculated using Robust Multiarray average in the Bioconductor library of R statistical language (33). We used RT-qPCR to validate gene expression changes for genes that exhibited a fold change of 1.5 or greater on the microarray.
Quantitative RT-PCR (RT-qPCR)
First-strand cDNA was synthesized from total RNA (1 µg) using SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA) according to the manufacturers instructions.
For each gene assayed, real-time PCR was performed on duplicate cDNA samples in a Prism 7000 Sequence Detection System with TaqMan probes (Assays-on-Demand, Applied Biosystems, Foster City, CA). We determined the level of HPRT, a housekeeping gene whose expression remained relatively constant between the two experimental groups, for each RNA sample as an internal control. CT, the threshold cycle, is defined as the PCR cycle at which the fluorescence intensity crosses a manually determined threshold value, at a level where the fluorescent signal is appreciably above the background level but is still in the early exponential phase of amplification. The same threshold was used for all genes of interest and HPRT (internal control) across all samples. The difference in CT between the gene of interest (gene "X") and HPRT for any given RNA sample was defined as
CT(X). The difference in
CT(x) between two samples was defined as 
CT(X), which represented a relative difference in expression of gene X. The fold change of gene X relative to HPRT was defined as 2-
CT (X) (34).
Statistical analysis
We used StatView software (Cary, NC) to calculate statistical significance and to create graphs of mouse weight vs. age.
| Results |
|---|
|
|
|---|
GSU-Prop1 transgenic mice have incomplete gonadotrope differentiation at age P1 but apparently normally differentiation by 4 wk of age. We characterized the gonadotrope phenotype of the D6 line on the B6 background using quantitative PCR (Q-PCR), in situ hybridization, and immunohistochemistry at multiple developmental time points. Q-PCR revealed that Prop1 transcripts are approximately 100-fold more abundant in the transgenic pituitaries at P1 compared with wild type (Table 1
GSU-Prop1 transgenic P1 mice (data not shown), and we confirmed this by Q-PCR (Table 1
GSU-Prop1Tg mice at e16.5 and P1 (Fig. 1
GSU-Prop1 transgenic mice and the number of immunoreactive cells appears similar. (Fig. 1
|
|
-GSU-Prop1Tg mice appeared similar relative to the wild-type littermates. However, on the B6 background, the D6
GSU-Prop1Tg mice looked visibly smaller than wild-type mice at time of weaning. We weighed the B6 (n = 7)
GSU-Prop1Tg and wild-type mice of both sexes once a week, from 212 wk of age. The
GSU-Prop1Tg male body weights were significantly (P < 0.05) lower than the wild-type male body weights from the age of 58 wk (Fig 2A
|
GSU-Prop1 transgenic males (n = 4) are smaller and less developed than the wild types, suggesting that puberty is delayed (Fig 2B
Male mice exhibit high levels of MUPs at the onset of sexual maturity (35, 37). MUPs are synthesized in the liver in response to the male-specific pattern of pulsatile GH secretion, which requires testosterone. MUPs are ultimately excreted into the urine at approximately 3-fold higher levels in male than female mice. Prop1 transgenic male mice excreted low and/or undetectable levels of MUPs compared with wild-type mice at 30 d of age, consistent with delayed puberty (Fig. 2C
). At the time point where we documented smaller, underdeveloped seminal vesicles, serum FSH was measured by RIA in eight wild-type and seven transgenic 6-wk-old males averaged 43.5 ng/ml ± 11.1 ng/ml and 21.5 ng/ml ± 25.9 ng/ml, respectively. The difference is statistically significant, with a P value less then 0.05. By 12 wk of age, the level of MUPs protein in the urine of transgenic and wild-type mice is indistinguishable. This supports the hypothesis that Prop1 transgenic male mice initially have decreased levels of testosterone and pulsatile GH, which causes their delay in puberty and pubertal growth spurt.
In female mice, the development of a vaginal opening is indicative of the onset of puberty (38), and reduced gonadotropins causes a variable delay in the opening of the vagina (39). All of the wild-type females analyzed (n = 5) had easily detectable vaginal openings by 25 d. However, three of the five
GSU-Prop1Tg females did not have vaginal openings until d 30. Serum LH levels were not detectable in either transgenic or wild-type females at 25 d of age. FSH levels measured by RIA in seven wild-type and seven transgenic 25-d-old females averaged 7.27 ng/ml ± 1.42 ng/ml and 3.64 ng/ml ± 1.19 ng/ml, respectively. This difference is statistically significant with a P value less than 0.01. These data support the idea that the B6
GSU-Prop1 mice have a variably delayed puberty phenotype as a result of delayed gonadotropin production.
Although there is a delay in gonadotrope differentiation, both male and female
GSU-Prop1 transgenic mice are fertile. Pups were born from matings between wild-type B6 females and transgenic males and from matings of wild-type B6 males with transgenic females. This indicates that gonadotrope differentiation and gonadotrope production are established in the
GSU-Prop1 transgenic mice in time for functional reproduction.
Unaltered expression of gonadotrope-specific transcription factors in
GSU-Prop1 transgenics
NR0B1, NR5A1, EGR1, PITX2, T-PIT [T-box pituitary transcription factor 19 (TBX19)], and GATA2 are thought to be important for differentiation and/or function of gonadotropes (8, 12, 16, 17, 40). We examined the expression of these transcription factors in
GSU-Prop1 transgenics to determine whether Prop1 affected Lhb and Fshb transcription by influencing the expression of these transcription factors. NR0B1 and NR5A1 are nuclear receptors that regulate the development and function of the HPG axis (41, 42). Nr0b1 is expressed in the diencephalon at e14.5 and in the anterior lobe of the pituitary by e16.5. Nr5a1 has a similar expression pattern, although transcription initiates earlier in the anterior lobe, at e14.5 (Fig 3
). We examined Nr0b1 and Nr5a1 expression during embryogenesis using immunohistochemistry and found no significant difference between wild-type and transgenic mice (Fig 3
).
|
Prop1 is necessary for the activation of Pit1, which in turn is necessary for the development of somatotropes, thyrotropes, and lactotropes. If Prop1 is overexpressed, then Pit1 may be overexpressed, resulting in an increased number of somatotropes, thyrotropes, and lactotropes and decreased number of gonadotropes. To test whether Pit1 is also being overexpressed we used immunohistochemistry at d e14.5, e16.5, and P1 in wild-type and transgenic mice. We observed no difference in the overall intensity or pattern of expression (Fig 3
).
We used in situ hybridization to assess whether the delayed gonadotrope differentiation in the transgenic mice was the result of absent or delayed initiation of the transcription factors Gata2 or Egr1 (Fig 4
). No change in the expression pattern of either transcript was observed. We used Q-PCR to measure the levels of Gata2 and Egr1 transcripts and confirmed that they are equal in transgenic and wild-type P1 pituitaries (Table 1
).
|
, and inhibin-ß at e14.5 and P1 in wild-type and transgenic mice (data not shown). Activin receptor-IIa (Acvr2a), activin receptor-IIb (Acvr2b), and follistatin (Fst) transcripts were quantified using Q-PCR. No significant alterations were detected (Table 1
Microarray analysis revealed novel pituitary genes
Due to the fact that many of the factors known to affect gonadotrope development appear unaffected in the
GSU-Prop1 transgenic pituitaries, we conducted a microarray experiment to look for novel genes that could be either up- or down-regulated by overexpression of Prop1 and cause the delay of Fsh and Lh expression. Genes with the highest fold change in the microarray included Prop1, components of the Prop1 transgene, Lhb, Fshb, Prl, and several novel genes. We used Q-PCR to confirm altered expression in pituitary RNA of wild-type and transgenic mice. Prl transcripts are reduced 3.4-fold, protease serine 28 (Prss28) transcripts are increased 6.3-fold, and killer cell lectin-like receptor G1 (Klrg1) transcripts are increased 57.7-fold in
GSU-Prop1 transgenic P1 pituitaries compared with wild-type pituitaries (Table 1
).
Expression timing and patterning suggests a role of Prss28 and Klrg1 in pituitary function
We examined the expression pattern of Prss28 in the wild-type and
GSU-Prop1Tg mouse pituitary by in situ hybridization. At P1, no Prss28 transcripts are detectable in the wild-type pituitary, but transgenic littermates contained strong Prss28 hybridization signals in aggregates along the ventral aspect of the anterior lobe (Fig. 5
). These data are consistent with the microarray and quantitative PCR findings (Table 1
). At P7, both wild-type and transgenic anterior pituitaries exhibit expression of Prss28 (Fig. 5
). Q-PCR analysis at this time reveals that the fold change between wild-type and transgenic pituitaries decreased from 6.3 at P1 to 4.4 at P7 (data not shown). Furthermore, when concurrent staining of pituitary hormones and Prss28 was done, the Prss28-positive cells colocalized with thyrotropes and gonadotropes, but not with corticotropes or somatotropes (data not shown). This suggests that Prss28 could be a marker for gonadotrope differentiation in normal pituitary development. Klrg1 expression is below our limit of detection by in situ hybridization at the time of P1; however, it is detectable in the adult pituitary in the transgenic animals (Fig 5
). The evidence that Klrg1 is persistently expressed along with Prop1 suggests that Klrg1 could play a role in pituitary function.
|
| Discussion |
|---|
|
|
|---|
GSU-Prop1 transgenic mice exhibit many characteristics of CD patients, such as delayed gonadal development and late onset of gonadotropin expression (44) .
The physiological phenotypes exhibited by the
GSU-Prop1 transgenic mice are due to a 7-d delay of Fshb expression. The smaller seminal vesicles and delay of growth spurt in transgenic males at 6 wk of age and delayed vaginal opening and lower FSH serum levels in females correlate with findings in human patients. A major increase in gonadotropin levels actually occurs well before the appearance of secondary sex characteristics. Initiation of this process probably goes back to age seven or eight in humans (44). Therefore, it is reasonable that a 7-d delay in initiation of puberty affects mice 6 wk later.
The complex genetic causes of delayed puberty are largely due to the differential regulation of Lhb and Fshb gene expression and cross talk of intracellular signaling pathways. Transcription factors that control gonadotropin gene expression by direct basal expression, such as Nr5a1 and GATA2, bind directly to their cognate DNA elements in the gonadotropin subunit gene promoters, and stimulating
- and ß-subunit gene expression (45, 46). The binding of GnRH to GnRHR triggers signal transduction that results in phosphorylation of transcription factors, which enhances their activity (47). Gonadotropin gene expression is also regulated by feedback loops of gonadal steroids and peptides that act at the pituitary and hypothalamus. Fshb transcription is highly sensitive to negative feedback by the steroids estradiol and progesterone (48). It has also been previously noted that Fshb expression is regulated by the TGFß family members (19, 49). The myriad levels of transcriptional regulation of Lhb and Fshb indicate the complexity involved in the differentiation and secretion of gonadotropes and the onset of puberty in mammals. Our experiments indicate that none of the mechanisms mentioned above are responsible for the delay of puberty in the
GSU-Prop1 transgenic mice.
The increased gene expression of the Prss28 and Klrg1 genes in the P1 Prop1 transgenic pituitaries suggests novel players that could participate in the regulation of gonadotrope differentiation and Prop1 action. The Prss28 gene encodes strypsin, which is necessary for blastocyst hatching in vitro and initiation of implantation (50). It is expressed in several other tissues, although no complete expression studies have been done (51). We found no expression of Prss28 in normal mouse pituitaries at e14.5, e16.5, and P1. Prss28 expression is detectable at P7 after gonadotropes express Lhb and Fshb. The persistent expression of Prop1 in transgenic mice causes precocious expression of Prss28 at P1, and a concomitant delay in gonadotrope differentiation.
Proteases constitute a large family of proteins encoded by over 500 different genes (52). They control a myriad of events with known roles in embryonic development, coagulation, immunity, cell proliferation, differentiation, migration, adhesion, and death. Given the diversity of processes that involve proteases, it is premature to speculate on the possible role Prss28 in the pituitary gland. Indeed, there is no obvious simple correspondence between Prss28 and gonadotrope expression levels. It is particularly intriguing that serine proteases affect cell differentiation through effects on Notch signaling or growth factor-receptor activities, by inhibiting signaling by TGFß family members like activin and BMP, by activating prohormones, or by cleaving transcription factors and affecting gene expression (53, 54, 55, 56, 57).
Klrg1 expression is profoundly elevated in newborn Prop1 transgenics relative to normal mice. KLRG1 is the homolog of the mast cell function-associated antigen, which is expressed on natural killer (NK) cells and activated CD8 T cells in the mouse (58, 59) and on basophils and NK cells in humans (60). KLRG1 activation inhibits effector functions of a murine NK cell line (61) and exerts effector functions on CD8+ T cells (62). These functions include the production of the different cytokines such as interferon
and TFN-
(61). A number of different cytokines, including IL-1, IL-2, IL-6, IL-11, IL-12, leukemia inhibitory factor, interferon
, and TNF
, are expressed in the pituitary gland and have effects on hormone transcription and secretion, and the initiation or progression of pituitary tumors (63, 64, 65, 66). It is intriguing that Rathkes cleft cysts are caused by pituitary-directed leukemia inhibitory factor expression and Prop1 expression (29, 67). Investigations of KLRG1 expression and its effects on cytokine responses in the pituitary will be important for understanding the physiological role of KLRG1 in vivo.
In summary, we present a well-characterized animal model of transient hypogonadotropic hypogonadism and uncovered two novel genes that may be involved in PROP1 mediated suppression of gonadotrope development.
| Acknowledgments |
|---|
| Footnotes |
|---|
First Published Online December 29, 2005
Abbreviations: BMP, Bone morphogenetic protein; CD, constitutional delay; e10.5, embryonic d 10.5; EGR1, early growth response 1; GATA2, GATA binding protein 2; Gnrhr, GnRH receptor; GSU, glycoprotein hormone subunit; HHG, hypogonadotrophic hypogonadism; HPG, hypothalamic-pituitary-gonadal; HPRT, hypoxanthine guanine phosphoribosyl transferase; Klrg1, killer cell lectin-like receptor subfamily G, member 1; MPHD, multiple pituitary hormone deficiency; MUPs, major urinary proteins; NK, natural killer; NR0B1, nuclear receptor, subfamily 0, group B, member 1; NR5A1, nuclear receptor, subfamily 5, group A, member 1; Nupr1, nuclear protein 1; Otx1, orthodenticle homolog 1; Pit1, pituitary-specific transcription factor 1; Pitx2, paired-like homeodomain transcription factor 2; PRL, prolactin; PROP1, prophet of Pit1; Prss28, protease serine 28; Q-PCR, quantitative PCR; RT-qPCR, real-time quantitative PCR; TBX19, T-box 19.
Received August 24, 2005.
Accepted for publication December 19, 2005.
| References |
|---|
|
|
|---|

C(T)) method. Methods 25:402408[CrossRef][Medline]
-subunit gene in pituitary gonadotropes. Mol Endocrinol 8:878885
-subunit gene in the placenta and pituitary gland. Mol Cell Biol 14:55925602
and is important for the development of acute promyelocytic leukemia in mice. Cell 115:305318[CrossRef][Medline]
-cell proliferation, and islet neogenesis. Endocrinology 144:40614069
treatment on 24-hour variations in plasma ACTH, growth hormone, prolactin, luteinizing hormone and follicle-stimulating hormone of male rats. Neuroimmunomodulation 12:146151[CrossRef][Medline]This article has been cited by other articles:
![]() |
X. Zhu, A. S. Gleiberman, and M. G. Rosenfeld Molecular Physiology of Pituitary Development: Signaling and Transcriptional Networks Physiol Rev, July 1, 2007; 87(3): 933 - 963. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. T. Raetzman, B. S. Wheeler, S. A. Ross, P. Q. Thomas, and S. A. Camper Persistent Expression of Notch2 Delays Gonadotrope Differentiation Mol. Endocrinol., November 1, 2006; 20(11): 2898 - 2908. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Ward, B. M. Stone, L. T. Raetzman, and S. A. Camper Cell Proliferation and Vascularization in Mouse Models of Pituitary Hormone Deficiency Mol. Endocrinol., June 1, 2006; 20(6): 1378 - 1390. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |