help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1297
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/4/1924    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pak, T. R.
Right arrow Articles by Handa, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pak, T. R.
Right arrow Articles by Handa, R. J.
Endocrinology Vol. 147, No. 4 1924-1931
Copyright © 2006 by The Endocrine Society

Ligand-Independent Effects of Estrogen Receptor ß on Mouse Gonadotropin-Releasing Hormone Promoter Activity

Toni R. Pak, Wilson C. J. Chung, James L. Roberts and Robert J. Handa

Department of Biomedical Science, College of Veterinary Medicine and Biomedical Sciences, Colorado State University, Fort Collins, Colorado 80523

Address all correspondence and requests for reprints to: Toni R. Pak, Department of Biomedical Sciences, College of Veterinary Medicine, Colorado State University, Fort Collins, Colorado 80523. E-mail: Toni.Pak{at}colostate.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH is the most upstream regulator of reproduction in vertebrates, and its synthesis and release are regulated by gonadal steroid hormones. The proposed sites of hormone action were historically thought to be upstream from GnRH neurons; however, the discovery of ERß in a subset of GnRH neurons suggests that this hypothesis should be reevaluated. To determine a functional role for ERß in GnRH neurons, we examined ERß’s regulation of GnRH promoter activity. The GnRH-producing cell line, GT1–7, was cotransfected with expression vectors containing one of three ERß splice variants and a luciferase-reporter construct containing the full-length mouse GnRH promoter sequence or one of two deletions upstream of the transcription start site (–225/–201; –184/–150). Transfected cells were treated with 100 nM 17ß-estradiol (E2), diarylpropionitrile, raloxifene, or vehicle. There was a robust increase in GnRH-luciferase activity by all ERß splice variants in the absence of hormone. Furthermore, E2 treatment abolished this response for ER-ß1 and ER-ß2, but not ER-ß1{delta}3. The –225/–201 and –184/–150 regions were critical for ERß-induced promoter activity because deletion of these regions eliminated the ligand-independent effects of ERß. ER-ß1 binds directly to these promoter regions and because there are no classical estrogen response elements in the mouse GnRH promoter, these data raise the possibility that this region contains a novel estrogen response element specific for ERß. Overall, our data suggest that ERß functions as a basic transcription factor in GnRH neurons and demonstrate a potential molecular mechanism for the negative feedback effects of E2 on GnRH.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GnRH IS THE PRIMARY central regulator of reproduction in vertebrates. GnRH is a highly conserved decapeptide whose synthesizing neurons constitute a sparsely scattered group of cells predominately located in the hypothalamus (1). Despite the relative paucity of GnRH neurons, it is well accepted that they are critical for reproductive competence.

GnRH synthesis and release are tightly regulated by gonadal steroid hormones, such as testosterone and estrogen, which maintain control through a negative feedback system (2). A major source of contention is whether these hormones act directly in the GnRH neuron or indirectly through intermediary neurons to regulate GnRH output. Previous studies have demonstrated that GnRH neurons generally lack steroid hormone receptors, such as progesterone receptor, androgen receptor, and estrogen receptor (ER)-{alpha} (3, 4, 5, 6), lending considerable support for the prevailing hypothesis that steroid hormones indirectly affect GnRH. However, the identification of ERß (7, 8, 9) and the subsequent demonstration of ERß expression in the immortalized GT1–7 cell line (10), as well as ERß-GnRH colocalization in vivo (10, 11, 12), has forced the reevaluation of this hypothesis.

ERs belong to the superfamily of nuclear receptors and are classified as class I ligand-activated transcription factors (13). To date, there are two identified subtypes (ER{alpha} and ERß) that are encoded by separate genes (8, 14) and differ in structure, function, and anatomical distribution (14, 15, 16, 17, 18, 19). Ligand-bound ERs can activate transcription by binding directly to estrogen response elements (EREs) located within the promoter region of a target gene; or alternatively, they can interact with other transcription factors, such as members of the Fos and Jun families, to activate transcription in the absence of direct DNA binding (20, 21). Although ERß is classified as a ligand-activated transcription factor, we have previously shown that ERß is a potent modulator of ERE- and activator protein-1 (AP-1)-mediated transcription independent of ligand binding (22). These data suggest that ERß might have a functional role in modulating gene expression that is independent of steroid hormones.

Four splice variants of ERß (also called ER-ß1) have been identified in rodents since its first detection in 1996 including: ER-ß1{delta}3, ER-ß1{delta}4, ER-ß2, and ER-ß2{delta}3 (23, 24, 25). Although a functional significance for these variant forms of ERß has yet to be elucidated, they are found in numerous tissues including the brain. Of particular interest to this study are the splice variants ER-ß1{delta}3 and ER-ß2. ER-ß1{delta}3 does not bind DNA due to a deletion of exon 3, which encodes for the second zinc finger of the DNA binding domain (26). Consequently, any modulation of the GnRH promoter by ER-ß1{delta}3 would likely be due to protein:protein interactions and not through direct ER binding of an ERE or AP-1 site. The splice variant ER-ß2 is also of interest for this study because preliminary data suggest that ER-ß2 is found in GT1–7 cells and can be colocalized with GnRH in the rat brain (27). ER-ß2 has an 18-amino acid insert in the ligand binding domain and binds 17ß-estradiol (E2) with a lower affinity than ER-ß1. Interestingly, the nonsubtype-specific selective ER modulator (SERM) raloxifene binds with a higher affinity for ER-ß2 than the other ERß splice variants (28). Although E2 is the presumed natural ligand for ER-ß1, other compounds exhibit either a high binding affinity or selectivity for ER-ß1 including plant-derived and synthetic estrogens (29).

To determine a functional role for ERß in GnRH neurons, we investigated whether ERß splice variants, apo-receptor or ligand-bound, modulate GnRH promoter activity. Our data demonstrate that ER-ß1 and its splice variants increase GnRH promoter activity in a ligand-independent fashion. Furthermore, E2 decreased GnRH promoter activity mediated by ER-ß1 and ER-ß2 but not ER-ß1{delta}3, whereas raloxifene decreased GnRH promoter mediated by all ERß spice variants. These data suggest a separate mechanism for the ligand-dependent regulation of GnRH. We have also identified specific regions of the GnRH promoter that bind ER-ß1 and are critical for the ligand-independent regulation of GnRH. Overall, our data suggest that ERß-mediated regulation of the GnRH promoter is governed by a nonclassical ER signaling pathway.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Transient transfections
Cell culture.
The mouse hypothalamic-derived cell line GT1–7 (generously provided by Dr. Pamela Mellon, University of California, San Diego, CA) was used for all transient transfections. GT1–7 cells were selected for this study because they are a unique neuronal cell line that endogenously produces GnRH peptide, which is released in a pulsatile fashion, thus closely mimicking the activity of native GnRH neurons (30). Cells were maintained in 50/50 F12/DMEM containing 4.5% glucose and L-glutamine (Invitrogen, Carlsbad, CA); supplemented with 1x nonessential amino acids, and 10% fetal bovine serum (Gemini Bioproducts, Woodland, CA). Cells were grown to 70% confluency and used before passage 10 for all transient transfection experiments.

Expression vectors.
Plasmid expression vectors for ERs included a pcDNA 3.0 vector (Invitrogen) containing an insert for rat ER-ß1 (generously provided by Dr. Tom Brown, Pfizer Corp., Cambridge, MA) and a pCGN-Oct-1 expression vector (generously provided by Dr. Winship Herr; Cold Spring Harbor Laboratory, Cold Spring Harbor, NY).

Reporter constructs.
The full-length mouse (–3446 to + 24) GnRH promoter was subcloned into the promoterless luciferase vector (pXP2) followed by the generation of constructs with deletions at one of two GnRH promoter regions: –225 to –201, –184 to –150. Previously, all GnRH reporter constructs were extensively characterized (31). The pJ3 reporter construct (generously provided by Dr. Rosalie Uht, University of Virginia), expressing ß-galactosidase under the control the sv40 promoter, was used as an internal control for calculating plasmid transfection efficiency.

Transfections.
Cells were plated at a density of 0.5 x 105 cells/well in 24-well plates for 48 h before transfection to achieve a final confluency of 70–80%. All constructs were transfected in triplicate wells within each assay and each transfection assay was repeated a minimum of six times. Each experiment was performed using a minimum of three different preparations for each plasmid. Transfections were carried out using a lipid-mediated transfection reagent (FuGene6, Roche Molecular Biomedical, Indianapolis, IN; according to manufacturer’s instructions). Cells were incubated with transfection media complex overnight followed by replacement with 50/50 F12/DMEM containing 10% dextran-charcoal stripped fetal bovine serum (Hyclone Laboratories, Logan, UT) to ensure steroid-free culture conditions. Twenty-four hours after transfection, cells were incubated with media containing hormone treatments for 15 h and then lysed for luciferase assay analysis. All treatments were performed in DMEM containing 10% dextran-charcoal stripped fetal bovine serum. In addition, each transfection experiment was performed a minimum of three times with phenol red-free media and no differences were observed from the transfections performed with media containing phenol red. Luciferase activity was measured using 20-µl cell lysate added to 100 µl luciferin substrate (Promega Corp., Madison, WI). ß-Galactosidase activity was measured using 40-µl cell lysate added to 200 µl galacton substrate (Tropix-GalactoLight kit, Applied Biosystems, Foster City, CA; according to the manufacturer’s instructions). Relative light units (RLUs) were measured using a 20/20 TD luminometer (Turner Designs, Sunnyvale, CA).

Hormone treatments.
The following compounds were diluted in 95% ethanol (ETOH) (vehicle control) and used at a final concentration of 100 nM in 0.001% ETOH: diarylpropionitrile (DPN; Tocris-Cookson, Ellisville, MO) E2, and raloxifene (Sigma-Aldrich Co., St. Louis, MO). Each compound was added to 50/50% F12/DMEM supplemented with 10% dextran charcoal-stripped fetal bovine serum (HyClone Laboratories, Logan, UT).

EMSAs
Receptor protein synthesis.
The full-length rat ER-ß1 and Oct-1 expression vectors were used to synthesize receptor proteins in vitro using the TnT-coupled rabbit reticulocyte lysate system (Promega Corp.) with T7-RNA polymerase, according to manufacturer’s directions.

Oligonucleotides.
Double-stranded oligonucleotides of two GnRH promoter regions were 32-P end-labeled with T4 polynucleotide kinase: 1) corresponding to the –225 to –201 region (5'-AAGTTTTAGCTAAGATTTTAATGAC-3') and 2) corresponding to the –184 to –150 region (5'-AACAGATAGACCAGCAGGTGTTGCAATTACATTCA-3'). Randomized sequences of these same regions were used as controls. The percent incorporation was determined and labeled probes with greater than 50% 32-P incorporation were used for EMSAs.

Gel electrophoresis.
Receptor protein lysates were incubated with 1x gel shift binding buffer [20% glycerol, 5 mM MgCl2, 2.5 mM EDTA, 2.5 mM dithiothreitol, 250 mM NaCl, 50 mM Tris-HCl, 0.25 mg/ml poly(deoxyinosine-deoxycytosine)·poly(deoxyinosine-deoxycytosine)] for 10 min. Specific binding reactions were also incubated with 500- to 1000-fold excess of unlabeled GnRH oligonucleotide from each region. Nonspecific binding was tested using randomized sequences of the specific GnRH promoter regions. After an initial 10-min incubation, the appropriate 32-P-oligo was added and incubated for an additional 20 min. DNA-protein complexes were resolved on a 6% Novex DNA retardation gel (Invitrogen) for 20 min at 250 V. Gels were dried on a vacuum gel dryer at 80 C for 1 h before autoradiography.

Autoradiography.
Dried gels were exposed to x-ray film (Biomax MS; Eastman Kodak Co., New Haven, CT) for 12 h at –70 C. Film images were captured using a charge-coupled device camera (Sony XC-77) that was connected to a QuickCapture framegrabber board (Data Translation Inc., Marlboro, MA) on a personal computer. The captured images were analyzed with Scion Image software (W. Rasband, National Institutes of Health, Bethesda, MD).

Statistics
Differences among groups were analyzed by two-way ANOVA followed by Tukey’s post hoc analysis. Differences were considered significant when P < 0.05. All transfection data are represented as percent change compared with vehicle-treated, empty vector controls.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ER-ß1 effects on GnRH promoter (full length) activity
To determine whether ER-ß1 has a direct effect on GnRH promoter activity, GT1–7 cells were cotransfected with varying concentrations of an ER-ß1 expression vector (0.1, 0.5, 1.0, and 2.0 µg/well) and the full-length GnRH promoter-luciferase reporter construct. Overexpression of ER-ß1 significantly increased GnRH promoter activity at plasmid concentrations of 1.0 and 2.0 µg/well (Fig. 1Go). Notably, these transfections were all performed in a steroid hormone-free environment demonstrating a robust, ligand-independent action of ER-ß1 on the GnRH promoter. Higher concentrations of ER-ß1, up to 5 µg/well, did not significantly increase GnRH promoter activity further (data not shown).


Figure 1
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 1. Ligand-independent effects of varying concentrations of ER-ß1 expression vectors on mouse GnRH-luciferase promoter activity. Cotransfection of GT1–7 cells with a mouse full-length GnRH-luciferase reporter construct and an expression vector containing varying concentrations of ER-ß1. Data are represented as percent change in RLUs from vehicle-treated empty vector control ± SEM. *, Significant difference from empty vector controls (P < 0.05).

 
We also tested whether the cognate ER ligand E2, or the ERß-selective ligand DPN, altered the ligand-independent-induced increase in ERß-mediated GnRH promoter activity. GT1–7 cells were cotransfected with 1.0 µg of an ER-ß1 expression vector and then treated for 15 h with vehicle (0.001% ETOH), 100 nM E2, or 100 nM DPN. This dose was chosen to ensure complete saturation of all estrogen receptors in the cell. As shown in Fig. 2Go, both E2 and DPN treatment effectively blocked the ER-ß1-induced stimulation of GnRH promoter activity.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
FIG. 2. Effects of E2 and DPN on ER-ß1-mediated GnRH promoter activity. Cotransfection of GT1–7 cells with 1.0 µg of a mouse full-length GnRH-luciferase reporter construct and 1.0 µg of an empty expression vector or one containing full-length rat ER-ß1. After transfection, cells were treated with 0.001% ETOH (vehicle), 100 nM E2 or 100 nM DPN for 15 h. Data are represented as percent change in RLUs from vehicle-treated empty vector control ± SEM. *, Significant difference from empty vector controls (P < 0.05).

 
Putative binding sites for ER-ß1 on the GnRH promoter
EMSAs were used to determine whether ER-ß1 binds directly to the GnRH promoter to exert its ligand-independent effects. The mouse GnRH promoter does not contain a classical ERE [Dragon ERE Finder (32)]; therefore, we investigated candidate sites that have previously been shown to interact with other nuclear steroid receptors, such as glucocorticoid receptor (GR). Oligonucleotides were generated to the regions –225 to –201 and –184 to –150 upstream from the GnRH promoter transcriptional start site (Fig. 3Go). Lysate containing translated ER-ß1 protein was incubated with a 32P-labeled oligonucleotide of the GnRH promoter regions and resolved on a 6% DNA retardation gel. After autoradiography, we observed a strong shift for ER-ß1 with both oligonucleotides, demonstrating that ER-ß1 binds to both selected regions of the GnRH promoter (Fig. 4Go). Unlabeled GnRH-promoter fragment oligonucleotides (1000-fold excess) effectively competed for ER-ß1 binding, and there was no shift observed when ER-ß1 receptor proteins were incubated with a 32P-labeled scrambled sequence of the same region (data not shown). These results demonstrate the specificity for ER-ß1 binding to the regions –225 to –201 and –184 to –150 of the mouse GnRH-promoter.


Figure 3
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3. GnRH promoter deletion constructs. DNA sequence of the mouse GnRH promoter from base –235 through +100. The boxed areas represent deleted regions –225 to –201 and –184 to –150, respectively. The TATA box is also shown along with an arrow indicating the transcription start site. The heavy black bar depicts an Oct-1 binding site.

 

Figure 4
View larger version (118K):
[in this window]
[in a new window]
 
FIG. 4. EMSA of ER-ß1 and Oct-1 binding for two regions of the mouse GnRH promoter. A total of 0.2 pM of GnRH oligonucleotide corresponding to the –225 to –201 region (5'AAGTTTTAGCTAAGATTTTAATGAC 3') or to the –184 to –150 region (5'AACAGATAGACCAGCAGGTGTTGCAATTACATTCA 3') was 32-P end-labeled and incubated with 2 µl pcDNA (empty vector control, lane 1), ER-ß1 (lanes 2 and 4), Oct-1 (lane 3), or ER-ß1 + Oct-1 (lane 4) receptor protein lysates. After 32-P-ERE incubation, reaction product was resolved on a 6% DNA retardation gel for 20 min at 250 V. Gels were dried and exposed to autoradiographic film for 12 h. Unlabeled GnRH oligonucleotide was added to determine binding specificity at 1000-fold excess of 32P-ERE. 32P-labeled scrambled GnRH oligonucleotide sequences were used as a negative control (not shown).

 
We also examined the possibility that ER-ß1 interacts with the POU homeodomain protein Oct-1 at these same regions. In vitro-translated recombinant Oct-1 protein was coincubated with ER-ß1 protein and a 32P-labeled GnRH-promoter oligonucleotide from previously selected regions. A strong shift was observed in samples containing only Oct-1 protein at the –225 to –201 oligonucleotide but was absent at the –184 to –150 oligonucleotide, indicating that Oct-1 does not bind the GnRH promoter at the most proximal region examined (Fig. 4Go). Importantly, a supershift was observed in samples containing both ER-ß1 and Oct-1 proteins in the GnRH promoter oligonucleotide region –225 to –201 but not –184 to –150 (Fig. 4Go), showing that ERß interacted with Oct-1 at the most distally selected region of the GnRH promoter.

ER-ß1 effects on GnRH promoter (containing regional deletions) activity
Electromobility shifts indicated that ER-ß1 binds to specific regions of the GnRH promoter. Therefore, this experiment was designed to investigate whether these regions were critical for the observed ER-ß1-induced increase in GnRH promoter activity. Two reporter constructs were designed containing deletions of the regions: –225 to –201 and –184 to –150 (Fig. 3Go). GT1–7 cells were cotransfected with 1.0 µg/well of ER-ß1 and one of the two GnRH promoter-deletion constructs. Our results showed that a deletion of either the –225 to –201 or –184 to –150 of the GnRH promoter abolished the ERß-induced constitutive increase in promoter activity (Fig. 5Go). Treatment with 100 nM E2 significantly reduced GnRH promoter activity in cells transfected with either empty vector or ER-ß1 (Fig. 5Go).


Figure 5
View larger version (14K):
[in this window]
[in a new window]
 
FIG. 5. Effects of ER-ß1 on GnRH promoter (containing regional deletions) activity. Cotransfection of GT1–7 cells with a mouse GnRH-luciferase reporter construct containing a deletion for the region –225 to –201 (A) or –184 to –150 (B) and an expression vector containing 1.0 µg/well ER-ß1. After transfection, cells were treated with 0.001% ETOH (vehicle) or 100 nM E2 for15 h. Data are represented as percent change in RLUs from vehicle-treated empty vector control ± SEM. *, Significant difference from empty vector controls (P < 0.05).

 
Effects of ERß splice variants and ERß-specific ligands on GnRH promoter activity
Preliminary studies have shown that other splice variants of ER-ß1 might be present in GnRH neurons. Here, we investigated whether the ER-ß1 splice variants ER-ß1{delta}3 or ER-ß2 modulate GnRH promoter activity. We cotransfected GT1–7 cells with expression vectors containing either ER-ß1{delta}3 or ER-ß2 and the full-length GnRH promoter-luciferase reporter construct. Similar to ER-ß1, both splice variants significantly increased GnRH promoter activity in a ligand-independent manner (Fig. 6AGo).


Figure 6
View larger version (22K):
[in this window]
[in a new window]
 
FIG. 6. Effects of ER-ß1, ER-ß1{delta}3 and ER-ß2 splice variants and ER ligands on full-length mouse GnRH promoter activity. Cotransfection of GT1–7 cells with a mouse full-length GnRH-luciferase reporter construct and an expression vector containing ER-ß1, ER-ß1{delta}3, or ER-ß2. After transfection, cells were treated with 0.001% ETOH (vehicle), 100 nM E2 (A), or 100 nM raloxifene (B) for 15 h. Data are represented as percent change in RLUs from vehicle-treated empty vector control ± SEM. *, Significant difference from empty vector controls (P < 0.05).

 
Using this same transient transfection paradigm, the cells were treated for 15 h with 100 nM E2 or 100 nM raloxifene after transfection. This dose was chosen to ensure complete saturation of all estrogen receptors in the cell. Figure 6AGo demonstrates that treatment with E2 abolished the ER-ß1 and ER-ß2-induced increase in GnRH promoter activity. This same effect of E2 was observed with concentrations as low as 1.0 nM (data not shown). Interestingly, E2 had no effect on ER-ß1{delta}3 regulated transcription. Of interest, the nonsubtype-specific SERM raloxifene significantly inhibited the ligand-independent increase in GnRH promoter activity by all three ERß variants (Fig. 6BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These studies demonstrate that ER-ß1, and its splice variants, directly modulate GnRH promoter activity, thereby providing a mechanism for ERß to regulate GnRH synthesis. We show a clear ligand-independent increase of GnRH promoter activity that is mediated by ERß and abolished by ER-specific ligands. Defining the precise role of ERß in GnRH neurons has been the focus of intensive investigation since the first reported demonstration of ERß mRNA colocalization with GnRH in 1999 (11). For many years, the prevailing view was that gonadal steroid hormones regulated GnRH through an indirect pathway. Support for this hypothesis stemmed from the observation that gonadal steroid hormone receptors were absent in GnRH neurons (3, 4, 5, 6). The discovery of a second ER (called ERß) provided the impetus to further explore a direct role for gonadal steroid hormones in GnRH neurons. Coexpression of GnRH in neurons with ERß protein and/or mRNA has now been described in a variety of species including; the rat [approximately 50–85% protein (33, 34) and mRNA (12)]; mouse [mRNA (11, 35)] and sheep [protein, 50% (36)]. Notably, in the mouse, ERß protein in GnRH neurons has not been shown using standard immunocytochemical techniques. It is possible that this represents an important species difference or that the current available antibodies for ERß are not optimal for detecting ERß in mouse.

The study herein demonstrates that overexpression of ER-ß1 significantly increased GnRH promoter activity even at low concentrations in a steroid-free media. These data are consistent with our previous report demonstrating that ER-ß1 exerts potent ligand-independent effects mediated by an ERE and an AP-1 site when coupled to a minimal promoter (22). That study showed that in the absence of ligand ER-ß1 significantly increased ERE-mediated, yet significantly inhibited AP-1-mediated, promoter activity. Thus, our current findings that ER-ß1 increased GnRH promoter activity are consistent with the hypothesis that ER-ß1 exerts this effect through an ERE. Paradoxically, a classical ERE has not been described on the mouse GnRH promoter raising the possibility that ER-ß1 can bind and activate transcription at novel DNA sequences. Indeed, our data also reveal two regions of the mouse GnRH promoter that bind ER-ß1 and do not bear similarity to any previously described EREs.

Early studies designed to map the regulatory elements on the GnRH promoter identified putative EREs on both the human and rat GnRH promoter (37, 38). The human GnRH promoter contains an ER binding site at –551 to –514 upstream from the transcriptional start site (37), whereas the rat GnRH promoter only contains ERE half-sites (38). However, these previous studies were performed before the discovery of ERß and thus used recombinant ER{alpha} or tissue homogenates that may have contained ERß. To date, there have not been any studies describing a direct DNA binding site for ERß on the GnRH promoter for any species. In this study, we chose to focus on two regions of the mouse GnRH promoter that interact with GRs and are required for glucocorticoid-induced repression of promoter activity (31). We show that ERß binds to these two novel binding sites that are located at base pairs within –225 to –201 and –184 to –150 upstream from the transcription start site. Because these sequences are not similar to any consensus steroid response element, these data raise the possibility that ERß is more flexible in its ability to bind novel DNA sequences than ER{alpha}. Moreover, we have demonstrated that these regions of the GnRH promoter are critical for mediating ER-ß1-induced transcriptional activation because deletion of these sites abolished the ligand-independent increase in GnRH promoter activity.

The regions we have identified as binding to ER-ß1 have also been shown to interact with, although not directly bind, the GR. Chandran et al. (31) proposed a model for GR regulation of the GnRH promoter that suggested Oct-1 served as an intermediary to tether GR to the GnRH promoter. In agreement with their study, our results suggest that Oct-1 and ERß interact at the –225 to –201, but not the –184 to –150, region. By contrast, however, we show that both Oct-1 and ER-ß1 bind independently to the DNA suggesting that they might bind in different places within the region. Indeed, the Oct-1 consensus binding site consists of only 8 bp (ATGCAAAT) within this larger 25-bp region. Previous studies have determined that the mouse GnRH promoter region –237 to –201 contains a 6/8 match for the Oct-1 consensus binding site on the coding strand of the DNA (31). Analysis of the remaining part of the –225 to –201, along with the –184 to –150 regions, show no significant similarity to each other suggesting that ER-ß1 is binding to separate sequences that are unique to each region.

In the rat GnRH promoter, there are at least three identified Oct binding sites that are associated with GnRH-specific enhancer elements (39, 40, 41). Interestingly, when these sites were mutated, transcriptional activity was reduced (40), which suggested that Oct-1 was critical for maintaining basal promoter activity. Moreover, Rave-Harel et al. (42) recently demonstrated the requirement for Oct-1 to interact with TALE homeodomain proteins, such as Pbx1 and Prep1, to regulate GnRH. Our data demonstrate that, in the mouse GnRH promoter, Oct-1 might interact with ER-ß1 at the –225 to –201 region, although a precise functional relationship for these two proteins remains to be elucidated.

The ERß splice variants have received little attention since their discovery, partly due to the difficulty in defining a separate physiological function for each variant. Our laboratory has preliminary data suggesting that the splice variant ER-ß2 is present in GnRH neurons (27). In addition, brain regions that express ER-ß1 have also been shown to express all of the other ERß splice variants (25); thus, it is logical to predict that the other splice variants might also be present in GnRH neurons. Notably, in our study ER-ß1{delta}3 increased GnRH promoter activity independent of ligand, yet E2 treatment did not have any effect. By contrast, the splice variant ER-ß2 was not functionally different from ER-ß1 in regulating GnRH promoter activity.

There is a growing body of evidence demonstrating that E2 has a direct action in GnRH neurons that is mediated by ERß. Our data suggest that E2 directly regulates GnRH by suppressing the constitutive actions of ERß on GnRH promoter activity. These data offer a mechanistic model for the negative feedback actions of E2 on GnRH. However, there is contradictory evidence in the literature about E2 effects on GnRH gene expression in vivo; with studies showing either a decrease (43, 44, 45), no effect (46), or increase (47) in GnRH mRNA after E2 treatment. These discrepancies have largely been reconciled with studies showing that GnRH gene expression is differentially modulated by E2 in a time and brain region-specific manner (see Ref.48 for review). Furthermore, these data do not preclude E2 from modulating GnRH in other ways, such as mRNA stabilization, translational modifications, or secretion. Indeed, Temple et al. (49) showed that E2 directly increased intracellular calcium oscillations in GnRH neurons. These effects were determined to be genomic actions mediated by ERß, suggesting that estradiol might regulate GnRH secretion through the mobilization of intracellular calcium. Estrogen has also been shown to alter the excitability of GnRH neurons through the modulation of voltage-gated ion channels (50). Moreover, whole cell recordings taken from the GnRH neurons of ovariectomized female mice demonstrated that estrogen increases the firing rate of these neurons (50), and because GnRH neurons lack ER{alpha}, it raises the possibility that some of the direct electrophysiological effects of E2 are mediated through ERß. Finally, it has been shown that estradiol directly reduces GnRH mRNA levels in GT1–7 cells (51).

In the present study, the nonsubtype-specific SERM raloxifene significantly reduced ERß-induced GnRH promoter activity for all spice variants tested. Recently, Zhao et al. (28) showed that raloxifene had a greater binding affinity for ER-ß2 than ER-ß1. Furthermore, in transient transfection experiments, raloxifene significantly decreased ERE-thymidine kinase-luciferase reporter activity through ER-ß2 at lower concentrations than through ER-ß1 (28). In our study, raloxifene also inhibited GnRH promoter activity mediated by ER-ß1{delta}3; a splice variant that was not tested by Zhao et al. The ligand binding domains of ER-ß1 and ER-ß1{delta}3 are identical; however, previous studies have shown that binding of an agonist vs. an antagonist alters the intranuclear distribution of ER-ß1{delta}3 (26). Ligand binding induces a conformational change that facilitates receptor dimerization, interaction with DNA binding domains, and initiates the recruitment of coactivator and/or corepressor proteins that modulate transcriptional activity (see Ref.52 for review). Moreover, crystal structure characterization of ERs has shown that there are slight differences in how the protein conforms when bound to different ER ligands (53). Together, these data raise the possibility that raloxifene binding to ER-ß1{delta}3 induces a conformational change resulting in the recruitment of different coactivators and/or corepressors than when E2 binds to ER-ß1{delta}3.

Investigations into the nongenomic actions of estrogen in GnRH neurons have been at the forefront of the literature in recent years. Of particular interest, Abraham et al. (54) showed that E2 elicited a robust increase in the phosphorylation of cAMP response element binding protein. This effect was rapid, within 15 min of E2 treatment, and dependent on ERß because phosphorylation of cAMP response element binding protein was completely eliminated in the ERß-null mouse model. Furthermore, Navarro et al. (55) showed a rapid reduction in cAMP production in GT1–7 cells after treatment with low levels of E2. In general, the amount of time required for the initiation of transcription and subsequent protein translation exceeds these short time frames. One possibility is that these nongenomic actions are mediated via ERs localized to the plasma membrane and not by ERs located in the nucleus (56, 57). GT1–7 cells express ER{alpha} and ERß in the plasma membrane (55); therefore, we cannot exclude the possibility that the effects ER-ß1, ER-ß2, or ER-ß1{delta}3 on the GnRH promoter were solely due to genomic actions.

Historically, factors that directly regulate GnRH neurons have been difficult to study by conventional molecular techniques due to the sparse and widespread pattern of distribution of GnRH neurons. Several model systems have been developed to better understand the factors controlling GnRH function including the establishment of a transgenic mouse model expressing green fluorescent protein under the control of the GnRH promoter (58) and the GnRH-expressing tumorgenic cell line, GT1–7 (30). Gene knockout mouse models have also been designed to study the specific contributions of ER{alpha} and ERß in mediating E2 action (59, 60). Despite the limitation involved with using these model systems, they have proved invaluable in their contribution to our understanding of the GnRH system. Most importantly for this study, GT1–7 cells are the best model system available for deciphering direct effects of steroid hormones on GnRH promoter activity. These cells have a neuronal phenotype, synthesize GnRH, and release GnRH in a pulsatile fashion. Unfortunately, they also express gonadal steroid receptors that are not found in GnRH neurons in situ, including ER{alpha} and androgen receptor (55, 61). Thus, it is possible that the overexpressed ERß in our study might have interacted with these endogenously expressed receptors.

Another important consideration is the physiological relevance of ERß in regulating reproductive function in the context of the ERß-null mouse model. This mouse model displays a relatively normal reproductive phenotype that calls into question the necessity of ERß as an important mediator of estrogen action (60). However, we must consider that in the mouse ERß transcripts are only present in a small subset of GnRH neurons [~20% (11)]; yet in other species, such as the rat, ERß is expressed in more than 80% of GnRH neurons (33, 34). These data highlight the importance of species differences and suggest that the ERß-null mouse might be able to compensate more easily for the loss of ERß expression. Indeed, despite their ability to breed these mice are not reproductively normal. For instance, they are subfertile, have smaller litter sizes, and produce fewer litters than their wild-type counterparts (60). Furthermore, Dorling et al. (62) reported that the ERß-null mouse has elevated basal LH levels and that LH is not suppressed in response to acute E2 treatment. These data suggest a potential defect in the negative feedback mechanisms regulating GnRH. Temple et al. (63) have shown that male ERß-null mice exhibit a latency in the onset of ejaculatory behavior, suggesting that ERß might play an important role in the timing of sexual maturation. However, overall the generation of the ER-null transgenic mouse model has provided an important tool for examining estrogen signaling mechanisms and the specific contributions of ER{alpha} and ERß in vivo.

Taken together, our study provides important information about the role for ERß in GnRH neurons. Clearly, ERß provides a modulatory role that is most likely governed by a nonclassical estrogen pathway. Our data showed that, at the level of GnRH promoter activity, which is indicative of protein synthesis, ERß regulated GnRH primarily in a ligand-independent fashion. Furthermore, we have identified two regions of the mouse GnRH promoter that bind ERß. The DNA sequences in these regions are unique and not similar to known DNA binding sites for ER, thus reflecting a novel property of ERß. Future investigations into the temporal and nongenomic actions of estrogen, which are potentially mediated by ERß, will further elucidate the role that ERß plays in GnRH neurons.


    Footnotes
 
This work was supported by National Institutes of Health Grants RO1 NS039951 and F32 HD046301.

Disclosure statement: T.P., W.C., J.R., and R.H. have nothing to declare.

First Published Online January 26, 2006

Abbreviations: AP-1, Activator protein-1; DPN, diarylpropionitrile; E2, 17ß-estradiol; ER, estrogen receptor; ERE, estrogen response element; ETOH, ethanol; GR, glucocorticoid receptor; RLUs, relative light units; SERM, selective ER modulator.

Received October 12, 2005.

Accepted for publication January 13, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. King JC, Anthony EL 1984 LHRH neurons and their projections in humans and other mammals: species comparisons. Peptides 5(Suppl 1):195–207
  2. Melrose P, Gross L 1987 Steroid effects on the secretory modalities of gonadotropin-releasing hormone release. Endocrinology 121:190–199[Abstract]
  3. Herbison AE, Theodosis DT 1992 Localization of oestrogen receptors in preoptic neurons containing neurotensin but not tyrosine hydroxylase, cholecystokinin or luteinizing hormone-releasing hormone in the male and female rat. Neuroscience 50:283–298[CrossRef][Medline]
  4. Lehman MN, Karsch FJ 1993 Do gonadotropin-releasing hormone, tyrosine hydroxylase-, and ß-endorphin-immunoreactive neurons contain estrogen receptors? A double-label immunocytochemical study in the Suffolk ewe. Endocrinology 133:887–895[Abstract]
  5. Herbison AE, Horvath TL, Naftolin F, Leranth C 1995 Distribution of estrogen receptor-immunoreactive cells in monkey hypothalamus: relationship to neurones containing luteinizing hormone-releasing hormone and tyrosine hydroxylase. Neuroendocrinology 61:1–10[CrossRef][Medline]
  6. Skinner DC, Caraty A, Allingham R 2001 Unmasking the progesterone receptor in the preoptic area and hypothalamus of the ewe: no colocalization with gonadotropin-releasing neurons. Endocrinology 142:573–579[Abstract/Free Full Text]
  7. Kuiper GG, Enmark E, Pelto-Huikko M, Nilsson S, Gustafsson JA 1996 Cloning of a novel receptor expressed in rat prostate and ovary. Proc Natl Acad Sci USA 93:5925–5930[Abstract/Free Full Text]
  8. Mosselman S, Polman J, Dijkema R 1996 ERß: identification and characterization of a novel human estrogen receptor. FEBS Lett 392:49–53[CrossRef][Medline]
  9. Tremblay GB, Tremblay A, Copeland NG, Gilbert DJ, Jenkins NA, Labrie F, Giguere V 1997 Cloning, chromosomal localization, and functional analysis of the murine estrogen receptor ß. Mol Endocrinol 11:353–365[Abstract/Free Full Text]
  10. Kallo I, Butler JA, Barkovics-Kallo M, Goubillon ML, Coen CW 2001 Oestrogen receptor ß-immunoreactivity in gonadotropin releasing hormone-expressing neurones: regulation by oestrogen. J Neuroendocrinol 13:741–748[CrossRef][Medline]
  11. Skynner MJ, Sim JA, Herbison AE 1999 Detection of estrogen receptor {alpha} and ß messenger ribonucleic acids in adult gonadotropin-releasing hormone neurons. Endocrinology 140:5195–5201[Abstract/Free Full Text]
  12. Hrabovszky E, Shughrue PJ, Merchenthaler I, Hajszan T, Carpenter CD, Liposits Z, Petersen SL 2000 Detection of estrogen receptor-ß messenger ribonucleic acid and 125I-estrogen binding sites in luteinizing hormone-releasing hormone neurons of the rat brain. Endocrinology 141:3506–3509[Abstract/Free Full Text]
  13. Giguere V, Yang N, Segui P, Evans RM 1988 Identification of a new class of steroid hormone receptors. Nature 331:91–94[CrossRef][Medline]
  14. Green S, Walter P, Greene G, Krust A, Goffin C, Jensen E, Scrace G, Waterfield M, Chambon P 1986 Cloning of the human oestrogen receptor cDNA. J Steroid Biochem 24:77–83[CrossRef][Medline]
  15. Shughrue P, Scrimo P, Lane M, Askew R, Merchenthaler I 1997 The distribution of estrogen receptor-ß mRNA in forebrain regions of the estrogen receptor-{alpha} knockout mouse. Endocrinology 138:5649–5652[Abstract/Free Full Text]
  16. Barkhem T, Carlsson B, Nilsson Y, Enmark E, Gustafsson J, Nilsson S 1998 Differential response of estrogen receptor {alpha} and estrogen receptor ß to partial estrogen agonists/antagonists. Mol Pharmacol 54:105–112[Abstract/Free Full Text]
  17. Shughrue PJ, Merchenthaler I 2001 Distribution of estrogen receptor ß immunoreactivity in the rat central nervous system. J Comp Neurol 436:64–81[CrossRef][Medline]
  18. Merchenthaler I, Lane MV, Numan S, Dellovade TL 2004 Distribution of estrogen receptor {alpha} and ß in the mouse central nervous system: in vivo autoradiographic and immunocytochemical analyses. J Comp Neurol 473:270–291[CrossRef][Medline]
  19. Milner TA, Ayoola K, Drake CT, Herrick SP, Tabori NE, McEwen BS, Warrier S, Alves SE 2005 Ultrastructural localization of estrogen receptor ß immunoreactivity in the rat hippocampal formation. J Comp Neurol 491:81–95[CrossRef][Medline]
  20. Kuiper GG, Carlsson B, Grandien K, Enmark E, Haggblad J, Nilsson S, Gustafsson JA 1997 Comparison of the ligand binding specificity and transcript tissue distribution of estrogen receptors {alpha} and ß. Endocrinology 138:863–870[Abstract/Free Full Text]
  21. Paech K, Webb P, Kuiper GG, Nilsson S, Gustafsson JA, Kushner PJ, Scanlan TS 1997 Differential ligand activation of estrogen receptors ER{alpha} and ERß at AP1 sites. Science 277:1508–1510[Abstract/Free Full Text]
  22. Pak TR, Chung WC, Lund TD, Hinds LR, Clay CM, Handa RJ 2005 The androgen metabolite, 5{alpha}-androstane-3ß, 17ß-diol, is a potent modulator of estrogen receptor-ß1-mediated gene transcription in neuronal cells. Endocrinology 146:147–155[Abstract/Free Full Text]
  23. Petersen DN, Tkalcevic GT, Koza-Taylor PH, Turi TG, Brown TA 1998 Identification of estrogen receptor ß2, a functional variant of estrogen receptor ß expressed in normal rat tissues. Endocrinology 139:1082–1092[Abstract/Free Full Text]
  24. Hanstein B, Liu H, Yancisin MC, Brown M 1999 Functional analysis of a novel estrogen receptor-ß isoform. Mol Endocrinol 13:129–137[Abstract/Free Full Text]
  25. Price Jr RH, Lorenzon N, Handa RJ 2000 Differential expression of estrogen receptor ß splice variants in rat brain: identification and characterization of a novel variant missing exon 4. Mol Brain Res 80:260–268[Medline]
  26. Price Jr RH, Butler CA, Webb PA, Uht R, Kushner P, Handa RJ 2001 A splice variant of estrogen receptor ß missing exon 3 displays altered subnuclear localization and capacity for transcriptional activation. Endocrinology 142:2039–2049[Abstract/Free Full Text]
  27. Chung WCJ, Pak TR, Andersen ME, Handa RJ, The distribution of estrogen receptor ß 2 in the rat brain. Proc Annual Meeting of the Society for Neuroscience, Washington, DC, 2005 (Abstract 632.11)
  28. Zhao C, Toresson G, Xu L, Koehler KF, Gustafsson JA, Dahlman-Wright K 2005 Mouse estrogen receptor ß isoforms exhibit differences in ligand selectivity and coactivator recruitment. Biochemistry 44:7936–7944[CrossRef][Medline]
  29. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA 1998 Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor ß. Endocrinology 139:4252–4263[Abstract/Free Full Text]
  30. Mellon PL, Windle JJ, Goldsmith PC, Padula CA, Roberts JL, Weiner RI 1990 Immortalization of hypothalamic GnRH neurons by genetically targeted tumorigenesis. Neuron 5:1–10[CrossRef][Medline]
  31. Chandran UR, Attardi B, Friedman R, Zheng Z, Roberts JL, DeFranco DB 1996 Glucocorticoid repression of the mouse gonadotropin-releasing hormone gene is mediated by promoter elements that are recognized by heteromeric complexes containing glucocorticoid receptor. J Biol Chem 271:20412–20420[Abstract/Free Full Text]
  32. Bajic VB, Tan SL, Chong A, Tang S, Strom A, Gustafsson JA, Lin CY, Liu ET 2003 Dragon ERE Finder version 2: a tool for accurate detection and analysis of estrogen response elements in vertebrate genomes. Nucleic Acids Res 31:3605–3607[Abstract/Free Full Text]
  33. Legan SJ, Tsai HW 2003 Oestrogen receptor-{alpha} and -ß immunoreactivity in gonadotropin-releasing hormone neurones after ovariectomy and chronic exposure to oestradiol. J Neuroendocrinol 15:1164–1170[CrossRef][Medline]
  34. Hrabovszky E, Steinhauser A, Barabas K, Shughrue PJ, Petersen SL, Merchenthaler I, Liposits Z 2001 Estrogen receptor-ß immunoreactivity in luteinizing hormone-releasing hormone neurons of the rat brain. Endocrinology 142:3261–3264[Abstract/Free Full Text]
  35. Sharifi N, Reuss AE, Wray S 2002 Prenatal LHRH neurons in nasal explant cultures express estrogen receptor ß transcript. Endocrinology 143:2503–2507[Abstract/Free Full Text]
  36. Skinner DC, Dufourny L 2005 Oestrogen receptor ß-immunoreactive neurones in the ovine hypothalamus: distribution and colocalisation with gonadotropin-releasing hormone. J Neuroendocrinol 17:29–39[CrossRef][Medline]
  37. Radovick S, Ticknor CM, Nakayama Y, Notides AC, Rahman A, Weintraub BD, Cutler Jr GB, Wondisford FE 1991 Evidence for direct estrogen regulation of the human gonadotropin-releasing hormone gene. J Clin Invest 88:1649–1655[Medline]
  38. Wierman ME, Kepa JK, Sun W, Gordon DF, Wood WM 1992 Estrogen negatively regulates rat gonadotropin releasing hormone (rGnRH) promoter activity in transfected placental cells. Mol Cell Endocrinol 86:1–10[CrossRef][Medline]
  39. Vazquez-Martinez R, Leclerc GM, Wierman ME, Boockfor FR 2002 Episodic activation of the rat GnRH promoter: role of the homeoprotein oct-1. Mol Endocrinol 16:2093–2100[Abstract/Free Full Text]
  40. Eraly SA, Nelson SB, Huang KM, Mellon PL 1998 Oct-1 binds promoter elements required for transcription of the GnRH gene. Mol Endocrinol 12:469–481[Abstract/Free Full Text]
  41. Wierman ME, Xiong X, Kepa JK, Spaulding AJ, Jacobsen BM, Fang Z, Nilaver G, Ojeda SR 1997 Repression of gonadotropin-releasing hormone promoter activity by the POU homeodomain transcription factor SCIP/Oct-6/Tst-1: a regulatory mechanism of phenotype expression? Mol Cell Biol 17:1652–1665[Abstract]
  42. Rave-Harel N, Givens ML, Nelson SB, Duong HA, Coss D, Clark ME, Hall SB, Kamps MP, Mellon PL 2004 TALE homeodomain proteins regulate gonadotropin-releasing hormone gene expression independently and via interactions with Oct-1. J Biol Chem 279:30287–30297[Abstract/Free Full Text]
  43. Petersen SL, Gardner E, Adelman J, McCrone S 1996 Examination of steroid-induced changes in LHRH gene transcription using 33P- amd 35S-labeled probes specific for intron 2. Endocrinology 137:234–239[Abstract]
  44. Thanky NR, Slater R, Herbison AE 2003 Sex differences in estrogen-dependent transcription of gonadotropin-releasing hormone (GnRH) gene revealed in GnRH transgenic mice. Endocrinology 144:3351–3358[Abstract/Free Full Text]
  45. Krajewski SJ, Abel TW, Voytko ML, Rance NE 2003 Ovarian steroids differentially modulate the gene expression of gonadotropin-releasing hormone neuronal subtypes in the ovariectomized cynomolgus monkey. J Clin Endocrinol Metab 88:655–662[Abstract/Free Full Text]
  46. Park OK, Gugneja S, Mayo KE 1990 Gonadotropin-releasing hormone gene expression during the rat estrous cycle: effects of pentobarbital and ovarian steroids. Endocrinology 127:365–372[Abstract]
  47. Suzuki M, Nishihara M, Takahashi M 1995 Hypothalamic gonadotropin-releasing hormone gene expression during rat estrous cycle. Endocr J 42:789–796[Medline]
  48. Petersen SL, Ottem EN, Carpenter CD 2003 Direct and indirect regulation of gonadotropin-releasing hormone neurons by estradiol. Biol Reprod 69:1771–1778[Abstract/Free Full Text]
  49. Temple JL, Laing E, Sunder A, Wray S 2004 Direct action of estradiol on gonadotropin-releasing hormone-1 neuronal activity via a transcription-dependent mechanism. J Neurosci 24:6326–6333[Abstract/Free Full Text]
  50. DeFazio RA, Moenter SM 2002 Estradiol feedback alters potassium currents and firing properties of gonadotropin-releasing hormone neurons. Mol Endocrinol 16:2255–2265[Abstract/Free Full Text]
  51. Roy D, Angelini NL, Belsham DD 1999 Estrogen directly respresses gonadotropin-releasing hormone (GnRH) gene expression in estrogen receptor-{alpha} (ER{alpha})- and ERß-expressing GT1–7 GnRH neurons. Endocrinology 140:5045–5053[Abstract/Free Full Text]
  52. McKenna NJ, O’Malley BW 2002 Combinatorial control of gene expression by nuclear receptors and coregulators. Cell 108:465–474[CrossRef][Medline]
  53. Wu YL, Yang X, Ren Z, McDonnell DP, Norris JD, Willson TM, Greene GL 2004 Dissecting physiological roles of estrogen receptor {alpha} and ß with potent selective ligands from structure-based design. Mol Endocrinol 18:1599–1609[Abstract/Free Full Text]
  54. Abraham IM, Han SK, Todman MG, Korach KS, Herbison AE 2003 Estrogen receptor ß mediates rapid estrogen actions on gonadotropin-releasing hormone neurons in vivo. J Neurosci 23:5771–5777[Abstract/Free Full Text]
  55. Navarro CE, Saeed SA, Murdock C, Martinez-Fuentes AJ, Arora KK, Krsmanovic LZ Catt KJ 2003 Regulation of cyclic adenosine 3',5'-monophosphate signaling and pulsatile neurosecretion by Gi-coupled plasma membrane estrogen receptors in immortalized gonadotropin-releasing hormone neurons. Mol Endocrinol 17:1792–1804[Abstract/Free Full Text]
  56. Razandi M, Pedram A, Greene GL, Levin ER 1999 Cell membrane and nuclear estrogen receptors (ERs) originate from a single transcript: studies of ER{alpha} and ERß expressed in Chinese hamster ovary cells. Mol Endocrinol 13:307–319[Abstract/Free Full Text]
  57. Toran-Allerand CD, Guan X, MacLusky NJ, Horvath TL, Diano S, Singh M, Connolly Jr ES, Nethrapalli IS, Tinnikov AA 2002 ER-X: a novel, plasma membrane-associated, putative estrogen receptor that is regulated during development and after ischemic brain injury. J Neurosci 22:8391–8401[Abstract/Free Full Text]
  58. Suter KJ, Song WJ, Sampson TL, Wuarin JP, Saunders JT, Dudek FE, Moenter SM 2000 Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology. Endocrinology 141:412–419[Abstract/Free Full Text]
  59. Couse JF, Curtis SW, Washburn TF, Lindzey J, Golding TS, Lubahn DB, Smithies, O Korach KS 1995 Analysis of transcription and estrogen insensitivity in the female mouse after targeted disruption of the estrogen receptor gene. Mol Endocrinol 9:1441–1454[Abstract]
  60. Krege JH, Hodgin JB, Couse JF, Enmark E, Warner M, Mahler JF, Sar M, Korach KS, Gustafsson JA, Smithies O 1998 Generation and reproductive phenotypes of mice lacking estrogen receptor-ß. Proc Natl Acad Sci 95:5677–5682
  61. Belsham DD, Evangelou A, Roy D, Le D, Brown TJ 1998 Regulation of gonadotropin-releasing hormone gene expression by 5-dihydrotestosterone in GnRH-secreting GT1–7 hypothalamic neurons. Endocrinology 139:1108–1114[Abstract/Free Full Text]
  62. Dorling AA, Todman MG, Korach KS, Herbison AE 2003 Critical role for estrogen receptor {alpha} in negative feedback regulation of gonadotropin-releasing hormone mRNA expression in the female mouse. Neuroendocrinology 78:204–209[CrossRef][Medline]
  63. Temple JL, Scordalakes EM, Bodo C, Gustafsson JA, Rissman EF 2003 Lack of functional estrogen receptor ß gene disrupts pubertal male sexual behavior. Horm Behav 44:427–434[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Clin. Endocrinol. Metab.Home page
E. Hrabovszky, I. Kallo, N. Szlavik, E. Keller, I. Merchenthaler, and Z. Liposits
Gonadotropin-Releasing Hormone Neurons Express Estrogen Receptor-{beta}
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2827 - 2830.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
T. R. Pak, W. C. J. Chung, L. R. Hinds, and R. J. Handa
Estrogen Receptor-{beta} Mediates Dihydrotestosterone-Induced Stimulation of the Arginine Vasopressin Promoter in Neuronal Cells
Endocrinology, July 1, 2007; 148(7): 3371 - 3382.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/4/1924    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Pak, T. R.
Right arrow Articles by Handa, R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Pak, T. R.
Right arrow Articles by Handa, R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH