This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ishikawa, T. Articles by Morris, P. L. Search for Related Content PubMed PubMed Citation Articles by Ishikawa, T. Articles by Morris, P. L. Pubmed/NCBI databases Compound via MeSH Substance via MeSH

A Multistep Kinase-Based Sertoli Cell Autocrine-Amplifying Loop Regulates Prostaglandins, Their Receptors, and Cytokines

Center for Biomedical Research, Population Council (T.I., P.L.M.) and The Rockefeller University (P.L.M.), New York, New York 10021

Address all correspondence and requests for reprints to: Dr. Patricia L. Morris, Center for Biomedical Research, Population Council and The Rockefeller University, 1230 York Avenue, New York, New York 10021. E-mail: p-morris{at}popcbr.rockefeller.edu.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
In Sertoli epithelial cells, the IL-1ß induces prostaglandins (PG) PGE₂, PGF₂ and PGI₂ (7-, 11-, and 2-fold, respectively), but not PGD₂, production. Cyclohexamide pretreatment inhibiting protein synthesis prevents IL-1ß increases in PG levels, indicating that induction requires de novo protein synthesis. IL-1ß-regulated PGE₂ and PGF₂ production and cytokine expression require activation of cyclooxygenase-2 (COX-2) and c-Jun NH₂-terminal kinase, as shown using specific enzyme inhibition. PGE₂ and PGF₂ stimulate expression of IL-1, -1ß, and -6, findings consistent with PG involvement in IL signaling within the seminiferous tubule. PGE₂ and PGF₂ reverse COX-2-mediated inhibition of IL-1ß induction of cytokine expression and PG production. Sertoli PG receptor expression was determined; four known E-prostanoid receptor (EP) subtypes (1–4) and the F-prostanoid and prostacyclin prostanoid receptors were demonstrated using RNA and protein analyses. Pharmacological characterization of Sertoli PG receptors associated with cytokine regulation was ascertained by quantitative real-time RT-PCR analyses. IL-1ß regulates both EP₂ mRNA and protein levels, data consistent with a regulatory feedback loop. Butaprost (EP₂ agonist) and 11-deoxy PGE₁ (EP₂ and EP₄ agonist) treatments show that EP₂ receptor activation stimulates Sertoli cytokine expression. Consistent with EP₂-cAMP signaling, protein kinase A inhibition blocks both IL-1ß- and PGE₂-induced cytokines. Together, the data indicate an autocrine-amplifying loop involving IL-1ß-regulated Sertoli function mediated by COX-2-induced PGE₂ and PGF₂ production. PGE₂ activates EP₂ and/or EP₄ receptor(s) and the protein kinase A-cAMP pathway; PGF₂ activates F-prostanoid receptor-protein kinase C signaling. Further identification of the molecular mechanisms subserving these mediators may offer new insights into physiological events as well as proinflammatory-mediated pathogenesis in the testis.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
PROSTANOIDS ARE THE metabolic product of cyclooxygenase (COX)-mediated metabolism of arachidonic acid. In the male reproductive system, the precise role of distinct prostaglandins (PG, prostanoids) produced by the activity of the constitutive enzyme COX-1, and the inducible isoform COX-2 is poorly understood. Both COX isoforms are present during normal development of the fetal male reproductive tract, findings concordant with their physiological involvement in its function (1). Additionally, in both males and females, normal functioning of specific prostanoids and their receptors is a requirement for fertility and reproduction. These prostanoids interact with a family of eight G protein-coupled transmembrane receptors, which are abundantly expressed along the genitourinary tract and mediate their physiological actions (2). In particular, PGE₂ and PGF₂ are crucial regulators of female (3, 4, 5, 6) and male reproduction (7, 8, 9). PGE₂ binds to G protein-coupled plasma membrane receptors. Four distinct PGE₂ receptors [E-prostanoid receptor (EP_1–4)], encoded by different genes, have been identified in human tissues. Binding of PGE₂ to EP₂ or EP₄ activates adenylyl cyclase and the protein kinase A (PKA) signaling pathway via G_s activation. EP₁ is a G_i-coupled receptor, and its activation leads to an increase in the intracellular free calcium levels and/or PKA inhibition (10). EP₁ and EP₃ further undergo alternative mRNA splicing, generating different isoforms (11). Such nuances of receptor signaling may be present in the rat testis as our studies in Leydig progenitors indicated (12). Binding of PGE₂ to EP₃ causes intracellular calcium mobilization, activation of PKA, protein kinase C (PKC), and MAPK, or inhibition of the PKA-signaling pathway (11). Thus, PGE₂ can activate several signaling pathways, depending on the specific EP receptor subtype to which it binds. PGF₂ activates the F-prostanoid (FP) receptor signaling by way of increased [Ca²⁺]_I and phosphorylation of PKC (11, 13). The FP receptor exhibits multiple PKC phosphorylation sites. PGF₂ can also bind to EP₁ and EP₃ receptors with significant affinity. Therefore, FP as well as EP₁ and EP₃ receptors are coupled with mobilization of intracellular calcium (14). C-terminal variants of prostanoid receptors modulate the signal transduction, phosphorylation, and desensitization of these receptors, as well as altering agonist-independent constitutive activity. Both the transmembrane sequences and amino acid residues in the putative extracellular-loop regions determine ligand-binding selectivity of these receptors. The selectivity of interaction between the receptors and G proteins appears to be mediated at least in part by the C-terminal tail region.

IL-1ß induces the production of PG by up-regulation of the inducible isoform of COX-2 in a broad array of cell types and tissues (15). Several previous studies showed that inflammatory levels of cytokines, including IL-1ß can inhibit steroidogenesis and sperm production although the direct mechanisms involved are less clearly delineated within the seminiferous tubule (16, 17, 18, 19, 20). In Leydig cell progenitors, we previously reported that FP and EP₁ receptors mediate PGF₂ and PGE₂ regulation of IL-1ß expression, findings consistent with intratesticular PG effects on androgen production (12).

In Sertoli cells, our data showed that IL-1ß is a potent inducer of several IL (namely, IL-1, IL-1ß, and IL-6) (21, 22). Furthermore, our recent studies demonstrated that the COX-2 pathway is involved in this cytokine regulation because the COX-2 selective inhibitor, NS-398, significantly impairs induction by IL-1ß (23).

The aims of the present study were 1) to determine whether a Sertoli cell regulatory loop exists between IL-1ß, activation of its receptor, and downstream signaling pathways on the regulation of PG production and, 2) to characterize the specific PG receptors involved in mediating the action of intratesticular prostanoids on cytokine expression in the seminiferous tubule.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Sertoli cell preparations
Sertoli cells were isolated and purified as previously reported (24) from the testes of 18-d-old Sprague Dawley [Crl: CD (Sprague Dawley) BR-CD] rats purchased from Charles River Laboratories, Inc. (Kingston, NY). Animals were housed in standard lighting (12 h light, 12 h dark) with food and water allowed ad libitum in facilities approved by the American Association for the Accreditation of Laboratory Animal Care. Procedures involving the use of animals strictly followed the Guidelines for Care and Use of Laboratory Animals set forth by the National Institutes of Health and protocols received Institutional Animal Care and Use Committee approval. Rat Sertoli cells were incubated at 34 C at a density of 1 x 10⁷ cells per 100-mm polystyrene dish in phenol red-, serum-, and endotoxin-free DME/F-12 medium (Irvine Scientific, Santa Ana, CA) as described previously (25). This medium was supplemented with 2.5 µg/ml bovine insulin (Sigma, St. Louis, MO), 1.0 µg/ml transferrin (Calbiochem, La Jolla, CA), and 10 µg/ml bacitracin (Sigma). On d 3 ex vivo, Sertoli cells were rinsed twice with fresh serum- and phenol red-free culture medium and then treated with IL-1ß (10 ng/ml) in the absence or presence of COX-2-selective activity inhibitor, NS-398 (10 µM, COX-2-selective); the c-Jun NH₂-terminal kinase (JNK) inhibitor, SP600125 (10 µM); the PKA inhibitor, H89 (10 µM); or the PKC inhibitor, Calphostin C (1 µM). Cells were also concomitantly treated with PGs (10 µM) or receptor subtype-selective agonists for prostanoid receptors. The doses of all drugs were selected on the basis of several similar studies that showed their maximal effects, specificity, and effectiveness (9, 12, 27, 28). At 0.5, 1, 3, 6, and 24 h after either vehicle (control), IL-1ß, and/or addition of the inhibitor(s) or PGs, whole cell lysates for protein and total RNA were isolated from each replicate. Duplicate or triplicate replicate Sertoli cell cultures were used for each drug treatment; each experiment was repeated at least three times. The mean (±SEM) of data obtained from all of the individual experiments was calculated for RNA, ELISA, and protein analyses.

Drugs
Recombinant IL-1ß was purchased from R&D Systems (Minneapolis, MN). NS-398 (N-[2-(cyclohexyloxy)-4-nitrophenyl]-methanesulfonamide) was purchased from Cayman Chemical (Ann Arbor, MI). SP600125 (N¹-methyl-substituted pyrazolanthrone (N¹-methyl-1,9-pyrazoloanthrone)), forskolin (8,13-epoxy-7ß-(N-metylpiperazino--butyryloxy)-1, 6ß,9-trihydroxy-labd-14-en-11-one), H-89 (N-[2-((p-bromocinnamyl)amino)etyl]-5-isoquinolinesulfonamide), and Calphostin C (UCN-1028c) were purchased from Calbiochem. Cycloheximide (CHX) was used as protein synthesis inhibitor and was purchased from Sigma. Recombinant IL-1ß was dissolved in 0.1% BSA in PBS as a 100-fold (10 µg/ml) stock solution. Matched aliquots of 0.1% BSA were used in control cultures at 1 µl/ml; the final BSA concentration was 0.0001%. COX, JNK, PKA, and PKC inhibitors were dissolved in dimethylsulfoxide (DMSO; Fisher Scientific, Swanee, GA), and subsequent dilutions, as needed, were performed in serum- and phenol red-free medium on the day of the experiment. The final DMSO concentration was 0.1%. Matched DMSO alone was used as the vehicle control as required. CHX and forskolin were dissolved in ethanol and H₂O, respectively (5 µg/ml and 10 µM, respectively).

PGE₂, PGF₂, Carbaprostacyclin (cPGI₂ analog; 6,9-methylene-11,15 S-dihydroxy-prosta-5E,13E-dien-1-oic acid), U-46619 (9,11-dideoxy-9,11-methanoepoxy-prosta-5Z,13E-dien-1-oic acid), 11-deoxy PGE₁ (9-oxo-15S-hydroxy-prost-13E-en-1-oic acid), 17-phenyl trinor PGE₂ (9-oxo-11,15S-dihydroxy-17 -phenyl-18,19,20-trinor-prosta-5Z,13E-dien-1-oic acid), Butaprost (9-oxo-11,16R-dihydroxy-17-cyclobutyl-prost-13E-en-1-oic acid, methyl ester), Cloprostenol [9,11,15-trihydroxy-16-(3-chlorophenoxy)-17,18,19,20-tetranor-prosta-5Z,13E-dien-1-oic acid, sodium salt], and Sulprostone [N-(methylsulfonyl)-9-oxo-11,15R-dihydroxy-16-phenoxy-17,18,19,20-tetranor-prosta-5Z,13E-dien-1-amide] were purchased from Cayman Chemical. The bioactive PGD₂ metabolite, 15-deoxy-^12,14-PGJ₂ (15d-PGJ_2; 11-oxo-prosta-5Z,9,12E,14Z-tetraen-1-oic acid) was purchased from Calbiochem.

PG and synthetic agonists were dissolved in stock solutions of DMSO, and subsequent dilutions were performed, as needed, in sterile phenol red- and serum-free medium on the day of the experiment.

Protein extraction and Western analysis
Whole cell homogenates were extracted for protein lysates for 15 min on ice in buffer [10 mM Tris-HCl (pH 7.8) containing 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 150 mM NaCl, 1 mM ethylene-diamine-tetra-acetic acid, 1 mM phenylmethylsulfonylfluoride, 2 mM dithiothreitol, 2 mM sodium orthovanadate, 2 µg/ml aprotinin, 2 µg/ml pepstatin, and 2 µg/ml leupeptin]. Cellular debris was pelleted by centrifugation at 12,000 x g for 15 min.

The proteins in the supernatant were then subjected, under reducing conditions, to SDS-PAGE using 4–20% Tris-glycine gels (Novex, San Diego, CA), and were electrophoretically transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The membranes were sequentially probed with antibodies, as described below. Polyclonal antibodies raised against phosphorylated (phospho-) proteins phospho-pan PKC (1:1000) and phospho-cAMP response element binding protein (CREB) (1:1000) were obtained from Cell Signaling Technology, Inc. (Beverly, MA). Antibodies specific for PG receptor subtypes EP₂ and EP₄ were purchased from Alpha Diagnostic International (San Antonio, TX); anti-EP₁, EP₃, FP, and prostaglandin D₂ receptor (PGD₂ receptor) polyclonal antibodies (1:1000) were obtained from Cayman Chemical. Monoclonal anti-ß-actin antibody (1:2000) was purchased from Sigma. Blots were developed with the enhanced chemiluminescence Western blotting system (Amersham, Arlington Heights, IL) and exposed to x-ray film (Kodak, Rochester, NY).

Total RNA extraction
Total RNA was extracted from Sertoli cells using the TRIzol reagent (Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s instructions. RNA was measured using 260/280 UV spectrophotometry.

RT-PCR analysis
Total RNA (2 µg) was reverse transcribed for 15 min at 42 C. Reverse transcription (RT) was performed in a 20-µl mixture containing 5 mM MgCl₂, 1x PCR buffer II, 4 mM each of deoxy-NTP, 1 U/µl ribonuclease inhibitor, and 2.5 mM random hexamers. Samples were then denatured (5 min, 99 C). A no-template control was performed for each experiment, establishing the absence of genomic contamination of the samples.

PCR was performed using 3 µl of each RT product as a template. The following primers were used for PCR amplification to detect PG receptor subtypes; the S16 ribosomal gene was simultaneously amplified and used for normalization (Table 1). AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA) was used at 25 mU/µl. The PCR mixture (25 µl) contained 2 mM MgCl₂, 1x PCR buffer II, and each primer at 0.2 µM. Amplification was performed in a programmable thermal controller (model PTC-100; MJ Research, Inc., Watertown, MA). The samples were first denatured at 95 C for 2 min, followed by 35 PCR cycles; the temperature profile was 95 C (30 sec), annealing temperature (30 sec), and 72 C (90 sec). Annealing temperatures were as follows: EP₁, EP₃, and EP₄, 61 C; EP₂ and FP, 56 C; prostacyclin receptor (IP), 60 C; and DP₁, 54 C. After the last cycle, an additional extension incubation was performed (7 min, 72 C).

Quantitative real-time PCR (Q-PCR) analysis
Fluorescence-monitored Q-PCR assays using a standard curve method of analysis were conducted to quantitatively determine in each sample the levels of rat IL-1, IL-1ß, IL-6, and EP₂ mRNAs (6-carboxy-fluorescein-labeled probes) with 18S ribosomal RNA (VIC-labeled probe) used to normalize the data for specific mRNAs.

Reactions were set up in triplicate in optical 96-well reaction plates by adding 23 µl of a mix containing 1x qPCR MasterMix Plus (Eurogentec, Philadelphia, PA), 200 nM primers, 100 nM probe for the gene of interest, 50 nM primers, 200 nM probes for the 18S ribosomal RNA, and 2 µl of 6-fold diluted cDNA sample was subsequently added to each well. The detection of IL mRNAs was performed using proprietary TaqMan primers and probes (PE Applied Biosystems). EP₂ primers were designed and prepared to order for this study: forward, GCCCTGGCTCCCGAAA and reverse, GAGCATCGTGGCCAGACTAAA, with CGCGTGTACCTATTTCGCTTTCACTATGACC as probe (Applied Biosystems). Q-PCR were performed using a PE Applied Biosystems model 7700 Sequence Detection System. The temperature profile for the reactions was 50 C (2 min), 95 C (10 min), and 40 cycles of 95 C (15 sec) and 60 C (1 min). Using the manufacturer’s software, a threshold above the noise was chosen, and the cycle number (C_T) at which fluorescence, generated by the cleavage of the probe, exceeded the threshold was determined for each well. For each real-time PCR assay, a standard curve was generated by six 2-fold serial dilutions in water of the RT samples corresponding to the control. The mean C_T value for each cDNA sample was expressed as an arbitrary value relative to the standard curve after linear regression analysis. Experimental samples were diluted 3-fold for comparison with the standard curve. A no-template control was performed for each reaction in duplicate. Data were normalized with 18S values and were expressed as arbitrary units relative to control, set as a value of 1.

ELISA
Sertoli cells were not treated (control) or treated with IL-1ß (10 ng/ml), IL-1ß (10 ng/ml) with NS-398 (10 µM), SP600125 (10 µM), or CHX (5 µg/ml) for 1, 3, and 6 h. Cell-free supernatants were transferred to sterile microcentrifuge tubes. Two 50-µl aliquots of conditioned medium were assayed using individual PGD₂, PGE₂, PGF₂, and cPGI₂ ELISA kits according to the manufacturer’s instructions (Cayman Chemical). The sensitivity of the assay (80% bound) was 200, 36, 9, and 11 pg/ml for PGD₂, PGE₂, PGF₂, and cPGI₂ (6-keto PGF₁), respectively, and the intra and interassay coefficients of variation were less than 10% for all EIA kits. The concentration of PGs was determined by competitive binding in replicates in an ELISA measured by a standard curve method using a microplate reader (model MRX; Dynex Technologies, Inc., Chantilly, VA). These measurements were made in duplicate; experiments were repeated using three separate Sertoli cell isolations and purifications before their subsequently independent primary cultures ex vivo.

Data analysis
Densitometry was performed using image-capture photography (Kodak) and analysis with NIH Image software, Scion Image (Scion Corp.). Densitometric analyses are expressed in arbitrary units.

All quantitative and semiquantitative PCR, Western, and ELISA results are the mean ± SEM derived from the total number of different experiments, each with three to four replicates. Statistical analyses were performed using t test or paired t test, ANOVA. Values of P 0.05 were considered significant.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
IL-1ß induction of Sertoli cell PGE₂ and PGF₂ requires de novo protein synthesis
Because our recent studies show that IL-1ß triggers the phosphorylation of Sertoli cell JNK and inducible COX-2 expression, experiments were performed to determine whether COX-activity results in the induction of PG. PG responses to IL-1ß signaling were evaluated in the presence or absence of selective inhibition of the individual downstream signaling components, JNK and COX-2 (23). Sertoli cell PGE₂, PGF₂, PGD₂, and cPGI₂ levels were determined at specified times after IL-1ß using specific ELISA and the conditioned culture media.

IL-1ß treatment led to a significant and rapid increase (1 h) in PGE₂ and PGF₂ secretion (Fig. 1A). By 6 h, a significant stimulation of PGE₂ and PGF₂ secretion (7- and 11-fold that of controls, respectively) was observed. Basal PGD₂ concentration was not detectable, and no increase was observed after IL-1ß treatment; a 2.2-fold increase in cPGI₂ secretion was observed (data not shown). In the presence of the specific COX-2 activity inhibitor NS-398, IL-1ß induction of PGE₂ and PGF₂ levels dramatically decrease at 3 h and show complete inhibition by 6 h (Fig. 1B, cross-hatched bars). In comparison, the JNK inhibitor SP600125 significantly decreases PGE₂ and PGF₂ induction at 3 h, but to a lesser degree than that observed with direct inhibition of COX-2 activity. Whereas the inability to activate JNK significantly decreases the total PG levels induced by IL-1ß at 6 h, the relative amount of this decrease is smaller than the earlier time point, suggesting that JNK pathway inhibition alone is not sufficient (Fig. 1B, stippled bars). Similarly, IL-1ß induction of Sertoli cell cPGI₂ is also abolished at 3 and 6 h by the inhibition of COX-2 or JNK activity (data not shown).

View larger version (16K): [in this window] [in a new window]   FIG. 1. IL-1ß significantly increases COX-2-dependent Sertoli cell PGE2 and PGF2. A, Sertoli cells were cultured without (control) or with IL-1ß (10 ng/ml) for 1, 3, and 6 h. Specific ELISA were used to determine the PGE2 and PGF2 concentrations in the same conditioned serum-free media replicates. Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the value for matched Sertoli cells treated only with the vehicle blank (control, Ct). B, The COX-2 inhibitor NS-398 (cross-hatched), the JNK inhibitor SP600125 (stippled), or pretreatment with the protein synthesis inhibitor CHX (open) inhibit IL-1ß increases (closed bars) in extracellular PGE2 and PGF2 (3 and 6 h). Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the value for cells treated with IL-1ß only (closed bars).

2

2

2

2

Sertoli cell expression of EP subtypes, and the FP and IP receptors
PGE₂ and PGF₂ are the predominant PG induced by IL-1ß in Sertoli cells. To better understand the signaling pathways affected by this cytokine, we next determined the PG receptor subtypes expressed in Sertoli cells and those required for potential PG-regulated autocrine effects. Control Sertoli cells express EP₁, EP₂, EP₃, EP₄, FP, and IP receptor mRNAs were each detected by RT-PCR analysis (data not shown). By RT-PCR analysis, DP₁ receptor mRNA is not expressed in Sertoli cells (data not shown). To evaluate whether IL-1ß activated transcriptional mechanisms for the PG receptor subtypes present, we compared mRNA levels in nonstimulated control with that of IL-1ß-treated Sertoli cells. Using semiquantitative RT-PCR analyses, mRNA levels were evaluated at various times after treatment with IL-1ß. Changes were only observed in EP₂ mRNAs. In contrast, in matched samples from four separate primary experiments, no changes in steady-state levels for the other EP subtypes, FP or IP receptors were observed (not shown). To quantitate this regulation, Q-PCR analysis was performed (n = 12). IL-1ß rapidly and significantly decreased the level of EP₂ receptor mRNA within 1 h (50%, P 0.001). Although still significantly decreased relative to that of the controls, EP₂ mRNA levels progressively began to increase within 3 (P 0.001) and 6 h (P 0.01) and were at normal levels by 24 h after IL-1ß treatment (Fig. 2A).

View larger version (24K): [in this window] [in a new window]   FIG. 2. IL-1ß treatment regulates Sertoli EP2 expression. A, The effects of IL-1ß treatment on steady-state levels of EP2 mRNA were evaluated by multiple Q-PCR analyses in the same replicate samples (n = 12) as indicated in Materials and Methods. Sertoli cells were cultured without (control, Ct, open bars) or with IL-1ß (10 ng/ml) for 1, 3, 6, and 24 h. Results are the mean ± SEM from four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct, which is set as 1. ***, A significant difference (P < 0.001) from the Ct value; **, a significant difference (P < 0.01) from the Ct. B, EP2 receptor protein levels were evaluated in Sertoli cells cultured for 0.5, 1, 3, 6, or 24 h with IL-1ß (10 ng/ml) or without (Ct). Whole cell lysates were prepared from four individual primary experiments. For each experimental set, proteins (50 µg/lane) were subjected to SDS-PAGE followed by sequential immunoblot analyses on a given membrane for all PG receptors and ß-actin. For illustration, a representative sequential Western analysis using a single membrane is shown for the EP2 receptor and ß-actin.

IL-1ß treatment significantly increases Sertoli cell EP₂ receptors
Western analysis was performed for the PG receptors using whole cell lysates obtained from four separate preparations of Sertoli cells. Although EP₁, EP₃, EP₄, and FP and IP receptor proteins are detected in freshly isolated and purified as well as cultured Sertoli cells, their respective basal protein expression levels were not changed with IL-1ß treatment (not shown). Significant increases in EP₂ receptor protein were observed at 1–3 h after IL-1ß, findings suggesting early posttranscriptional regulation (Fig. 2B). Consistent with our ELISA data indicating that under these conditions Sertoli cells did not secrete PGD₂, neither DP₁ mRNA nor its protein was detected in Sertoli cells (data not shown).

To further identify the mechanisms for EP₂ induction by IL-1ß, Sertoli cells were pretreated with the protein synthesis inhibitor, CHX (30 min). CHX prevented the IL-1ß-stimulated elevation in the levels of EP₂ protein levels (data not shown). Taken together, our data indicates that IL-1ß-mediated increases in EP₂ receptor protein is not directly due to increases in EP₂ mRNA transcription, but does require de novo protein synthesis. Based on our recent studies, one protein synthesis requirement is likely inducible COX-2 (23).

Our previous studies showed that IL-1ß is a potent autocrine regulator of Sertoli cell cytokine expression in a dose- and time-dependent manner (21, 22, 23). These effects are dependent on de novo protein synthesis of IL-1ß-inducible COX-2 (23). To evaluate the individual contribution of those prostanoids induced by signaling events secondary to COX-2 activation, we next evaluated the effects of these PGs on Sertoli cytokine expression.

PGE₂ and PGF₂ induce expression of distinct cytokines without a requirement for COX-2 activation
The direct effects of PGE₂ and PGF₂ on cytokine expression were compared with that of carbaprostacyclin (cPGI₂; a stable analog of PGI₂), 15d-PGJ₂ (a bioactive metabolite of PGD₂), and U-46619 (a thromboxane A₂-mimetic agonist) (Fig. 3; 10 µM each). Significant induction of IL-1ß mRNA is observed with either PGE₂ or PGF₂ (Fig. 3B). IL-6 mRNA levels significantly increase when cells are stimulated by PGE₂ (Fig. 3C). In contrast, IL-1 mRNA levels are unaffected by any of the PG treatments (Fig. 3A). Interestingly, the antiinflammatory PG 15d-PGJ₂ significantly reduces basal IL-1ß mRNA levels (Fig. 3B).

View larger version (20K): [in this window] [in a new window]   FIG. 3. PGE2 and PGF2 differentially induce IL-1ß or IL-6 mRNA levels. Sertoli cells were cultured for 3 h without (control, Ct, open bars) or with PGE2 and PGF2, 15d-PGJ2, cPGI2, and U-46619 (10 µM each, closed bars). Using the same total RNA replicate samples, Q-PCR analyses using particular primers and probes for IL-1 (A), IL-1ß (B), or IL-6 (C) were performed. Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from the Ct value.

2

2

View larger version (15K): [in this window] [in a new window]   FIG. 4. PGE2 and PGF2a dose-dependently stimulate Sertoli IL-1ß mRNA levels. Sertoli cells cultures were exposed to the indicated concentrations of PGE2 (10 µM, closed bars) or PGF2 (10 µM, open bars) for 3 h, and the levels of IL-1ß mRNA were determined in each replicate sample of total RNA using Q-PCR analysis. Data are normalized with 18S values and are expressed as the mean fold increase in IL-1ß mRNA levels in PG-treated cells compared with untreated controls. Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the control (Ct) value.

2

2

2

2

View larger version (22K): [in this window] [in a new window]   FIG. 5. Prostanoids PGE2 and PGF2 are potent activators of cytokine expression. The effects of PGs on steady-state levels of IL mRNAs in Sertoli cells treated with IL-1ß and NS-398 were evaluated by Q-PCR analysis. Sertoli cells were cultured for 3 h without (Ct, open bars) or with IL-1ß (10 ng/ml, closed bars) in the absence or presence (+Veh, cross-hatched) of NS-398 (10 µM). PGs (10 µM) were added concomitantly with IL-1ß (10 ng/ml) + NS-398 (10 µM). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1 (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to control (Ct) set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß and NS-398 (Veh) value. , A significant difference (P 0.05) from the increases obtained with IL-1ß only.

2

View larger version (22K): [in this window] [in a new window]   FIG. 6. Agonists for specific PG receptors enhance distinct cytokine mRNA levels. Sertoli cells were cultured for 3 h without (control, Ct, open bar) or with IL-1ß (10 ng/ml, closed bar) in the absence or presence (Veh, cross-hatched) of NS-398 (10 µM). Cloprostenol (FP agonist, 0.1 µM), Butaprost (EP2 agonist; 10 µM), 17-phenyl trinor PGE2 (EP1/EP3 agonist, 10 µM), 11-deoxy PGE1 (EP2/EP4 agonist, 10 µM), and Sulprostone (EP3/EP1 agonist, 10 µM) were added concomitantly with IL-1ß + NS-398. Total RNAs were extracted, and cDNAs were amplified by Q-PCR assays using particular primers and probes for IL-1 (A), IL-1ß (B), or IL-6 (C) in the same replicate samples. Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß + NS-398 (Veh, cross-hatched) value. , A significant difference (P 0.05) from the increases obtained with IL-1ß only.

2

2

Our recent studies demonstrate that IL-1ß significantly phosphorylates JNK and induces COX-2 expression (23). The current findings show that after COX-2 activation, Sertoli cell PG are increased. These PG and their receptors (or pharmacological agonists) are able to stimulate cytokine expression. Biological effects that result from the binding of PGE₂ to EP₂ receptors are known to involve downstream cAMP-PKA signaling pathways (29). In comparison, PKC-dependent phosphorylation is responsible for differential regulation of second messenger signaling by FP prostanoid receptors (30).

Therefore, we next determined whether PGE₂-stimulated EP₂ receptors and PGF₂-activated FP signaling in Sertoli cells activate the PKA and/or PKC pathways, thereby regulating cytokine expression.

IL-1ß, PGE₂, and PGF₂ differentially activate Sertoli cell PKA and PKC pathways
To determine whether PKA and/or PKC is activated after IL-1ß, PGE₂, or PGF₂ treatments, proteins were isolated from whole cell lysates prepared from Sertoli cells treated as indicated.

Phosphorylation of CREB protein (43 kDa) by IL-1ß was observed within 30 min (Fig. 7A) but did not phosphorylate PKC (data not shown). In comparison, PGE₂ resulted in a rapid phosphorylation of PKC (30 min) and CREB (1 h) (Fig. 7B). In contrast, PGF₂ treatment results in a significant increase in phosphorylated PKC by 1 h (Fig. 7C) but did not show any change in the phosphorylation status of CREB protein (data not shown).

View larger version (40K): [in this window] [in a new window]   FIG. 7. Differential IL-1ß, PGE2 and PGF2 PKA and PKC signaling. Sertoli cells were cultured in the presence or absence (control, Ct) of IL-1ß (10 ng/ml) or PGE2 (10 µM) for 0.5, 1, 3, and 6 h. A, Western analysis using whole cell extracts (30 µg/lane) show significant increases in phosphorylated CREB protein (43 kDa) within 0.5 h of the addition of IL-1ß; the same membrane was reprobed for ß-actin (42 kDa) to determine equal loading and for normalization of signals. B, Western analysis using whole cell extracts show increases in phosphorylated pan-PKC at 0.5 h and CREB protein (43 kDa) within 1 h of PGE2 addition; the same membrane was reprobed for ß-actin to assess equal loading in the lanes and for normalization of signals. C, Western analysis using whole cell extracts showed a phosphorylated PKC protein (80 kDa) within 1 h of the addition of PGF2 (10 µM); the same membrane was reprobed for ß-actin to assess equal loading in the lanes and for normalization of signals. A representative experiment of three replicates is shown in A, B, and C. Results are the mean ± SEM.

View larger version (22K): [in this window] [in a new window]   FIG. 8. Forskolin increases IL-1ß and IL-6 mRNA levels. The effects of IL-1ß or forskolin treatment on steady-state levels of IL mRNAs were evaluated by multiple Q-PCR analyses in the same replicate samples. Sertoli cells were cultured for 3 h without (control, Ct, open bars), with IL-1ß (10 ng/ml, closed bars), forskolin (10 µM, cross-hatched bars), or forskolin with the PKA inhibitor H89 (stippled bars). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1 (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct, which is set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of Ct value. , A significant difference (P < 0.05) from similar values obtained in the presence of forskolin only.

View larger version (22K): [in this window] [in a new window]   FIG. 9. Differential kinase inhibition reduces IL-1ß induction of Sertoli cytokine expression. The effects of inhibition of PKA or PKC-dependent pathways on IL-1ß-induced levels of IL mRNAs were evaluated when COX-2 activity (and subsequently dependent events) were concomitantly inhibited. Sertoli cells were cultured for 3 h without (control, Ct, open bars) or with IL-1ß (10 ng/ml) in the absence or presence of NS-398 (COX-2 inhibitor, 10 µM, cross-hatched bars), H89 (PKA inhibitor, 10 µM), or Calphostin-C (PKC inhibitor, 1 µM). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1 (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß only.

2

View larger version (33K): [in this window] [in a new window]   FIG. 10. Proposed IL-1ß, PG, and PG receptor autocrine amplifying loop. A multistep Sertoli cell model that incorporates the components identified by these studies illustrates one working hypothesis for the proposed biological regulatory loop. Transcriptional (dotted lines) and posttranscriptional effects (boxed text) are indicated (23 ). Transient autocrine production of IL-1ß stimulates Sertoli JNK and the inducible COX-2 cascade (purple). Arachidonic acid (AA) from membranes is metabolized by COX-2 to PGH2, which is converted by synthases into PGE2 and/or PGF2. Secreted PGE2 activates the Sertoli transmembrane EP2 receptor, intracellular PKA, and cAMP (red objects, yellow outlines) and, in addition, PKC phosphorylation. Secreted PGF2 activates the Sertoli transmembrane FP receptor and PKC signaling (yellow objects, green outlines). PKA signaling, and in part, PKC regulate the duration and composition of inducible cytokine and PG production, influencing Sertoli intracellular and Sertoli-germ cell extracellular microenvironments. Auto-amplification of cytokine and PG expression occurs by multiple regulatory steps including their biosynthesis and influx and efflux transporter activities (blue lines). Temporally patterned cross talk signaling pathways contribute to an integrated and biologically relevant circuit.

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

2

2

2

2

Our data are consistent with differential pathway regulation mediated by particular transmembrane PG receptors. This study indicates that PGE₂-EP₂ signaling is primarily responsible for Sertoli cell cytokine induction. EP₂ and EP₄ are G protein-coupled receptors that activate adenylate cyclase, resulting in increased cAMP levels and the activation of cAMP-dependent protein kinases (29, 31). IL-1 is regulated by EP₁, EP₂, EP₃, and FP. IL-1 and IL-6 are more dose-responsive to FP activation than is IL-1ß. EP₂ and possibly EP₄ agonists induce Sertoli cell IL-6 expression but not EP₁ or EP₃ indicating that intracellular calcium movement does not contribute to IL-6 regulation. In addition to EP₂- and EP₄-activated signaling, EP₁ or EP₃ agonists increase IL-1 and IL-1ß mRNA levels. Because EP₁ and EP₃ are coupled with the mobilization of intracellular calcium and the PKC pathway, and EP₃ receptor signaling can inhibit PKA activation, multiple receptor-mediated pathways are involved in the integrated regulation of these cytokines (11, 14).

During Sertoli cell development and differentiated function, IL-1 and IL-6 are expressed under basal physiological conditions in response to the pituitary gonadotropic hormone FSH. FSH activates the PKA-cAMP signaling pathway and, consequently, CREB. PKA-dependent phosphorylation of CREB regulates the transcription of cAMP-responsive genes and thereby positively auto-regulates CREB expression itself. In Sertoli cells, activated CREB promotes transcription of genes essential for proper germ cell differentiation; FSH and androgens regulate CREB-mediated transferrin secretion, and CREB levels fluctuate in a stage-specific and germ cell-associated manner (32, 33). The round spermatid-secreted cytokine TNF- has been shown to activate NF-B-dependent CREB expression in Sertoli cells (33). In this study, we show that transient exposure to either IL-1ß or PGE₂ activates Sertoli cell CREB through its phosphorylation, consistent with regulation of genes participating in spermatogenesis. It is well established that IL-1ß can increase intracellular cAMP levels in a variety of cell types and that inducers of cAMP such as forskolin or cAMP analogs can mimic some, but not all, of the effects of IL-1ß (34).

Forskolin, a potent activator of adenylyl cyclase and intracellular cAMP, significantly increased IL-1ß and IL-6 mRNA levels; IL-1 mRNA changes were modest and not statistically significant. This implies significant differences in PG signaling and the resulting transcriptional activation of distinct IL gene promoters. Our earlier studies (35) demonstrated that FSH effects mediated by cAMP induction and PKA activation could increase cytokine induction, findings consistent with the forskolin effects shown in this study. Forskolin induction of IL-1ß and IL-6 mRNA levels was blunted by PKA inhibition, findings reflecting the downstream effects of increased intracellular cAMP levels on expression of these two cytokines. In comparison, IL-1ß induction of IL-1, IL-1ß, and IL-6 expression was decreased by PKA inhibition indicating important regulatory participation by non-PKA-dependent mechanisms.

FP receptor expression did not change at either mRNA or protein levels after IL-1ß. It is noteworthy that PGF₂ also induced cytokine expression, but only at the 10-µM dose, an effect independent of adenylate cyclase and cAMP-dependent protein kinase activation. PGF₂ may act on its G protein-coupled receptor (FP) or be imported intracellularly via a PG transporter, which has high affinity for PGF₂ and PGE₂, but not prostacyclin PGI₂ (36). Differences in the capacity of PGE₂ and PGF₂ to induce cytokine production may reflect dissimilarity in the total numbers of the particular prostanoid receptors per Sertoli plasma membrane, PG uptake/efflux mechanisms, as well as the individual or multiple downstream signaling pathways activated. However, the data are consistent with the hypothesis that PGE₂ is the IL-1ß-induced PG primarily responsible for the Sertoli PKA-cAMP signaling resulting in cytokine induction. Interestingly, PKC inhibition also prevented IL-1ß induction of IL-1 and IL-1ß expression but not that of IL-6, findings indicating that PKC activity does not regulate IL-6. PKA signaling and, in part, PKC mediate PG-inducible cytokine production in Sertoli cells. These findings demonstrate that in, addition to physiological regulation by gonadotropins, distinct intratesticular PG can alter the intracellular signaling pathways that regulate mediate distinct cytokines.

In the testis, IL-1ß-to-PG signaling is likely defined by functional cell type, developmental status, and prostanoid specificity. EP₂ receptor activation alone is sufficient to mediate autocrine PGE₂ induction of Sertoli cell cytokine mRNA. In Leydig progenitors isolated and purified from the testis of rats the same age, our previous studies showed that IL-1ß significantly increases both EP₂ and EP₄ receptors while decreasing EP₁ receptor protein levels. The progenitor Leydig EP₁ receptor mediates PGE₂ regulation of its cytokine mRNAs (12). Together, these results suggest that within the male gonad, maturational and cell-specific differences in PG signaling lead to transcriptional activation of distinct IL gene promoters. Such differences have been described for nongonadal cell types. Additionally, the cell microenvironment reflecting both local autocrine and paracrine factors, gonadotropins, and steroid milieu may contribute. In the testis, spermatogenesis is supported by multiple factors from the major somatic cells as well as the germ cells themselves. Many studies, including those from this laboratory, suggest that a particular testis cell responds to an extracellular cue in the context of concentrations as well as the surrounding cell-to-cell associations; in time, the cell integrates these testicular factors with pulsatile pituitary hormonal influences. That other signals regulating PGE₂ responsiveness need to be temporally correlated with its release to specify the selective production of cytokines has been shown for nontesticular cells (37). Similarly, the present study indicates that the antiinflammatory PG 15d-PGJ₂ significantly reduces basal IL-1ß mRNA levels, data implying that certain PG can inhibit the expression of an individual cytokine.

Physiologically, Sertoli cytokines are also induced by residual bodies, which represent membrane-enclosed cytoplasmic contents shed by elongating spermatids during spermiogenesis. In defined stages of the rodent seminiferous cycle, the presence of residual bodies activates Sertoli cell phagocytosis and IL-1 release, events that initiate IL-6 secretion (38, 39, 40). This physiological stage-specific process induces Sertoli cell IL-1, -1ß, and -6 production and also accompanies pathological testicular inflammation (21, 22, 26, 35, 38, 39, 40). Temporal signaling by pituitary gonadotropins and local germ cell or Leydig cell paracrine factors may well contribute to an integrated biologically relevant regulatory loop. Identification of the mechanisms responsible for IL-1ß-dependent COX-2 activation and PG regulation should provide new insights into physiological processes in the testis. Additionally, new therapeutic interventions may be identified to prevent pathogenesis secondary to inflammatory-based dysfunction after cryptorchidism, testicular torsion, atypical hormonal conditions, autoimmune events, or orchitis.

	Acknowledgments

 
We express our appreciation for the excellent technical assistance of Lyann Mitchell and KeumSil Hwang.

	Footnotes

 
This study was supported by National Institutes of Health Grants HD29428 and HD39024 (to P.L.M.).

First Published Online January 19, 2006

Abbreviations: CHX, Cycloheximide; COX, cyclooxygenase; cPGI₂, carboprostacyclin; CREB, cAMP response element binding protein; DP, PGD₂ receptor; 15d-PGJ₂, 15-deoxy-^12,14-PGJ₂; DMSO, dimethylsulfoxide; EP, E-prostanoid receptor; FP, F-prostanoid; IP, prostacyclin receptor; JNK, c-Jun NH₂-terminal kinase; PG, prostaglandin (prostanoid); PGI₂, prostacyclin prostaglandin I₂; PKA, protein kinase A; PKC, protein kinase C; Q-PCR, quantitative real-time PCR; RT, reverse transcription.

Received December 12, 2005.

Accepted for publication January 9, 2006.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Kirschenbaum A, Liotta DR, Yao S, Liu XH, Klausner AP, Unger P, Shapiro E, Leav I, Levine AC 2000 Immunohistochemical localization of cyclooxygenase-1 and cyclooxygenase-2 in the human fetal and adult male reproductive tracts. J Clin Endocrinol Metab 85:3436–3441[Abstract/Free Full Text]
2. Breyer MD, Hebert RL, Breyer RM 2003 Prostanoid receptors and the urogenital tract. Curr Opin Investig Drugs 4:1343–1353[Medline]
3. Challis JR 1997 Prostaglandins and reproduction—what do knockouts really tell us? Nat Med 3:1326–1327[CrossRef][Medline]
4. Hizaki H, Segi E, Sugimoto Y, Hirose M, Saji T, Ushikubi F, Matsuoka T, Noda Y, Tanaka T, Yoshida N, Narumiya S, Ichikawa A 1999 Abortive expansion of the cumulus and impaired fertility in mice lacking the prostaglandin E receptor subtype EP₂. Proc Natl Acad Sci USA 96:10501–10506[Abstract/Free Full Text]
5. Sales KJ, Jabbour HN 2003 Cyclooxygenase enzymes and prostaglandins in reproductive tract physiology and pathology. Prostaglandins Other Lipid Mediat 71:97–117[CrossRef][Medline]
6. Kennedy CR, Zhang Y, Brandon S, Guan Y, Coffee K, Funk CD, Magnuson MA, Oates JA, Breyer MD, Breyer RM 1999 Salt-sensitive hypertension and reduced fertility in mice lacking the prostaglandin EP₂ receptor. Nat Med 5:217–220[CrossRef][Medline]
7. Tripiciano A, Filippini A, Ballarini F, Palombi F 1998 Contractile response of peritubular myoid cells to prostaglandin F₂. Mol Cell Endocrinol 138:143–150[CrossRef][Medline]
8. Lazarus M, Munday CJ, Eguchi N, Matsumoto S, Killian GJ, Kubata BK, Urade Y 2002 Immunohistochemical localization of microsomal PGE synthase-1 and cyclooxygenases in male mouse reproductive organs. Endocrinology 143:2410–2419[Abstract/Free Full Text]
9. Walch L, Morris PL 2002 Cyclooxygenase 2 pathway mediates IL-1ß regulation of IL-1, -1ß, and IL-6 mRNA levels in Leydig cell progenitors. Endocrinology 143:3276–3283[Abstract/Free Full Text]
10. Breyer RM 2001 Prostaglandin EP₁ receptor subtype selectivity takes shape. Mol Pharmacol 59:1357–1359[Free Full Text]
11. Breyer RM, Bagdassarian CK, Myers SA, Breyer MD 2001 Prostanoid receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol 41:661–690[CrossRef][Medline]
12. Walch L, Clavarino E, Morris PL 2003 Prostaglandin (PG) FP and EP₁ Receptors Mediate PGF₂ and PGE₂ regulation of interleukin-1ß expression in Leydig cell progenitors. Endocrinology 144:1284–1291[Abstract/Free Full Text]
13. Abramovitz M, Boie Y, Nguyen T, Rushmore TH, Bayne MA, Metters KM, Slipetz DM, Grygorczyk R 1994 Cloning and expression of a cDNA for the human prostanoid FP receptor. J Biol Chem 269:2632–2636[Abstract/Free Full Text]
14. Coleman RA, Smith WL, Narumiya S 1994 International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev 46:205–229[Medline]
15. Smith WL, DeWitt DL, Garavito RM 2000 Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 69:145–182[CrossRef][Medline]
16. Hales DB 1992 Interleukin-1 inhibits Leydig cell steroidogenesis primarily by decreasing 17-hydroxylase/C17–20 lyase cytochrome P450 expression. Endocrinology 131:2165–2172[Abstract/Free Full Text]
17. Xiong Y, Hales DB 1997 Differential effects of tumor necrosis factor- and interleukin-1 on 3ß-hydroxysteroid dehydrogenase/54 isomerase expression in mouse Leydig cells. Endocrine 7:295–301[Medline]
18. Calkins JH, Sigel MM, Nankin HR, Lin T 1988 Interleukin-1 inhibits Leydig cell steroidogenesis in primary culture. Endocrinology 123:1605–1610[Abstract/Free Full Text]
19. Wang D, Nagpal ML, Shimasaki S, Ling N, Lin T 1995 Interleukin-1 induces insulin-like growth factor binding protein-3 gene expression and protein production by Leydig cells. Endocrinology 136:4049–4055[Abstract]
20. Lin T, Wang D, Stocco DM 1998 Interleukin-1 inhibits Leydig cell steroidogenesis without affecting steroidogenic acute regulatory protein messenger ribonucleic acid or protein levels. J Endocrinol 156:461–467[Abstract]
21. Okuda Y, Bardin CW, Hodgskin LR, Morris PL 1995 Interleukins-1 and -1ß regulate interleukin-6 expression in Leydig and Sertoli cells. Recent Prog Horm Res 50:367–372[Medline]
22. Okuda Y, Sun X-R, Morris PL 1994 Interleukin-6 (IL-6) mRNAs expressed in Leydig and Sertoli cells are regulated by cytokines, gonadotropins and neuropeptides. Endocrine 2:617–624
23. Ishikawa T, Hwang K, Lazzarino D, Morris PL 2005 Sertoli cell expression of steroidogenic acute regulatory protein-related lipid transfer 1 and 5 domain-containing proteins and sterol regulatory element binding protein-1 are interleukin-1ß regulated by activation of c-jun N-terminal kinase and cyclooxygenase-2 and cytokine induction. Endocrinology 146:5100–5111[Abstract/Free Full Text]
24. Morris PL, Vale WW, Cappel S, Bardin CW 1988 Inhibin production by primary Sertoli cell-enriched cultures: regulation by follicle-stimulating hormone, androgens, and epidermal growth factor. Endocrinology 122:717–725[Abstract/Free Full Text]
25. Kanzaki M, Morris PL 1998 Identification and regulation of testicular interferon (IFN-) receptor subunits: IFN- enhances interferon regulatory factor-1 (IRF-1) and interleukin-1ß converting enzyme (ICE) expression. Endocrinology 139:2636–2644[Abstract/Free Full Text]
26. Cudicini C, Kercret H, Touzalin AM, Ballet F, Jegou B 1997 Vectorial production of interleukin 1 and interleukin 6 by rat Sertoli cells cultured in a dual culture compartment system. Endocrinology 138:2863–2870[Abstract/Free Full Text]
27. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, Lamontagne S, Rochette C, Sawyer N, Tremblay NM, Belley M, Gallant M, Dufresne C, Gareau Y, Ruel R, Juteau H, Labelle M, Ouimet N, Metters KM 2000 The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim Biophys Acta 1483:285–293[Medline]
28. Kimura M, Osumi S, Ogihara M 2001 Prostaglandin E₂ (EP₁) receptor agonist-induced DNA synthesis and proliferation in primary cultures of adult rat hepatocytes: the involvement of TGF-. Endocrinology 142:4428–4440[Abstract/Free Full Text]
29. Narumiya S, FitzGerald GA 2001 Genetic and pharmacological analysis of prostanoid receptor function. J Clin Invest 108:25–30[CrossRef][Medline]
30. Fujino H, Srinivasan D, Pierce KL, Regan JW 2000 Differential regulation of prostaglandin F2 receptor isoforms by protein kinase C. Mol Pharmacol 57:353–358[Abstract/Free Full Text]
31. Negishi M, Sugimoto Y, Ichikawa A 1995 Molecular mechanisms of diverse actions of prostanoid receptors. Biochim Biophys Acta 1259:109–119[Medline]
32. Walker WH, Fucci L, Habener JF 1995 Expression of the gene encoding transcription factor cyclic adenosine 3',5'-monophosphate (cAMP) response element-binding protein (CREB): regulation by follicle-stimulating hormone-induced cAMP signaling in primary rat Sertoli cells. Endocrinology 136:3534–3545[Abstract]
33. Don J, Stelzer G 2002 The expanding family of CREB/CREM transcription factors that are involved with spermatogenesis. Mol Cell Endocrinol 187:115–124[CrossRef][Medline]
34. Dinarello CA 1997 Interleukin-1. Cytokine Growth Factor Rev 8:253–265[CrossRef][Medline]
35. Okuda Y, Morris PL 1994 Identification of interleukin-6 receptor (IL-6R) mRNA in isolated Sertoli and Leydig cells: regulation by gonadotropin and interleukins in vitro. Endocrine 2:1163–1168
36. Vezza R, Rokach J, FitzGerald GA 2001 Prostaglandin F₂ receptor-dependent regulation of prostaglandin transport. Mol Pharmacol 59:1506–1513[Abstract/Free Full Text]
37. Williams JA, Shacter E 1997 Regulation of macrophage cytokine production by prostaglandin E₂. Distinct roles of cyclooxygenase-1 and -2. J Biol Chem 272:25693–25699[Abstract/Free Full Text]
38. Gerard N, Syed V, Jegou B 1992 Lipopolysaccharide, latex beads and residual bodies are potent activators of Sertoli cell interleukin-1 production. Biochem Biophys Res Commun 185:154–161[CrossRef][Medline]
39. Syed V, Gerard N, Kaipia A, Bardin CW, Parvinen M, Jegou B 1993 Identification, ontogeny, and regulation of an interleukin-6-like factor in the rat seminiferous tubule. Endocrinology 132:293–299[Abstract/Free Full Text]
40. Syed V, Stephan J-P, Gerard N, Legrand A, Parvinen M, Bardin CW, Jegou B 1995 Residual bodies activate Sertoli cell interleukin-1 (IL-1) release, which triggers IL-6 production by an autocrine mechanism, through the lipoxygenase pathway. Endocrinology 136:3070–3078[Abstract]

This article has been cited by other articles:

				H. Tian, Y. Lu, A. M. Sherwood, D. Hongqian, and S. Hong Resolvins E1 and D1 in Choroid-Retinal Endothelial Cells and Leukocytes: Biosynthesis and Mechanisms of Anti-inflammatory Actions Invest. Ophthalmol. Vis. Sci., August 1, 2009; 50(8): 3613 - 3620. [Abstract] [Full Text] [PDF]

				R Cruz, J D Quintana-Hau, J R Gonzalez, R Tornero-Montano, L M Baiza-Duran, and L Vega Effects of an ophthalmic formulation of meloxicam on COX-2 expression, PGE2 release, and cytokine expression in a model of acute ocular inflammation Br J Ophthalmol, January 1, 2008; 92(1): 120 - 125. [Abstract] [Full Text] [PDF]

				W. R. Winnall, U. Ali, M. K. O'Bryan, J. J. Hirst, P. A.F. Whiley, J. A. Muir, and M. P. Hedger Constitutive Expression of Prostaglandin-Endoperoxide Synthase 2 by Somatic and Spermatogenic Cells Is Responsible for Prostaglandin E2 Production in the Adult Rat Testis Biol Reprod, May 1, 2007; 76(5): 759 - 768. [Abstract] [Full Text] [PDF]

				M. F. Riera, M. N. Galardo, E. H. Pellizzari, S. B. Meroni, and S. B. Cigorraga Participation of phosphatidyl inositol 3-kinase/protein kinase B and ERK1/2 pathways in interleukin-1{beta} stimulation of lactate production in Sertoli cells Reproduction, April 1, 2007; 133(4): 763 - 773. [Abstract] [Full Text] [PDF]

				S. Han, J. D. Ritzenthaler, B. Wingerd, H. N. Rivera, and J. Roman Extracellular Matrix Fibronectin Increases Prostaglandin E2 Receptor Subtype EP4 in Lung Carcinoma Cells through Multiple Signaling Pathways: THE ROLE OF AP-2 J. Biol. Chem., March 16, 2007; 282(11): 7961 - 7972. [Abstract] [Full Text] [PDF]

				T. Ishikawa and P. L. Morris Interleukin-1{beta} Signals through a c-Jun N-Terminal Kinase-Dependent Inducible Nitric Oxide Synthase and Nitric Oxide Production Pathway in Sertoli Epithelial Cells Endocrinology, November 1, 2006; 147(11): 5424 - 5430. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ishikawa, T. Articles by Morris, P. L. Search for Related Content PubMed PubMed Citation Articles by Ishikawa, T. Articles by Morris, P. L. Pubmed/NCBI databases Compound via MeSH Substance via MeSH