help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1576
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/4/1706    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ishikawa, T.
Right arrow Articles by Morris, P. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ishikawa, T.
Right arrow Articles by Morris, P. L.
Endocrinology Vol. 147, No. 4 1706-1716
Copyright © 2006 by The Endocrine Society

A Multistep Kinase-Based Sertoli Cell Autocrine-Amplifying Loop Regulates Prostaglandins, Their Receptors, and Cytokines

Tomomoto Ishikawa and Patricia L. Morris

Center for Biomedical Research, Population Council (T.I., P.L.M.) and The Rockefeller University (P.L.M.), New York, New York 10021

Address all correspondence and requests for reprints to: Dr. Patricia L. Morris, Center for Biomedical Research, Population Council and The Rockefeller University, 1230 York Avenue, New York, New York 10021. E-mail: p-morris{at}popcbr.rockefeller.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In Sertoli epithelial cells, the IL-1ß induces prostaglandins (PG) PGE2, PGF2{alpha} and PGI2 (7-, 11-, and 2-fold, respectively), but not PGD2, production. Cyclohexamide pretreatment inhibiting protein synthesis prevents IL-1ß increases in PG levels, indicating that induction requires de novo protein synthesis. IL-1ß-regulated PGE2 and PGF2{alpha} production and cytokine expression require activation of cyclooxygenase-2 (COX-2) and c-Jun NH2-terminal kinase, as shown using specific enzyme inhibition. PGE2 and PGF2{alpha} stimulate expression of IL-1{alpha}, -1ß, and -6, findings consistent with PG involvement in IL signaling within the seminiferous tubule. PGE2 and PGF2{alpha} reverse COX-2-mediated inhibition of IL-1ß induction of cytokine expression and PG production. Sertoli PG receptor expression was determined; four known E-prostanoid receptor (EP) subtypes (1–4) and the F-prostanoid and prostacyclin prostanoid receptors were demonstrated using RNA and protein analyses. Pharmacological characterization of Sertoli PG receptors associated with cytokine regulation was ascertained by quantitative real-time RT-PCR analyses. IL-1ß regulates both EP2 mRNA and protein levels, data consistent with a regulatory feedback loop. Butaprost (EP2 agonist) and 11-deoxy PGE1 (EP2 and EP4 agonist) treatments show that EP2 receptor activation stimulates Sertoli cytokine expression. Consistent with EP2-cAMP signaling, protein kinase A inhibition blocks both IL-1ß- and PGE2-induced cytokines. Together, the data indicate an autocrine-amplifying loop involving IL-1ß-regulated Sertoli function mediated by COX-2-induced PGE2 and PGF2{alpha} production. PGE2 activates EP2 and/or EP4 receptor(s) and the protein kinase A-cAMP pathway; PGF2{alpha} activates F-prostanoid receptor-protein kinase C signaling. Further identification of the molecular mechanisms subserving these mediators may offer new insights into physiological events as well as proinflammatory-mediated pathogenesis in the testis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PROSTANOIDS ARE THE metabolic product of cyclooxygenase (COX)-mediated metabolism of arachidonic acid. In the male reproductive system, the precise role of distinct prostaglandins (PG, prostanoids) produced by the activity of the constitutive enzyme COX-1, and the inducible isoform COX-2 is poorly understood. Both COX isoforms are present during normal development of the fetal male reproductive tract, findings concordant with their physiological involvement in its function (1). Additionally, in both males and females, normal functioning of specific prostanoids and their receptors is a requirement for fertility and reproduction. These prostanoids interact with a family of eight G protein-coupled transmembrane receptors, which are abundantly expressed along the genitourinary tract and mediate their physiological actions (2). In particular, PGE2 and PGF2{alpha} are crucial regulators of female (3, 4, 5, 6) and male reproduction (7, 8, 9). PGE2 binds to G protein-coupled plasma membrane receptors. Four distinct PGE2 receptors [E-prostanoid receptor (EP1–4)], encoded by different genes, have been identified in human tissues. Binding of PGE2 to EP2 or EP4 activates adenylyl cyclase and the protein kinase A (PKA) signaling pathway via Gs activation. EP1 is a Gi-coupled receptor, and its activation leads to an increase in the intracellular free calcium levels and/or PKA inhibition (10). EP1 and EP3 further undergo alternative mRNA splicing, generating different isoforms (11). Such nuances of receptor signaling may be present in the rat testis as our studies in Leydig progenitors indicated (12). Binding of PGE2 to EP3 causes intracellular calcium mobilization, activation of PKA, protein kinase C (PKC), and MAPK, or inhibition of the PKA-signaling pathway (11). Thus, PGE2 can activate several signaling pathways, depending on the specific EP receptor subtype to which it binds. PGF2{alpha} activates the F-prostanoid (FP) receptor signaling by way of increased [Ca2+]I and phosphorylation of PKC (11, 13). The FP receptor exhibits multiple PKC phosphorylation sites. PGF2{alpha} can also bind to EP1 and EP3 receptors with significant affinity. Therefore, FP as well as EP1 and EP3 receptors are coupled with mobilization of intracellular calcium (14). C-terminal variants of prostanoid receptors modulate the signal transduction, phosphorylation, and desensitization of these receptors, as well as altering agonist-independent constitutive activity. Both the transmembrane sequences and amino acid residues in the putative extracellular-loop regions determine ligand-binding selectivity of these receptors. The selectivity of interaction between the receptors and G proteins appears to be mediated at least in part by the C-terminal tail region.

IL-1ß induces the production of PG by up-regulation of the inducible isoform of COX-2 in a broad array of cell types and tissues (15). Several previous studies showed that inflammatory levels of cytokines, including IL-1ß can inhibit steroidogenesis and sperm production although the direct mechanisms involved are less clearly delineated within the seminiferous tubule (16, 17, 18, 19, 20). In Leydig cell progenitors, we previously reported that FP and EP1 receptors mediate PGF2{alpha} and PGE2 regulation of IL-1ß expression, findings consistent with intratesticular PG effects on androgen production (12).

In Sertoli cells, our data showed that IL-1ß is a potent inducer of several IL (namely, IL-1{alpha}, IL-1ß, and IL-6) (21, 22). Furthermore, our recent studies demonstrated that the COX-2 pathway is involved in this cytokine regulation because the COX-2 selective inhibitor, NS-398, significantly impairs induction by IL-1ß (23).

The aims of the present study were 1) to determine whether a Sertoli cell regulatory loop exists between IL-1ß, activation of its receptor, and downstream signaling pathways on the regulation of PG production and, 2) to characterize the specific PG receptors involved in mediating the action of intratesticular prostanoids on cytokine expression in the seminiferous tubule.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Sertoli cell preparations
Sertoli cells were isolated and purified as previously reported (24) from the testes of 18-d-old Sprague Dawley [Crl: CD (Sprague Dawley) BR-CD] rats purchased from Charles River Laboratories, Inc. (Kingston, NY). Animals were housed in standard lighting (12 h light, 12 h dark) with food and water allowed ad libitum in facilities approved by the American Association for the Accreditation of Laboratory Animal Care. Procedures involving the use of animals strictly followed the Guidelines for Care and Use of Laboratory Animals set forth by the National Institutes of Health and protocols received Institutional Animal Care and Use Committee approval. Rat Sertoli cells were incubated at 34 C at a density of 1 x 107 cells per 100-mm polystyrene dish in phenol red-, serum-, and endotoxin-free DME/F-12 medium (Irvine Scientific, Santa Ana, CA) as described previously (25). This medium was supplemented with 2.5 µg/ml bovine insulin (Sigma, St. Louis, MO), 1.0 µg/ml transferrin (Calbiochem, La Jolla, CA), and 10 µg/ml bacitracin (Sigma). On d 3 ex vivo, Sertoli cells were rinsed twice with fresh serum- and phenol red-free culture medium and then treated with IL-1ß (10 ng/ml) in the absence or presence of COX-2-selective activity inhibitor, NS-398 (10 µM, COX-2-selective); the c-Jun NH2-terminal kinase (JNK) inhibitor, SP600125 (10 µM); the PKA inhibitor, H89 (10 µM); or the PKC inhibitor, Calphostin C (1 µM). Cells were also concomitantly treated with PGs (10 µM) or receptor subtype-selective agonists for prostanoid receptors. The doses of all drugs were selected on the basis of several similar studies that showed their maximal effects, specificity, and effectiveness (9, 12, 27, 28). At 0.5, 1, 3, 6, and 24 h after either vehicle (control), IL-1ß, and/or addition of the inhibitor(s) or PGs, whole cell lysates for protein and total RNA were isolated from each replicate. Duplicate or triplicate replicate Sertoli cell cultures were used for each drug treatment; each experiment was repeated at least three times. The mean SEM) of data obtained from all of the individual experiments was calculated for RNA, ELISA, and protein analyses.

Drugs
Recombinant IL-1ß was purchased from R&D Systems (Minneapolis, MN). NS-398 (N-[2-(cyclohexyloxy)-4-nitrophenyl]-methanesulfonamide) was purchased from Cayman Chemical (Ann Arbor, MI). SP600125 (N1-methyl-substituted pyrazolanthrone (N1-methyl-1,9-pyrazoloanthrone)), forskolin (8,13-epoxy-7ß-(N-metylpiperazino-{gamma}-butyryloxy)-1{alpha}, 6ß,9{alpha}-trihydroxy-labd-14-en-11-one), H-89 (N-[2-((p-bromocinnamyl)amino)etyl]-5-isoquinolinesulfonamide), and Calphostin C (UCN-1028c) were purchased from Calbiochem. Cycloheximide (CHX) was used as protein synthesis inhibitor and was purchased from Sigma. Recombinant IL-1ß was dissolved in 0.1% BSA in PBS as a 100-fold (10 µg/ml) stock solution. Matched aliquots of 0.1% BSA were used in control cultures at 1 µl/ml; the final BSA concentration was 0.0001%. COX, JNK, PKA, and PKC inhibitors were dissolved in dimethylsulfoxide (DMSO; Fisher Scientific, Swanee, GA), and subsequent dilutions, as needed, were performed in serum- and phenol red-free medium on the day of the experiment. The final DMSO concentration was 0.1%. Matched DMSO alone was used as the vehicle control as required. CHX and forskolin were dissolved in ethanol and H2O, respectively (5 µg/ml and 10 µM, respectively).

PGE2, PGF2{alpha}, Carbaprostacyclin (cPGI2 analog; 6,9{alpha}-methylene-11{alpha},15 S-dihydroxy-prosta-5E,13E-dien-1-oic acid), U-46619 (9,11-dideoxy-9{alpha},11{alpha}-methanoepoxy-prosta-5Z,13E-dien-1-oic acid), 11-deoxy PGE1 (9-oxo-15S-hydroxy-prost-13E-en-1-oic acid), 17-phenyl trinor PGE2 (9-oxo-11{alpha},15S-dihydroxy-17 -phenyl-18,19,20-trinor-prosta-5Z,13E-dien-1-oic acid), Butaprost (9-oxo-11{alpha},16R-dihydroxy-17-cyclobutyl-prost-13E-en-1-oic acid, methyl ester), Cloprostenol [9{alpha},11{alpha},15-trihydroxy-16-(3-chlorophenoxy)-17,18,19,20-tetranor-prosta-5Z,13E-dien-1-oic acid, sodium salt], and Sulprostone [N-(methylsulfonyl)-9-oxo-11{alpha},15R-dihydroxy-16-phenoxy-17,18,19,20-tetranor-prosta-5Z,13E-dien-1-amide] were purchased from Cayman Chemical. The bioactive PGD2 metabolite, 15-deoxy-{Delta}12,14-PGJ2 (15d-PGJ2; 11-oxo-prosta-5Z,9,12E,14Z-tetraen-1-oic acid) was purchased from Calbiochem.

PG and synthetic agonists were dissolved in stock solutions of DMSO, and subsequent dilutions were performed, as needed, in sterile phenol red- and serum-free medium on the day of the experiment.

Protein extraction and Western analysis
Whole cell homogenates were extracted for protein lysates for 15 min on ice in buffer [10 mM Tris-HCl (pH 7.8) containing 1% Nonidet P-40, 0.1% sodium dodecyl sulfate, 150 mM NaCl, 1 mM ethylene-diamine-tetra-acetic acid, 1 mM phenylmethylsulfonylfluoride, 2 mM dithiothreitol, 2 mM sodium orthovanadate, 2 µg/ml aprotinin, 2 µg/ml pepstatin, and 2 µg/ml leupeptin]. Cellular debris was pelleted by centrifugation at 12,000 x g for 15 min.

The proteins in the supernatant were then subjected, under reducing conditions, to SDS-PAGE using 4–20% Tris-glycine gels (Novex, San Diego, CA), and were electrophoretically transferred to a nitrocellulose membrane (Schleicher & Schuell, Keene, NH). The membranes were sequentially probed with antibodies, as described below. Polyclonal antibodies raised against phosphorylated (phospho-) proteins phospho-pan PKC (1:1000) and phospho-cAMP response element binding protein (CREB) (1:1000) were obtained from Cell Signaling Technology, Inc. (Beverly, MA). Antibodies specific for PG receptor subtypes EP2 and EP4 were purchased from Alpha Diagnostic International (San Antonio, TX); anti-EP1, EP3, FP, and prostaglandin D2 receptor (PGD2 receptor) polyclonal antibodies (1:1000) were obtained from Cayman Chemical. Monoclonal anti-ß-actin antibody (1:2000) was purchased from Sigma. Blots were developed with the enhanced chemiluminescence Western blotting system (Amersham, Arlington Heights, IL) and exposed to x-ray film (Kodak, Rochester, NY).

Total RNA extraction
Total RNA was extracted from Sertoli cells using the TRIzol reagent (Life Technologies, Inc., Grand Island, NY) according to the manufacturer’s instructions. RNA was measured using 260/280 UV spectrophotometry.

RT-PCR analysis
Total RNA (2 µg) was reverse transcribed for 15 min at 42 C. Reverse transcription (RT) was performed in a 20-µl mixture containing 5 mM MgCl2, 1x PCR buffer II, 4 mM each of deoxy-NTP, 1 U/µl ribonuclease inhibitor, and 2.5 mM random hexamers. Samples were then denatured (5 min, 99 C). A no-template control was performed for each experiment, establishing the absence of genomic contamination of the samples.

PCR was performed using 3 µl of each RT product as a template. The following primers were used for PCR amplification to detect PG receptor subtypes; the S16 ribosomal gene was simultaneously amplified and used for normalization (Table 1Go). AmpliTaq DNA polymerase (PE Applied Biosystems, Foster City, CA) was used at 25 mU/µl. The PCR mixture (25 µl) contained 2 mM MgCl2, 1x PCR buffer II, and each primer at 0.2 µM. Amplification was performed in a programmable thermal controller (model PTC-100; MJ Research, Inc., Watertown, MA). The samples were first denatured at 95 C for 2 min, followed by 35 PCR cycles; the temperature profile was 95 C (30 sec), annealing temperature (30 sec), and 72 C (90 sec). Annealing temperatures were as follows: EP1, EP3, and EP4, 61 C; EP2 and FP, 56 C; prostacyclin receptor (IP), 60 C; and DP1, 54 C. After the last cycle, an additional extension incubation was performed (7 min, 72 C).


View this table:
[in this window]
[in a new window]
 
TABLE 1. Sequences of primers used for PCR amplification of cDNA and product sizes

 
After amplification, PCR products (5 µl of each sample) were subjected to size separation by polyacrylamide gel (4–20% Tris/boric acid/EDTA gels; Novex). The bands were visualized by UV fluorescence after staining with ethidium bromide (1 µg/ml) for 15 min. Densitometric analysis was performed using the PC version of NIH Image software (Scion Image; Scion Corp., Frederick, MD) after photography with a computer-assisted camera (Kodak). PG receptor subtype mRNA levels were normalized with S16 values and were expressed as arbitrary units relative to control, set as a value of "1."

Quantitative real-time PCR (Q-PCR) analysis
Fluorescence-monitored Q-PCR assays using a standard curve method of analysis were conducted to quantitatively determine in each sample the levels of rat IL-1{alpha}, IL-1ß, IL-6, and EP2 mRNAs (6-carboxy-fluorescein-labeled probes) with 18S ribosomal RNA (VIC-labeled probe) used to normalize the data for specific mRNAs.

Reactions were set up in triplicate in optical 96-well reaction plates by adding 23 µl of a mix containing 1x qPCR MasterMix Plus (Eurogentec, Philadelphia, PA), 200 nM primers, 100 nM probe for the gene of interest, 50 nM primers, 200 nM probes for the 18S ribosomal RNA, and 2 µl of 6-fold diluted cDNA sample was subsequently added to each well. The detection of IL mRNAs was performed using proprietary TaqMan primers and probes (PE Applied Biosystems). EP2 primers were designed and prepared to order for this study: forward, GCCCTGGCTCCCGAAA and reverse, GAGCATCGTGGCCAGACTAAA, with CGCGTGTACCTATTTCGCTTTCACTATGACC as probe (Applied Biosystems). Q-PCR were performed using a PE Applied Biosystems model 7700 Sequence Detection System. The temperature profile for the reactions was 50 C (2 min), 95 C (10 min), and 40 cycles of 95 C (15 sec) and 60 C (1 min). Using the manufacturer’s software, a threshold above the noise was chosen, and the cycle number (CT) at which fluorescence, generated by the cleavage of the probe, exceeded the threshold was determined for each well. For each real-time PCR assay, a standard curve was generated by six 2-fold serial dilutions in water of the RT samples corresponding to the control. The mean CT value for each cDNA sample was expressed as an arbitrary value relative to the standard curve after linear regression analysis. Experimental samples were diluted 3-fold for comparison with the standard curve. A no-template control was performed for each reaction in duplicate. Data were normalized with 18S values and were expressed as arbitrary units relative to control, set as a value of 1.

ELISA
Sertoli cells were not treated (control) or treated with IL-1ß (10 ng/ml), IL-1ß (10 ng/ml) with NS-398 (10 µM), SP600125 (10 µM), or CHX (5 µg/ml) for 1, 3, and 6 h. Cell-free supernatants were transferred to sterile microcentrifuge tubes. Two 50-µl aliquots of conditioned medium were assayed using individual PGD2, PGE2, PGF2{alpha}, and cPGI2 ELISA kits according to the manufacturer’s instructions (Cayman Chemical). The sensitivity of the assay (80% bound) was 200, 36, 9, and 11 pg/ml for PGD2, PGE2, PGF2{alpha}, and cPGI2 (6-keto PGF1{alpha}), respectively, and the intra and interassay coefficients of variation were less than 10% for all EIA kits. The concentration of PGs was determined by competitive binding in replicates in an ELISA measured by a standard curve method using a microplate reader (model MRX; Dynex Technologies, Inc., Chantilly, VA). These measurements were made in duplicate; experiments were repeated using three separate Sertoli cell isolations and purifications before their subsequently independent primary cultures ex vivo.

Data analysis
Densitometry was performed using image-capture photography (Kodak) and analysis with NIH Image software, Scion Image (Scion Corp.). Densitometric analyses are expressed in arbitrary units.

All quantitative and semiquantitative PCR, Western, and ELISA results are the mean ± SEM derived from the total number of different experiments, each with three to four replicates. Statistical analyses were performed using t test or paired t test, ANOVA. Values of P ≤ 0.05 were considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-1ß induction of Sertoli cell PGE2 and PGF2{alpha} requires de novo protein synthesis
Because our recent studies show that IL-1ß triggers the phosphorylation of Sertoli cell JNK and inducible COX-2 expression, experiments were performed to determine whether COX-activity results in the induction of PG. PG responses to IL-1ß signaling were evaluated in the presence or absence of selective inhibition of the individual downstream signaling components, JNK and COX-2 (23). Sertoli cell PGE2, PGF2{alpha}, PGD2, and cPGI2 levels were determined at specified times after IL-1ß using specific ELISA and the conditioned culture media.

IL-1ß treatment led to a significant and rapid increase (1 h) in PGE2 and PGF2{alpha} secretion (Fig. 1AGo). By 6 h, a significant stimulation of PGE2 and PGF2{alpha} secretion (7- and 11-fold that of controls, respectively) was observed. Basal PGD2 concentration was not detectable, and no increase was observed after IL-1ß treatment; a 2.2-fold increase in cPGI2 secretion was observed (data not shown). In the presence of the specific COX-2 activity inhibitor NS-398, IL-1ß induction of PGE2 and PGF2{alpha} levels dramatically decrease at 3 h and show complete inhibition by 6 h (Fig. 1BGo, cross-hatched bars). In comparison, the JNK inhibitor SP600125 significantly decreases PGE2 and PGF2{alpha} induction at 3 h, but to a lesser degree than that observed with direct inhibition of COX-2 activity. Whereas the inability to activate JNK significantly decreases the total PG levels induced by IL-1ß at 6 h, the relative amount of this decrease is smaller than the earlier time point, suggesting that JNK pathway inhibition alone is not sufficient (Fig. 1BGo, stippled bars). Similarly, IL-1ß induction of Sertoli cell cPGI2 is also abolished at 3 and 6 h by the inhibition of COX-2 or JNK activity (data not shown).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
 
FIG. 1. IL-1ß significantly increases COX-2-dependent Sertoli cell PGE2 and PGF2{alpha}. A, Sertoli cells were cultured without (control) or with IL-1ß (10 ng/ml) for 1, 3, and 6 h. Specific ELISA were used to determine the PGE2 and PGF2{alpha} concentrations in the same conditioned serum-free media replicates. Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the value for matched Sertoli cells treated only with the vehicle blank (control, Ct). B, The COX-2 inhibitor NS-398 (cross-hatched), the JNK inhibitor SP600125 (stippled), or pretreatment with the protein synthesis inhibitor CHX (open) inhibit IL-1ß increases (closed bars) in extracellular PGE2 and PGF2{alpha} (3 and 6 h). Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the value for cells treated with IL-1ß only (closed bars).

 
To further identify the mechanisms for PGE2 and PGF2{alpha} induction by IL-1ß, Sertoli cultures were pretreated with the protein synthesis inhibitor, CHX (30 min). Pretreatment with CHX completely prevented the IL-1ß-stimulated increases in PGE2 and PGF2{alpha} levels (Fig. 1BGo, open bars), indicating that IL-1ß induction of PGE2 and PGF2{alpha} production requires de novo protein synthesis. Taken together, these data suggest that IL-1ß inducible COX-2 expression and, subsequently, its activity are required for stimulation of PGE2, PGF2{alpha}, and cPGI2 production but not PGD2 induction in Sertoli cells.

Sertoli cell expression of EP subtypes, and the FP and IP receptors
PGE2 and PGF2{alpha} are the predominant PG induced by IL-1ß in Sertoli cells. To better understand the signaling pathways affected by this cytokine, we next determined the PG receptor subtypes expressed in Sertoli cells and those required for potential PG-regulated autocrine effects. Control Sertoli cells express EP1, EP2, EP3, EP4, FP, and IP receptor mRNAs were each detected by RT-PCR analysis (data not shown). By RT-PCR analysis, DP1 receptor mRNA is not expressed in Sertoli cells (data not shown). To evaluate whether IL-1ß activated transcriptional mechanisms for the PG receptor subtypes present, we compared mRNA levels in nonstimulated control with that of IL-1ß-treated Sertoli cells. Using semiquantitative RT-PCR analyses, mRNA levels were evaluated at various times after treatment with IL-1ß. Changes were only observed in EP2 mRNAs. In contrast, in matched samples from four separate primary experiments, no changes in steady-state levels for the other EP subtypes, FP or IP receptors were observed (not shown). To quantitate this regulation, Q-PCR analysis was performed (n = 12). IL-1ß rapidly and significantly decreased the level of EP2 receptor mRNA within 1 h (50%, P ≤ 0.001). Although still significantly decreased relative to that of the controls, EP2 mRNA levels progressively began to increase within 3 (P ≤ 0.001) and 6 h (P ≤ 0.01) and were at normal levels by 24 h after IL-1ß treatment (Fig. 2AGo).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. IL-1ß treatment regulates Sertoli EP2 expression. A, The effects of IL-1ß treatment on steady-state levels of EP2 mRNA were evaluated by multiple Q-PCR analyses in the same replicate samples (n = 12) as indicated in Materials and Methods. Sertoli cells were cultured without (control, Ct, open bars) or with IL-1ß (10 ng/ml) for 1, 3, 6, and 24 h. Results are the mean ± SEM from four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct, which is set as 1. ***, A significant difference (P < 0.001) from the Ct value; **, a significant difference (P < 0.01) from the Ct. B, EP2 receptor protein levels were evaluated in Sertoli cells cultured for 0.5, 1, 3, 6, or 24 h with IL-1ß (10 ng/ml) or without (Ct). Whole cell lysates were prepared from four individual primary experiments. For each experimental set, proteins (50 µg/lane) were subjected to SDS-PAGE followed by sequential immunoblot analyses on a given membrane for all PG receptors and ß-actin. For illustration, a representative sequential Western analysis using a single membrane is shown for the EP2 receptor and ß-actin.

 
Studies from this laboratory showed that IL-1ß significantly decreases EP1 receptor protein and increases levels of FP, EP2, and EP4 receptor proteins in progenitor Leydig cells (12). Therefore, we next evaluated their protein expression in Sertoli cells after addition of this cytokine.

IL-1ß treatment significantly increases Sertoli cell EP2 receptors
Western analysis was performed for the PG receptors using whole cell lysates obtained from four separate preparations of Sertoli cells. Although EP1, EP3, EP4, and FP and IP receptor proteins are detected in freshly isolated and purified as well as cultured Sertoli cells, their respective basal protein expression levels were not changed with IL-1ß treatment (not shown). Significant increases in EP2 receptor protein were observed at 1–3 h after IL-1ß, findings suggesting early posttranscriptional regulation (Fig. 2BGo). Consistent with our ELISA data indicating that under these conditions Sertoli cells did not secrete PGD2, neither DP1 mRNA nor its protein was detected in Sertoli cells (data not shown).

To further identify the mechanisms for EP2 induction by IL-1ß, Sertoli cells were pretreated with the protein synthesis inhibitor, CHX (30 min). CHX prevented the IL-1ß-stimulated elevation in the levels of EP2 protein levels (data not shown). Taken together, our data indicates that IL-1ß-mediated increases in EP2 receptor protein is not directly due to increases in EP2 mRNA transcription, but does require de novo protein synthesis. Based on our recent studies, one protein synthesis requirement is likely inducible COX-2 (23).

Our previous studies showed that IL-1ß is a potent autocrine regulator of Sertoli cell cytokine expression in a dose- and time-dependent manner (21, 22, 23). These effects are dependent on de novo protein synthesis of IL-1ß-inducible COX-2 (23). To evaluate the individual contribution of those prostanoids induced by signaling events secondary to COX-2 activation, we next evaluated the effects of these PGs on Sertoli cytokine expression.

PGE2 and PGF2{alpha} induce expression of distinct cytokines without a requirement for COX-2 activation
The direct effects of PGE2 and PGF2{alpha} on cytokine expression were compared with that of carbaprostacyclin (cPGI2; a stable analog of PGI2), 15d-PGJ2 (a bioactive metabolite of PGD2), and U-46619 (a thromboxane A2-mimetic agonist) (Fig. 3Go; 10 µM each). Significant induction of IL-1ß mRNA is observed with either PGE2 or PGF2{alpha} (Fig. 3BGo). IL-6 mRNA levels significantly increase when cells are stimulated by PGE2 (Fig. 3CGo). In contrast, IL-1{alpha} mRNA levels are unaffected by any of the PG treatments (Fig. 3AGo). Interestingly, the antiinflammatory PG 15d-PGJ2 significantly reduces basal IL-1ß mRNA levels (Fig. 3BGo).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. PGE2 and PGF2{alpha} differentially induce IL-1ß or IL-6 mRNA levels. Sertoli cells were cultured for 3 h without (control, Ct, open bars) or with PGE2 and PGF2{alpha}, 15d-PGJ2, cPGI2, and U-46619 (10 µM each, closed bars). Using the same total RNA replicate samples, Q-PCR analyses using particular primers and probes for IL-1{alpha} (A), IL-1ß (B), or IL-6 (C) were performed. Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from the Ct value.

 
The stimulatory effects of PGE2 and PGF2{alpha} on IL-1ß mRNA levels are dose-dependent (Fig. 4Go). In comparison to the significant and rapid increases seen at low doses of PGE2, only the highest dose of PGF2{alpha} (10 µM, open bar) increased IL-1ß mRNA (Fig. 4Go).


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. PGE2 and PGF2a dose-dependently stimulate Sertoli IL-1ß mRNA levels. Sertoli cells cultures were exposed to the indicated concentrations of PGE2 (10 µM, closed bars) or PGF2{alpha} (10 µM, open bars) for 3 h, and the levels of IL-1ß mRNA were determined in each replicate sample of total RNA using Q-PCR analysis. Data are normalized with 18S values and are expressed as the mean fold increase in IL-1ß mRNA levels in PG-treated cells compared with untreated controls. Results are the mean ± SEM from three individual experiments. *, A significant difference (P < 0.05) from the control (Ct) value.

 
To determine whether IL-1ß-inducible COX-2 activity is required for the rapid effects on cytokine induction seen with PGE2 and PGF2{alpha}, we first determined whether the levels of COX-2 were induced by either PG. Neither COX-2 mRNA nor protein was induced over time after PGE2 or PGF2{alpha} (data not shown). To ascertain non-COX-2-mediated IL-1ß cytokine induction, Sertoli cells were treated for 3 h with IL-1ß or concomitantly with inhibitor to prevent IL-1ß-inducible COX-2 activity (Fig. 5Go, A–C). The COX-2 generated products, the prostanoids PGE2 and PGF2{alpha}, quantitatively restore induction of IL-1{alpha} and IL-1ß mRNAs in the absence of endogenous COX-2 activity (Fig. 5Go, A and B, compare with cross-hatched bars, asterisks). Interestingly, PGE2 significantly enhances IL-6 mRNA induction, whereas PGF2{alpha} elevates IL-1{alpha} mRNA levels beyond that of IL-1ß-treatment alone (Fig. 5Go, A and C, compare with IL-1ß only, daggers) or when COX-2 activity was inhibited (Fig. 5Go, A and C, compare with cross-hatched bar, asterisks). Consistent with our findings that the antiinflammatory 15d-PGJ2 lowers basal levels of IL-1ß expression (Fig. 3BGo), PGJ2 also significantly reduces non-COX-2-mediated IL-1ß auto-induction (Fig. 5BGo, compare with cross-hatched bar; asterisk).


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 5. Prostanoids PGE2 and PGF2{alpha} are potent activators of cytokine expression. The effects of PGs on steady-state levels of IL mRNAs in Sertoli cells treated with IL-1ß and NS-398 were evaluated by Q-PCR analysis. Sertoli cells were cultured for 3 h without (Ct, open bars) or with IL-1ß (10 ng/ml, closed bars) in the absence or presence (+Veh, cross-hatched) of NS-398 (10 µM). PGs (10 µM) were added concomitantly with IL-1ß (10 ng/ml) + NS-398 (10 µM). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1{alpha} (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to control (Ct) set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß and NS-398 (Veh) value. {dagger}, A significant difference (P ≤ 0.05) from the increases obtained with IL-1ß only.

 
Agonists for specific PG receptor subtypes enhance distinct cytokine mRNA levels
Experiments were performed to determine which of the EP receptor subtype(s) are involved in the PGE2 regulation of IL-1{alpha}, IL-1ß, and IL-6 mRNA levels (Fig. 6Go, A–C, respectively). Similarly, FP receptor involvement was ascertained for those effects observed with PGF2{alpha}. Sertoli cells were cultured for 3 h without (Ct, open bars) or with IL-1ß (10 ng/ml, closed bars). To determine non-COX-2-dependent effects of each receptor agonist, IL-1ß treatment was combined with NS-398 to inhibit COX-2 activity (10 µM, cross-hatched bars). Used at doses commensurate with their reported receptor-activating pharmacology, Cloprostenol (FP agonist; 0.1 µM), Butaprost (EP2 agonist; 10 µM), 17-phenyl trinor PGE2 (EP1/EP3 agonist; 10 µM), 11-deoxy PGE1 (EP2 /EP4 agonist; 10 µM), and Sulprostone (EP3/EP1 agonist; 10 µM) were added concomitantly with IL-1ß + NS-398 (Fig. 6Go, A–C, no agonist, cross-hatched; agonist-treated, closed bars).


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. Agonists for specific PG receptors enhance distinct cytokine mRNA levels. Sertoli cells were cultured for 3 h without (control, Ct, open bar) or with IL-1ß (10 ng/ml, closed bar) in the absence or presence (Veh, cross-hatched) of NS-398 (10 µM). Cloprostenol (FP agonist, 0.1 µM), Butaprost (EP2 agonist; 10 µM), 17-phenyl trinor PGE2 (EP1/EP3 agonist, 10 µM), 11-deoxy PGE1 (EP2/EP4 agonist, 10 µM), and Sulprostone (EP3/EP1 agonist, 10 µM) were added concomitantly with IL-1ß + NS-398. Total RNAs were extracted, and cDNAs were amplified by Q-PCR assays using particular primers and probes for IL-1{alpha} (A), IL-1ß (B), or IL-6 (C) in the same replicate samples. Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß + NS-398 (Veh, cross-hatched) value. {dagger}, A significant difference (P ≤ 0.05) from the increases obtained with IL-1ß only.

 
All EP and FP agonists significantly increase the expression of IL-1{alpha} above that of IL-1ß-treatment when COX-2 activity is inhibited (Fig. 6AGo). Interestingly, under these conditions, FP and EP2 agonists can increase IL-1{alpha} mRNA to levels above that seen with IL-1ß alone (Fig. 6AGo, daggers). Both the specific EP2 agonist (Butaprost) and the combined EP2 /EP4 agonist (11-deoxy PGE1) significantly increase the levels of IL-1{alpha}, IL-1ß, and IL-6 mRNAs (Fig. 6Go, A–C). Taken together, these data show that the PGE2 induction of all three cytokine mRNAs can occur through autocrine activation of Sertoli EP2 receptor signaling. Consistent with the effects of PGF2{alpha}, the FP agonist Cloprostenol increases IL-1{alpha} and IL-6 expression (Fig. 6Go, A and C). Perhaps reflecting its limited dose-responsiveness to stimulation by PGF2{alpha} (10 µM), under these same conditions and concentration, the FP agonist did not alter IL-1ß mRNA levels (Fig. 6BGo). The EP1/EP3 agonist 17-phenyl trinor PGE2 increases both IL-1ß and IL-1{alpha} mRNA but not that of IL-6 mRNA (Fig. 6BGo). Sulprostone, an EP3/EP1 agonist, increases only IL-1{alpha}. Together, these data indicate that IL-1{alpha} is regulated by EP1, EP2, EP3, and FP. IL-1{alpha} and IL-6 are more dose-responsive to FP activation than is IL-1ß. In contrast, IL-6 is not regulated by EP1 or EP3. Together, the data suggest that PGE2-EP2 signaling is primarily responsible for Sertoli cell cytokine induction.

Our recent studies demonstrate that IL-1ß significantly phosphorylates JNK and induces COX-2 expression (23). The current findings show that after COX-2 activation, Sertoli cell PG are increased. These PG and their receptors (or pharmacological agonists) are able to stimulate cytokine expression. Biological effects that result from the binding of PGE2 to EP2 receptors are known to involve downstream cAMP-PKA signaling pathways (29). In comparison, PKC-dependent phosphorylation is responsible for differential regulation of second messenger signaling by FP prostanoid receptors (30).

Therefore, we next determined whether PGE2-stimulated EP2 receptors and PGF2{alpha}-activated FP signaling in Sertoli cells activate the PKA and/or PKC pathways, thereby regulating cytokine expression.

IL-1ß, PGE2, and PGF2{alpha} differentially activate Sertoli cell PKA and PKC pathways
To determine whether PKA and/or PKC is activated after IL-1ß, PGE2, or PGF2{alpha} treatments, proteins were isolated from whole cell lysates prepared from Sertoli cells treated as indicated.

Phosphorylation of CREB protein (43 kDa) by IL-1ß was observed within 30 min (Fig. 7AGo) but did not phosphorylate PKC (data not shown). In comparison, PGE2 resulted in a rapid phosphorylation of PKC (30 min) and CREB (1 h) (Fig. 7BGo). In contrast, PGF2{alpha} treatment results in a significant increase in phosphorylated PKC by 1 h (Fig. 7CGo) but did not show any change in the phosphorylation status of CREB protein (data not shown).


Figure 7
View larger version (40K):
[in this window]
[in a new window]
 
FIG. 7. Differential IL-1ß, PGE2 and PGF2{alpha} PKA and PKC signaling. Sertoli cells were cultured in the presence or absence (control, Ct) of IL-1ß (10 ng/ml) or PGE2 (10 µM) for 0.5, 1, 3, and 6 h. A, Western analysis using whole cell extracts (30 µg/lane) show significant increases in phosphorylated CREB protein (43 kDa) within 0.5 h of the addition of IL-1ß; the same membrane was reprobed for ß-actin (42 kDa) to determine equal loading and for normalization of signals. B, Western analysis using whole cell extracts show increases in phosphorylated pan-PKC at 0.5 h and CREB protein (43 kDa) within 1 h of PGE2 addition; the same membrane was reprobed for ß-actin to assess equal loading in the lanes and for normalization of signals. C, Western analysis using whole cell extracts showed a phosphorylated PKC protein (80 kDa) within 1 h of the addition of PGF2{alpha} (10 µM); the same membrane was reprobed for ß-actin to assess equal loading in the lanes and for normalization of signals. A representative experiment of three replicates is shown in A, B, and C. Results are the mean ± SEM.

 
IL-1ß induction of cytokine expression involves cAMP-PKA signaling
We next examined the effects of forskolin (10 µM), at a dose known to highly stimulate Sertoli cell cAMP production, on IL-1{alpha}, IL-1ß, and IL-6 mRNA levels (Fig. 8Go). Forskolin significantly increased IL-1ß and IL-6 mRNA levels (Fig. 8Go, 3-h treatment, cross-hatched bars), although its effects on IL-1ß were less than that of IL-1ß treatment alone (Fig. 8BGo, closed bars). In contrast, 8-fold increases in IL-6 mRNA levels are observed with either IL-1ß or forskolin (Fig. 8CGo, closed vs. cross-hatched). Forskolin induction of IL-6 expression was blocked by the PKA inhibitor H89 (Fig. 8CGo, stippled, dagger), whereas IL-1ß mRNA induction was partially inhibited (Fig. 8BGo, stippled, dagger). Strikingly, for the Sertoli cell, forskolin does not increase IL-1{alpha} mRNA levels compared with the 10-fold increases after IL-1ß (Fig. 8AGo). Concomitant treatment (3-h) of Sertoli cells with IL-1ß and the PKA inhibitor H89 results in inhibition of IL-1ß induction of cytokine expression (Fig. 9Go, A and C). Interestingly, the PKC inhibitor Calphostin-C also inhibits IL-1ß-induced IL-1{alpha} and IL-1ß mRNA levels (Fig. 9BGo). The combination of PKA and PKC inhibitors (H89 + Calphostin-C) together with IL-1ß prevents auto-induction of its mRNA, findings consistent with dual activation of the PKC and PKA pathways in transcriptional regulation of IL-1ß expression (Fig. 9BGo).


Figure 8
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 8. Forskolin increases IL-1ß and IL-6 mRNA levels. The effects of IL-1ß or forskolin treatment on steady-state levels of IL mRNAs were evaluated by multiple Q-PCR analyses in the same replicate samples. Sertoli cells were cultured for 3 h without (control, Ct, open bars), with IL-1ß (10 ng/ml, closed bars), forskolin (10 µM, cross-hatched bars), or forskolin with the PKA inhibitor H89 (stippled bars). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1{alpha} (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct, which is set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of Ct value. {dagger}, A significant difference (P < 0.05) from similar values obtained in the presence of forskolin only.

 

Figure 9
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 9. Differential kinase inhibition reduces IL-1ß induction of Sertoli cytokine expression. The effects of inhibition of PKA or PKC-dependent pathways on IL-1ß-induced levels of IL mRNAs were evaluated when COX-2 activity (and subsequently dependent events) were concomitantly inhibited. Sertoli cells were cultured for 3 h without (control, Ct, open bars) or with IL-1ß (10 ng/ml) in the absence or presence of NS-398 (COX-2 inhibitor, 10 µM, cross-hatched bars), H89 (PKA inhibitor, 10 µM), or Calphostin-C (PKC inhibitor, 1 µM). Total RNAs were extracted, and cDNAs were amplified by real-time RT-PCR using particular primers and probes for IL-1{alpha} (A), IL-1ß (B), or IL-6 (C). Results are the mean ± SEM from three or four individual experiments. Data are normalized with 18S values and are expressed in arbitrary units relative to Ct set as 1. *, A significant difference (P < 0.05) from similar values obtained in the presence of IL-1ß only.

 
Taken together, our data indicate that, in Sertoli cells, physiologically relevant amounts of IL-1ß induce IL-1{alpha}, IL-1ß, and IL-6, and PGE2 and PGF2{alpha} expression. In large part, these effects are mediated through activation of the EP2 receptor-cAMP-PKA signaling cascade (see proposed model of autocrine-amplifier loop; Fig. 10Go).


Figure 10
View larger version (33K):
[in this window]
[in a new window]
 
FIG. 10. Proposed IL-1ß, PG, and PG receptor autocrine amplifying loop. A multistep Sertoli cell model that incorporates the components identified by these studies illustrates one working hypothesis for the proposed biological regulatory loop. Transcriptional (dotted lines) and posttranscriptional effects (boxed text) are indicated (23 ). Transient autocrine production of IL-1ß stimulates Sertoli JNK and the inducible COX-2 cascade (purple). Arachidonic acid (AA) from membranes is metabolized by COX-2 to PGH2, which is converted by synthases into PGE2 and/or PGF2{alpha}. Secreted PGE2 activates the Sertoli transmembrane EP2 receptor, intracellular PKA, and cAMP (red objects, yellow outlines) and, in addition, PKC phosphorylation. Secreted PGF2{alpha} activates the Sertoli transmembrane FP receptor and PKC signaling (yellow objects, green outlines). PKA signaling, and in part, PKC regulate the duration and composition of inducible cytokine and PG production, influencing Sertoli intracellular and Sertoli-germ cell extracellular microenvironments. Auto-amplification of cytokine and PG expression occurs by multiple regulatory steps including their biosynthesis and influx and efflux transporter activities (blue lines). Temporally patterned cross talk signaling pathways contribute to an integrated and biologically relevant circuit.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These data show that IL-1ß induces Sertoli cell PGE2 and PGF2{alpha} production. PG are autocrine lipid mediators that interact with specific members of a family of distinct G protein-coupled prostanoid receptors, designated EP, FP, IP, TP, and DP, respectively. To our knowledge, this study is the first to demonstrate that the rat Sertoli cells expresses EP1, EP2, EP3, EP4, IP, and FP mRNAs, and proteins, findings suggesting that the Sertoli cell represents a biological target for intratesticular prostanoid action. Consistent with such putative autocrine regulation, PGE2 activates the Sertoli cell transmembrane EP2 receptor, PKA, cAMP-signaling, and PKC; PGF2{alpha} activates the FP receptor and the phosphorylation of PKC. Moreover, both PGs can induce IL-1ß in a dose- and time-dependent but COX-2-independent manner (Fig. 10Go, proposed Sertoli cell autocrine-amplifying schema). Interestingly, we demonstrated a rapid and significant decrease in EP2 mRNA levels by 1 h. Albeit still decreased relative to controls, by 3–6 h, EP2 mRNA levels began to recover and at 24 h after IL-1ß were normal, findings suggestive of two phases of mRNA regulation. IL-1ß treatment significantly increased EP2 receptor protein at 3 h but does not affect the expression of other PG receptors, findings consistent with new EP2 mRNA transcription (1–3 h) and translation (≤3 h). IL-1ß increases in steady-state level of EP2 protein require de novo protein synthesis. Based on the findings of our previous study, this requirement likely includes the inducible and newly synthesized rate-limiting enzyme for PG synthesis, COX-2 (23). When the activity of COX-2 is blocked, the current data demonstrate that exogenous PGs, especially PGE2 and PGF2{alpha}, can fully restore IL-1ß induction of Sertoli cytokine mRNAs. Neither COX-2 mRNA nor protein is induced after PGE2 or PGF2{alpha}, findings consistent with their effects being direct and independent of COX activation. Exogenous PGE2 increases IL-1ß production in a dose-dependent manner. This effect is significant within the nanomolar range of endogenously produced PGE2 secreted in response to IL-1ß. Such effects are consistent with the functional operation of a biologically active regulatory mechanism.

Our data are consistent with differential pathway regulation mediated by particular transmembrane PG receptors. This study indicates that PGE2-EP2 signaling is primarily responsible for Sertoli cell cytokine induction. EP2 and EP4 are G protein-coupled receptors that activate adenylate cyclase, resulting in increased cAMP levels and the activation of cAMP-dependent protein kinases (29, 31). IL-1{alpha} is regulated by EP1, EP2, EP3, and FP. IL-1{alpha} and IL-6 are more dose-responsive to FP activation than is IL-1ß. EP2 and possibly EP4 agonists induce Sertoli cell IL-6 expression but not EP1 or EP3 indicating that intracellular calcium movement does not contribute to IL-6 regulation. In addition to EP2- and EP4-activated signaling, EP1 or EP3 agonists increase IL-1{alpha} and IL-1ß mRNA levels. Because EP1 and EP3 are coupled with the mobilization of intracellular calcium and the PKC pathway, and EP3 receptor signaling can inhibit PKA activation, multiple receptor-mediated pathways are involved in the integrated regulation of these cytokines (11, 14).

During Sertoli cell development and differentiated function, IL-1 and IL-6 are expressed under basal physiological conditions in response to the pituitary gonadotropic hormone FSH. FSH activates the PKA-cAMP signaling pathway and, consequently, CREB. PKA-dependent phosphorylation of CREB regulates the transcription of cAMP-responsive genes and thereby positively auto-regulates CREB expression itself. In Sertoli cells, activated CREB promotes transcription of genes essential for proper germ cell differentiation; FSH and androgens regulate CREB-mediated transferrin secretion, and CREB levels fluctuate in a stage-specific and germ cell-associated manner (32, 33). The round spermatid-secreted cytokine TNF-{alpha} has been shown to activate NF-{kappa}B-dependent CREB expression in Sertoli cells (33). In this study, we show that transient exposure to either IL-1ß or PGE2 activates Sertoli cell CREB through its phosphorylation, consistent with regulation of genes participating in spermatogenesis. It is well established that IL-1ß can increase intracellular cAMP levels in a variety of cell types and that inducers of cAMP such as forskolin or cAMP analogs can mimic some, but not all, of the effects of IL-1ß (34).

Forskolin, a potent activator of adenylyl cyclase and intracellular cAMP, significantly increased IL-1ß and IL-6 mRNA levels; IL-1{alpha} mRNA changes were modest and not statistically significant. This implies significant differences in PG signaling and the resulting transcriptional activation of distinct IL gene promoters. Our earlier studies (35) demonstrated that FSH effects mediated by cAMP induction and PKA activation could increase cytokine induction, findings consistent with the forskolin effects shown in this study. Forskolin induction of IL-1ß and IL-6 mRNA levels was blunted by PKA inhibition, findings reflecting the downstream effects of increased intracellular cAMP levels on expression of these two cytokines. In comparison, IL-1ß induction of IL-1{alpha}, IL-1ß, and IL-6 expression was decreased by PKA inhibition indicating important regulatory participation by non-PKA-dependent mechanisms.

FP receptor expression did not change at either mRNA or protein levels after IL-1ß. It is noteworthy that PGF2{alpha} also induced cytokine expression, but only at the 10-µM dose, an effect independent of adenylate cyclase and cAMP-dependent protein kinase activation. PGF2{alpha} may act on its G protein-coupled receptor (FP) or be imported intracellularly via a PG transporter, which has high affinity for PGF2{alpha} and PGE2, but not prostacyclin PGI2 (36). Differences in the capacity of PGE2 and PGF2{alpha} to induce cytokine production may reflect dissimilarity in the total numbers of the particular prostanoid receptors per Sertoli plasma membrane, PG uptake/efflux mechanisms, as well as the individual or multiple downstream signaling pathways activated. However, the data are consistent with the hypothesis that PGE2 is the IL-1ß-induced PG primarily responsible for the Sertoli PKA-cAMP signaling resulting in cytokine induction. Interestingly, PKC inhibition also prevented IL-1ß induction of IL-1{alpha} and IL-1ß expression but not that of IL-6, findings indicating that PKC activity does not regulate IL-6. PKA signaling and, in part, PKC mediate PG-inducible cytokine production in Sertoli cells. These findings demonstrate that in, addition to physiological regulation by gonadotropins, distinct intratesticular PG can alter the intracellular signaling pathways that regulate mediate distinct cytokines.

In the testis, IL-1ß-to-PG signaling is likely defined by functional cell type, developmental status, and prostanoid specificity. EP2 receptor activation alone is sufficient to mediate autocrine PGE2 induction of Sertoli cell cytokine mRNA. In Leydig progenitors isolated and purified from the testis of rats the same age, our previous studies showed that IL-1ß significantly increases both EP2 and EP4 receptors while decreasing EP1 receptor protein levels. The progenitor Leydig EP1 receptor mediates PGE2 regulation of its cytokine mRNAs (12). Together, these results suggest that within the male gonad, maturational and cell-specific differences in PG signaling lead to transcriptional activation of distinct IL gene promoters. Such differences have been described for nongonadal cell types. Additionally, the cell microenvironment reflecting both local autocrine and paracrine factors, gonadotropins, and steroid milieu may contribute. In the testis, spermatogenesis is supported by multiple factors from the major somatic cells as well as the germ cells themselves. Many studies, including those from this laboratory, suggest that a particular testis cell responds to an extracellular cue in the context of concentrations as well as the surrounding cell-to-cell associations; in time, the cell integrates these testicular factors with pulsatile pituitary hormonal influences. That other signals regulating PGE2 responsiveness need to be temporally correlated with its release to specify the selective production of cytokines has been shown for nontesticular cells (37). Similarly, the present study indicates that the antiinflammatory PG 15d-PGJ2 significantly reduces basal IL-1ß mRNA levels, data implying that certain PG can inhibit the expression of an individual cytokine.

Physiologically, Sertoli cytokines are also induced by residual bodies, which represent membrane-enclosed cytoplasmic contents shed by elongating spermatids during spermiogenesis. In defined stages of the rodent seminiferous cycle, the presence of residual bodies activates Sertoli cell phagocytosis and IL-1 release, events that initiate IL-6 secretion (38, 39, 40). This physiological stage-specific process induces Sertoli cell IL-1{alpha}, -1ß, and -6 production and also accompanies pathological testicular inflammation (21, 22, 26, 35, 38, 39, 40). Temporal signaling by pituitary gonadotropins and local germ cell or Leydig cell paracrine factors may well contribute to an integrated biologically relevant regulatory loop. Identification of the mechanisms responsible for IL-1ß-dependent COX-2 activation and PG regulation should provide new insights into physiological processes in the testis. Additionally, new therapeutic interventions may be identified to prevent pathogenesis secondary to inflammatory-based dysfunction after cryptorchidism, testicular torsion, atypical hormonal conditions, autoimmune events, or orchitis.


    Acknowledgments
 
We express our appreciation for the excellent technical assistance of Lyann Mitchell and KeumSil Hwang.


    Footnotes
 
This study was supported by National Institutes of Health Grants HD29428 and HD39024 (to P.L.M.).

First Published Online January 19, 2006

Abbreviations: CHX, Cycloheximide; COX, cyclooxygenase; cPGI2, carboprostacyclin; CREB, cAMP response element binding protein; DP, PGD2 receptor; 15d-PGJ2, 15-deoxy-{Delta}12,14-PGJ2; DMSO, dimethylsulfoxide; EP, E-prostanoid receptor; FP, F-prostanoid; IP, prostacyclin receptor; JNK, c-Jun NH2-terminal kinase; PG, prostaglandin (prostanoid); PGI2, prostacyclin prostaglandin I2; PKA, protein kinase A; PKC, protein kinase C; Q-PCR, quantitative real-time PCR; RT, reverse transcription.

Received December 12, 2005.

Accepted for publication January 9, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kirschenbaum A, Liotta DR, Yao S, Liu XH, Klausner AP, Unger P, Shapiro E, Leav I, Levine AC 2000 Immunohistochemical localization of cyclooxygenase-1 and cyclooxygenase-2 in the human fetal and adult male reproductive tracts. J Clin Endocrinol Metab 85:3436–3441[Abstract/Free Full Text]
  2. Breyer MD, Hebert RL, Breyer RM 2003 Prostanoid receptors and the urogenital tract. Curr Opin Investig Drugs 4:1343–1353[Medline]
  3. Challis JR 1997 Prostaglandins and reproduction—what do knockouts really tell us? Nat Med 3:1326–1327[CrossRef][Medline]
  4. Hizaki H, Segi E, Sugimoto Y, Hirose M, Saji T, Ushikubi F, Matsuoka T, Noda Y, Tanaka T, Yoshida N, Narumiya S, Ichikawa A 1999 Abortive expansion of the cumulus and impaired fertility in mice lacking the prostaglandin E receptor subtype EP2. Proc Natl Acad Sci USA 96:10501–10506[Abstract/Free Full Text]
  5. Sales KJ, Jabbour HN 2003 Cyclooxygenase enzymes and prostaglandins in reproductive tract physiology and pathology. Prostaglandins Other Lipid Mediat 71:97–117[CrossRef][Medline]
  6. Kennedy CR, Zhang Y, Brandon S, Guan Y, Coffee K, Funk CD, Magnuson MA, Oates JA, Breyer MD, Breyer RM 1999 Salt-sensitive hypertension and reduced fertility in mice lacking the prostaglandin EP2 receptor. Nat Med 5:217–220[CrossRef][Medline]
  7. Tripiciano A, Filippini A, Ballarini F, Palombi F 1998 Contractile response of peritubular myoid cells to prostaglandin F2{alpha}. Mol Cell Endocrinol 138:143–150[CrossRef][Medline]
  8. Lazarus M, Munday CJ, Eguchi N, Matsumoto S, Killian GJ, Kubata BK, Urade Y 2002 Immunohistochemical localization of microsomal PGE synthase-1 and cyclooxygenases in male mouse reproductive organs. Endocrinology 143:2410–2419[Abstract/Free Full Text]
  9. Walch L, Morris PL 2002 Cyclooxygenase 2 pathway mediates IL-1ß regulation of IL-1{alpha}, -1ß, and IL-6 mRNA levels in Leydig cell progenitors. Endocrinology 143:3276–3283[Abstract/Free Full Text]
  10. Breyer RM 2001 Prostaglandin EP1 receptor subtype selectivity takes shape. Mol Pharmacol 59:1357–1359[Free Full Text]
  11. Breyer RM, Bagdassarian CK, Myers SA, Breyer MD 2001 Prostanoid receptors: subtypes and signaling. Annu Rev Pharmacol Toxicol 41:661–690[CrossRef][Medline]
  12. Walch L, Clavarino E, Morris PL 2003 Prostaglandin (PG) FP and EP1 Receptors Mediate PGF2{alpha} and PGE2 regulation of interleukin-1ß expression in Leydig cell progenitors. Endocrinology 144:1284–1291[Abstract/Free Full Text]
  13. Abramovitz M, Boie Y, Nguyen T, Rushmore TH, Bayne MA, Metters KM, Slipetz DM, Grygorczyk R 1994 Cloning and expression of a cDNA for the human prostanoid FP receptor. J Biol Chem 269:2632–2636[Abstract/Free Full Text]
  14. Coleman RA, Smith WL, Narumiya S 1994 International Union of Pharmacology classification of prostanoid receptors: properties, distribution, and structure of the receptors and their subtypes. Pharmacol Rev 46:205–229[Medline]
  15. Smith WL, DeWitt DL, Garavito RM 2000 Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 69:145–182[CrossRef][Medline]
  16. Hales DB 1992 Interleukin-1 inhibits Leydig cell steroidogenesis primarily by decreasing 17{alpha}-hydroxylase/C17–20 lyase cytochrome P450 expression. Endocrinology 131:2165–2172[Abstract]
  17. Xiong Y, Hales DB 1997 Differential effects of tumor necrosis factor-{alpha} and interleukin-1 on 3ß-hydroxysteroid dehydrogenase/{delta}5->{delta}4 isomerase expression in mouse Leydig cells. Endocrine 7:295–301[Medline]
  18. Calkins JH, Sigel MM, Nankin HR, Lin T 1988 Interleukin-1 inhibits Leydig cell steroidogenesis in primary culture. Endocrinology 123:1605–1610[Abstract]
  19. Wang D, Nagpal ML, Shimasaki S, Ling N, Lin T 1995 Interleukin-1 induces insulin-like growth factor binding protein-3 gene expression and protein production by Leydig cells. Endocrinology 136:4049–4055[Abstract]
  20. Lin T, Wang D, Stocco DM 1998 Interleukin-1 inhibits Leydig cell steroidogenesis without affecting steroidogenic acute regulatory protein messenger ribonucleic acid or protein levels. J Endocrinol 156:461–467[Abstract]
  21. Okuda Y, Bardin CW, Hodgskin LR, Morris PL 1995 Interleukins-1{alpha} and -1ß regulate interleukin-6 expression in Leydig and Sertoli cells. Recent Prog Horm Res 50:367–372[Medline]
  22. Okuda Y, Sun X-R, Morris PL 1994 Interleukin-6 (IL-6) mRNAs expressed in Leydig and Sertoli cells are regulated by cytokines, gonadotropins and neuropeptides. Endocrine 2:617–624
  23. Ishikawa T, Hwang K, Lazzarino D, Morris PL 2005 Sertoli cell expression of steroidogenic acute regulatory protein-related lipid transfer 1 and 5 domain-containing proteins and sterol regulatory element binding protein-1 are interleukin-1ß regulated by activation of c-jun N-terminal kinase and cyclooxygenase-2 and cytokine induction. Endocrinology 146:5100–5111[Abstract/Free Full Text]
  24. Morris PL, Vale WW, Cappel S, Bardin CW 1988 Inhibin production by primary Sertoli cell-enriched cultures: regulation by follicle-stimulating hormone, androgens, and epidermal growth factor. Endocrinology 122:717–725[Abstract]
  25. Kanzaki M, Morris PL 1998 Identification and regulation of testicular interferon {gamma} (IFN-{gamma}) receptor subunits: IFN-{gamma} enhances interferon regulatory factor-1 (IRF-1) and interleukin-1ß converting enzyme (ICE) expression. Endocrinology 139:2636–2644[Abstract/Free Full Text]
  26. Cudicini C, Kercret H, Touzalin AM, Ballet F, Jegou B 1997 Vectorial production of interleukin 1 and interleukin 6 by rat Sertoli cells cultured in a dual culture compartment system. Endocrinology 138:2863–2870[Abstract/Free Full Text]
  27. Abramovitz M, Adam M, Boie Y, Carriere M, Denis D, Godbout C, Lamontagne S, Rochette C, Sawyer N, Tremblay NM, Belley M, Gallant M, Dufresne C, Gareau Y, Ruel R, Juteau H, Labelle M, Ouimet N, Metters KM 2000 The utilization of recombinant prostanoid receptors to determine the affinities and selectivities of prostaglandins and related analogs. Biochim Biophys Acta 1483:285–293[Medline]
  28. Kimura M, Osumi S, Ogihara M 2001 Prostaglandin E2 (EP1) receptor agonist-induced DNA synthesis and proliferation in primary cultures of adult rat hepatocytes: the involvement of TGF-{alpha}. Endocrinology 142:4428–4440[Abstract/Free Full Text]
  29. Narumiya S, FitzGerald GA 2001 Genetic and pharmacological analysis of prostanoid receptor function. J Clin Invest 108:25–30[CrossRef][Medline]
  30. Fujino H, Srinivasan D, Pierce KL, Regan JW 2000 Differential regulation of prostaglandin F2{alpha} receptor isoforms by protein kinase C. Mol Pharmacol 5