help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1116
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.
Endocrinology Vol. 147, No. 5 2147-2154
Copyright © 2006 by The Endocrine Society

Identification of a Signaling Pathway Involving Progesterone Receptor, Calcitonin, and Tissue Tranglutaminase in Ishikawa Endometrial Cells

Quanxi Li, Milan K. Bagchi and Indrani C. Bagchi

Departments of Veterinary Biosciences (Q.L., I.C.B.) and Molecular and Integrative Physiology (M.K.B.), University of Illinois at Urbana-Champaign, Urbana, Illinois 61802

Address all correspondence and requests for reprints to: Dr. Indrani C. Bagchi, Department of Veterinary Biosciences, University of Illinois, 2001 South Lincoln Avenue, Urbana, Illinois 61802. E-mail: ibagchi{at}uiuc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Previous studies indicated that calcitonin (CT), a peptide hormone involved in calcium (Ca2+) homeostasis, is transiently induced by steroid hormone progesterone (P) in the uterine epithelia of the rat and human within the window of implantation. Targeted disruption of uterine CT expression markedly impaired implantation in the rat. To gain insight into the molecular events underlying CT action in the endometrium, we performed gene expression profiling in response to CT in a human endometrial adenocarcinoma cell line, Ishikawa. We identified the gene encoding tissue tranglutaminase type II (tTGase), which participates in Ca2+-dependent, protein-protein cross-linking, as a downstream target of CT. Interestingly, addition of P alone to Ishikawa cells led to a marked induction in the level of both CT and tTGase, indicating the existence of a pathway involving P receptors, CT, and tTGase in these cells. Other studies revealed that regulation of the tTGase gene by CT occurs via its cell surface receptor and uses both cAMP and Ca2+ signaling pathways. We also noted that tTGase protein is expressed in human endometrium during the P-dominated midsecretory phase of the menstrual cycle, and it is localized at the basal membrane of glandular epithelium and the surrounding stroma. The spatio-temporal expression of tTGase in human endometrium during the cycle closely overlapped with that of CT. In summary, we have uncovered a novel steroid-regulated signaling cascade in which P induces CT, which, in turn, induces tTGase and potentially plays a critical role in the human endometrium during implantation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE PROCESS OF implantation involves complex interactions between the embryo and the endometrium. In human and rodents, the uterus can accept the blastocyst to implant for only a brief period, known as the receptive phase (1, 2). It is generally believed that the morphological and physiological alterations of the endometrium, leading to acquisition of the receptive phase of the uterus, is regulated by a complex interplay of a variety of effectors, including steroid hormones, growth factors, and cytokines (3, 4). The precise molecular mechanism by which these effectors promote uterine receptivity, however, remains unknown.

Calcitonin (CT), a peptide hormone, is known to regulate calcium homeostasis in bone and kidney (5, 6, 7). Our previous studies indicated that in response to progesterone (P), CT is induced transiently in the receptive rat endometrial epithelium within the window of implantation (8, 9). This burst of CT expression during implantation was linked to a marked reduction in the expression of E-cadherin, a calcium-dependent cell adhesion molecule. This finding led to the idea that down-regulation of E-cadherin by CT may result in the disorganization of adherens junctions between uterine epithelial cells, facilitating trophoblast invasion (10). Most importantly, suppression of the steady-state level of the CT mRNA in the preimplantation rat uterus by antisense oligodeoxynucleotides resulted in a marked reduction in the number of implanted embryos, strongly suggesting that CT expression in the preimplantation rat uterus is critical for blastocyst implantation (11). Our previous studies also reported that CT is expressed in the human endometrium during the menstrual cycle. This expression was regulated by P and occurred within the midsecretory phase, overlapping the putative window of implantation (12).

Although P regulation and implantation stage-specific expression of CT are conserved between the rat and the human, the molecular pathways that mediate the effects of CT in the endometrium have not been explored. It is known that in tissues such as bone and kidney, CT acts via its cell surface receptor (CTR) to alter gene expression patterns (13). It is, therefore, conceivable that CT signaling through its receptors on uterine cells influences the expression of genes that regulate the implantation process. Our previous studies showed that the regulation of E-cadherin expression in endometrial tissue is faithfully reproduced in Ishikawa cells, which contains abundant cell surface CTR (10). Binding of CT to its receptor led to a transient increase in intracellular calcium levels in these cells, indicating that the fundamental components of the CT signaling pathway are intact (10). Ishikawa, therefore, is a convenient model system to investigate alterations in gene expression patterns downstream of CT signaling in the endometrium.

In the current study, we employed oligonucleotide microarrays to identify genes whose expression is markedly altered in response to CT in Ishikawa cells. We report here that the expression of the gene encoding tissue tranglutaminase type II (tTGase), an enzyme that catalyzes calcium-dependent covalent cross-linking of proteins, is induced by P or CT in these cells. Furthermore, the observation that both CT and tTGase are expressed in P-dominated midsecretory endometrium within the putative window of implantation suggests that tTGase is likely to be an important downstream mediator of the biological effects of P and CT in the receptive human uterus.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents
Salmon CT, CT gene-related peptide (CGRP), and CGRP antagonist 8–37 were purchased from Peninsula Laboratories (Belmont, CA). Mouse monoclonal antibody against human tTGase II Ab-3 (clone CUB7402+TG100) was purchased from NeoMarker (Fremont, CA). FITC-goat antimouse IgG (H+L) was purchased from Zymed Laboratories, Inc. (San Francisco, CA). H89 and calphostin C, the specific inhibitors of protein kinase A (PKA) and protein kinase C (PKC), respectively, were purchased from Calbiochem-Novabiochem Corp. (La Jolla, CA). 1,2-Bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid acetoxymethyl ester (BAPTA/AM), an intracellular calcium chelator, was purchased from Sigma-Aldrich Corp. (St. Louis, MO).

Cell culture
Ishikawa endometrial adenocarcinoma cells were maintained in DMEM (Invitrogen Life Technologies, Inc., Grand Island, NY) supplemented with 5% fetal bovine serum (HyClone Laboratories, Inc., Logan, UT). Cells (5 x 105) were plated on 10-cm tissue culture dishes in phenol red-free medium containing 5% charcoal-stripped serum. The cells were grown to 70% confluence and transferred to serum-free medium for 24 h before treatment with 10 nM CT. Cells were harvested at different time points after CT treatment, and RNA was isolated for Northern blot analysis. Cells were also treated with P or CT alone or in combination with RU486 and harvested for isolation of RNA. For certain experiments, cells were also treated with 100 nM CGRP or CGRP antagonist 8–37 for 24 h. In other experiments, cells were pretreated with 2 µM H89, 250 nM calphostin C, and 33.3 µM BAPTA/AM for 1 h before the addition of CT.

Endometrial tissue
Human endometrial tissues were obtained as part of endometrial curettage from healthy, nonpregnant females between the ages of 25 and 40 yr before elective sterilization with informed consent. These tissues were obtained in accordance with the rules and regulations of the institution. After approval of the institutional review board at Nassau County Medical Center, endometrial tissues were transported to the laboratory in Hanks’ balanced salt solution on ice. Tissues were then snap-frozen in liquid nitrogen and stored at –70 C until further use. Endometrial tissues were classified according to serum levels of estradiol and P, and dating was performed based on the criteria described by Noyes et al. (14).

GeneChip analysis
For microarray analysis, RNA samples were processed and analyzed using human Affymetrix GeneChips (HGU95A) following the Affymetrix protocol as described previously (15).

Northern blot analysis
Northern blot analysis was performed as described previously (10, 16). Hybridization was carried out using 32P-labeled human tTGase and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) probes.

Immunofluorescence
Ishikawa cells were grown in calcium-containing DMEM to 60–70% confluence. Cells were then treated with either 10 nM CT or vehicle. Twenty-four hours after treatment with CT, cells were fixed with 4% paraformaldehyde and permeated with or without 0.2% Triton X-100 in PBS. After blocking with 10% nonimmune serum, distribution of tTGase was examined by immunofluorescence using a monoclonal antibody that specifically recognizes human tTGase. Signal was visualized under UV light by confocal microscope.

Immunohistochemistry
Frozen uteri were sectioned at 7 µm, mounted on slides, then fixed in 4% formaldehyde in PBS. Sections were washed, then incubated for 30 min in a blocking solution containing 10% normal goat serum before incubation in mouse monoclonal antihuman tTGase antibody (1 µg/ml) overnight at 4 C. Immunostaining was performed using a streptavidin-biotin kit for mouse primary antibody (Zymed Laboratories, Inc.) and the 3-amino-9-ethylcarbazole chromogen. Sections were counterstained with hematoxylin, mounted, and examined under bright field.

RT and quantitative real-time PCR (qPCR)
Endometrial RNA (5 µg) was subjected to cDNA synthesis using the StrataScript First-Strand Synthesis System (Stratagene, La Jolla, CA). The cDNA templates were diluted 10-fold, and the expression levels of human CT and tTGase were determined by SYBR Green-based qPCR analysis system (Applied Biosystems, Warrington, UK). The primer sequences for calcitonin were CAGATCTAAGCGGTGCGGTAATC and GACATCTCTGGGGGACTCAAAG; those for tTGase were CGTGTACCTAGATTCAGAGGC and CATACTTCACTTGCTGACAGC; and those for GAPDH were GGAAGCTTGTCATCAATGG and CGATACCAAAGTTGTCATGG, respectively. The analysis was carried out using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems). The parameters for the amplification program were as follows: 50 C for 2 min for one cycle, 95 C for 10 min for one cycle, 95 C for 15 sec, followed by 60 C for 1 min for 40 cycles. Triplicate reactions were carried out for each sample. The expression levels of CT and tTGase were normalized to that of GAPDH.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of tTGase as a CT-regulated gene in Ishikawa cells
To examine global changes in mRNA expression profiles in response to CT, Ishikawa cells were treated with this hormone or vehicle for 24 h. Total RNA was isolated and subjected to microarray analysis as described in Materials and Methods. We identified several known genes, including E-cadherin, whose expression altered significantly (2-fold or more) in Ishikawa cells in response to CT. Among these, tTGase encoded by the TGM2 gene exhibited the maximal alteration in expression (~7-fold induction).

To verify the results of our microarray analysis, total RNA obtained from Ishikawa cells treated with or without CT for 24 h was subjected to Northern blot analysis using a cDNA probe corresponding to tTGase. As shown in Fig. 1AGo, upper panel, the expression of a 1.9-kb transcript encoding tTGase was significantly induced in response to CT. Hybridization of the same blot with a control probe corresponding to GAPDH indicated equal loading of RNA in both lanes. The results of Northern blot analysis, therefore, showed that the expression of tTGase is indeed induced by CT in Ishikawa cells.


Figure 1
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 1. CT modulates tTGase gene expression in Ishikawa cells. A, Northern blot analysis confirming CT regulation of microarray-derived genes in Ishikawa cells. Total RNA was isolated from Ishikawa cells after treatment with vehicle (lane 1) or CT (lane 2) for 24 h. RNA samples (15 µg) were analyzed by Northern blotting using 32P-labeled cDNA probe corresponding to human tTGase and GAPDH genes. B, Time course of CT-mediated induction of tTGase gene expression. Ishikawa cells were treated with vehicle (lane 1) or 10 nM CT for 1 (lane 2), 3 (lane 3), 6 (lane 4), 12 (lane 5), and 24 (lane 6) h. Total RNA (15 µg/lane) was subjected to Northern blot analysis using a tTGase-specific probe.

 
We next examined the time course of CT regulation of tTGase expression in Ishikawa cells. As shown in Fig. 1BGo, tTGase mRNA was low or undetectable at 0–6 h of CT treatment. A marked induction of tTGase mRNA was observed, however, after 12 h of CT treatment (Fig. 1BGo, lane 5). The level of this mRNA increased at 24 h after CT administration (Fig. 1BGo, lane 6).

Expression of tTGase protein in Ishikawa cells
Depending upon the cell types, tTGase is localized within the cytoplasm or at the plasma membrane (17, 18, 19, 20). We, therefore, investigated the cellular distribution of tTGase protein in Ishikawa cells. These cells were grown to 60–70% confluence, treated with CT or vehicle for 24 h, then subjected to immunofluorescence using an antibody against tTGase. No immunostaining of tTGase protein was detected in the vehicle-treated cells (Fig. 2Go, A and C). Treatment of these cells with CT, on the other hand, led to a marked induction of tTGase protein expression. The immunostaining was localized within the cytosolic compartment as well as on the cell surface (Fig. 2Go, B and D).


Figure 2
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 2. CT-mediated induction of tTGase protein in Ishikawa cells. The expression of tTGase in Ishikawa cells was monitored by immunofluorescence. Ishikawa cells were treated with vehicle (A and C) or 10 nM CT (B and D) for 24 h. Cells were fixed and unpermeated (A and B) or permeated with Triton X-100 (B and D). Immunofluorescence was performed as described in Materials and Methods. The results are representative of four independent experiments.

 
Regulation of CT and tTGase expression by P
Because CT expression is regulated by P-complexed PR in the glandular epithelial cells of human endometrium, we examined whether CT is induced in response to P in Ishikawa cells, and this, in turn, influences the synthesis of tTGase. Cells were treated with vehicle, P, and CT in the absence or presence of RU486, an antiprogestin, for 24 h. The expression profiles of CT and tTGase mRNAs were then analyzed using quantitative PCR. As shown in Fig. 3Go, addition of P to Ishikawa cells led to a marked induction of CT and tTGase mRNAs. The P-mediated induction of these mRNAs was inhibited when cells were treated with RU486, indicating clearly that CT and tTGase genes are expressed downstream of PR. Addition of CT alone to Ishikawa cells induced tTGase mRNA, as expected. However, this CT-mediated induction of tTGase mRNA was not compromised in the presence of RU486 (Fig. 3Go). Collectively, these results indicated that P/PR induces the expression of CT, which, in turn, regulates the expression of tTGase in Ishikawa cells.


Figure 3
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 3. P/PR regulates the expression of CT and tTGase in Ishikawa cells. Ishikawa cells were treated with vehicle (column C), 10–7 M P (column P), 10–8 M CT (column CT), P with 10–5 M RU486 (column P+RU), or CT with 10–5 M RU486 (column CT+RU). Twenty-four hours after treatment with ligands, cells were harvested, and mRNA was isolated and subjected to qPCR analysis employing CT- or tTGase-specific primers. The x-axis corresponds to hormonal treatments, and the y-axis represents fold change in the expression level of CT and tTGase after normalization with the GAPDH signal. Fold changes were calculated by comparing the normalized expression levels of CT and tTGase to the vehicle-treated sample. The bars in the column represent the SEM.

 
Induction of tTGase expression by CT is dependent on CTR-mediated signaling
We next examined the role of cell surface CTRs in CT-mediated induction of tTGase expression in Ishikawa cells. For this purpose, cells were treated with either CT or CGRP. Although treatment of the cells with CT led to tTGase expression (Fig. 4BGo), similar treatment with CGRP, which does not bind to CTR, failed to induce tTGase expression in Ishikawa cells (Fig. 4CGo). Interestingly, when Ishikawa cells were treated with a mutant CGRP-(8–37), which binds to and functions as an agonist of CTR (21), the tTGase expression level was markedly enhanced (Fig. 4DGo), indicating that the regulation of tTGase expression by CT is initiated upon binding of this hormone to CTRs on target cells.


Figure 4
View larger version (45K):
[in this window]
[in a new window]
 
FIG. 4. CT/CTR-mediated signaling is required for tTGase expression. Ishikawa cells were treated with vehicle (A), CT (B), CGRP (C), or mutant CGRP-(8–37) (D) for 24 h and subjected to immunofluorescence using tTGase-specific antibody. The results are representative of three independent experiments.

 
CT regulates tTGase expression via PKA and calcium signaling pathways
CTR is a seven-transmembrane G protein-coupled receptor (22). Depending upon target cells, CTR couples to multiple hetrotrimeric G proteins, leading to the activation of adenylyl cyclase and/or phospholipase C pathways (23, 24, 25). It is known that cAMP produced by the activation of adenylyl cyclase turns on PKA and its downstream pathways, which may regulate gene expression. In contrast, activation of phospholipase C leads to the release of calcium from intracellular stores. The intracellular rise in calcium may alter gene expression via activation of PKC or another kinase pathway. Indeed, our previous studies showed that binding of CT to its receptors on Ishikawa cells leads to a transient rise in intracellular calcium, which then regulates the expression of the E-cadherin gene (10). In this study we investigated whether CT-mediated regulation of the tTGase gene in Ishikawa cells involves the participation of cAMP and/or calcium signaling pathways.

We analyzed the effects of specific inhibitors of PKA (H89) and PKC (calphostin C) and of intracellular calcium chelator (BAPTA/AM) on the expression of tTGase in Ishikawa cells. The cells were treated with vehicle (Fig. 5Go, lane 1), CT (lane 2), or the appropriate concentrations of H89 or calphostin C or BAPTA/AM for 1 h before the addition of CT. The pattern of tTGase expression was monitored by Northern blot analysis as well as by immunofluorescence. As shown in Fig. 5Go, in the presence of either H89 (lane 3) or BAPTA/AM (lane 5), CT failed to induce tTGase mRNA expression in Ishikawa cells. Consistent with Northern blot analysis, we observed that induction of tTGase protein expression was abolished upon treatment with either H89 (Fig. 6CGo) or BAPTA/AM (Fig. 6EGo). These results suggested that a rise in both intracellular cAMP and calcium is required for CT-mediated expression of tTGase. In contrast, calphostin C had no significant effect on the expression of tTGase mRNA (Fig. 5Go, lane 4), or tTGase protein (Fig. 6DGo), indicating that the intracellular calcium signaling that regulates the expression of this gene does not proceed through activation of PKC.


Figure 5
View larger version (18K):
[in this window]
[in a new window]
 
FIG. 5. CT regulates tTGase mRNA expression via cAMP and calcium signaling pathways. Northern blot analysis was performed to study the signaling pathways of CT-mediated expression of tTGase in Ishikawa cells. Ishikawa cells were treated with vehicle (lane 1), CT (lane 2), CT and H89 (lane 3), CT and calphostin C (lane 4), or CT and BAPTA/AM (lane 5). Cells were treated with 10 nM CT for 24 h. Hybridization was performed with 32P-labeled cDNA probes corresponding to human tTGase and GAPDH. The results are representative of two independent experiments.

 

Figure 6
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 6. Inhibitors of cAMP and calcium signaling pathways block tTGase protein expression in Ishikawa cells. Ishikawa cells were treated with vehicle (A), CT (B), CT and H89 (C), CT and calphostin C (D), or CT and BAPTA/AM (E) and subjected to immunofluorescence as described in Materials and Methods. The results are representative of three independent experiments.

 
Temporal profile of tTGase protein expression in human endometrium closely follows that of CT
Because we have identified tTGase as a downstream target of CT in Ishikawa cells, it is of interest to compare its expression profile to that of CT in the endometrial tissue. To test this possibility, we isolated total RNA from human endometrial biopsies representing proliferating, midsecretory, and late secretory phases of the menstrual cycle. We then analyzed the expression of CT and tTGase mRNAs in these tissues using quantitative PCR. As shown in Fig. 7Go, the temporal expression profile of tTGase mRNA in human endometrium during the menstrual cycle closely overlapped that of CT, its potential inducer in this tissue.


Figure 7
View larger version (13K):
[in this window]
[in a new window]
 
FIG. 7. Expression profiles of CT and tTGase on different days of the menstrual cycle by qPCR analysis. Total RNA was isolated from endometrial biopsies on d 7, 15, 21, and 27 of the menstrual cycle. RNA samples were pooled from two biopsies representing each of the specific days of the menstrual cycle and subjected to qPCR analysis. The x-axis corresponds to the stage of the menstrual cycle. The y-axis represents the fold change in the expression levels of CT and tTGase after normalization with the GAPDH signal. The expression levels on different days of the menstrual cycle were compared with the values on d 7 of the menstrual cycle. The bars in the column represent the SEM.

 
tTGase protein is localized in the basal membrane of glandular epithelium and stromal cells in human endometrium
To identify the site(s) of tTGase protein expression in the human endometrium, we performed immunocytochemical staining of sections of endometrial biopsies at mid- (d 20) and late (d 28) secretory stages of the menstrual cycle using an antibody against human tTGase. As shown in Fig. 8Go, A and B, sections of an endometrial sample in the midsecretory phase of the menstrual cycle exhibited strong tTGase-specific staining. This staining was predominantly present in the basal membrane of the glandular epithelium and the surrounding stromal cells. Control sections of the same endometrial tissue sample showed no immunoreactivity when incubated with preimmune serum, indicating the specificity of the immunostaining (Fig. 8Go, E and F). The tTGase-specific staining declined in the endometrium during the late secretory phase of the cycle (Fig. 8Go, C and D). Collectively, these results are consistent with our hypothesis that CT, which is secreted by the glandular epithelium of midsecretory phase human endometrium, controls the expression of tTGase in glandular and stromal cells in an autocrine or paracrine manner.


Figure 8
View larger version (192K):
[in this window]
[in a new window]
 
FIG. 8. Immunohistochemical localization of tTGase in human endometrium. Human endometrium specimens in the midsecretory (d 20) and late secretory (d 28) phases of the menstrual cycle were obtained from diagnostic endometrial hysterectomies performed for benign conditions. The specimens were dated according to the criteria of Noyes et al. (20 ). Immunohistochemistry was performed with endometrial sections in the midsecretory (d 20; A and B) phase and late secretory (d 28; C and D) phase, employing monoclonal antihuman tTGase antibody. E and F, Endometrial section from the midsecretory phase (d 20) incubated with preimmune serum. Similar staining patterns were observed using endometrial sections obtained from two additional individuals on each of these days.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously reported that the expression of CT is induced in the uterine epithelium of species as diverse as rats and humans within the window of implantation (8, 9, 12). Our studies also suggested that CT secreted into rat uterine lumen at the time of implantation regulates blastocyst implantation in a paracrine manner (9). Based on these results, it was postulated that binding of CT to the CTRs that exist on target endometrial cells sets in motion a signaling pathway that eventually triggers the expression of a unique set of genes that control a variety of cellular functions during implantation. In support of this concept, we observed that CT down-regulates the expression of the E-cadherin gene in the surface epithelium, thereby regulating the interaction of the trophoblast with epithelial cells (10). In the present study, microarray analysis revealed that in addition to E-cadherin, CT treatment leads to a marked alteration in gene expression of tTGase in Ishikawa cells, thereby identifying this gene as a novel downstream target of CT. Our studies have uncovered a chain of events linking PR activation, CT expression, and tTGase induction in Ishikawa cells. We have previously shown that P regulates CT expression in the endometrial tissue (12). We now recapitulate this regulation in a relevant cell culture system and also show that P regulates the expression of tTGase, the downstream target of CT.

Our results are consistent with a previous report that P induces tTGase expression in a primary culture of human endometrial cells (26). The induction of tTGase mRNA occurred within 6 h after the addition of P to the culture. It was, however, unclear whether this gene induction by P was due to a direct regulation of transcription of tTGase gene by the activated P receptors (PRs) or occurred through a mediator molecule induced by P. In the present study we used a PR antagonist, RU486, to establish that P acting through PRs induces CT expression in Ishikawa cells, and CT then acts as the inducer of tTGase. Although RU486 also exhibits antiglucocorticoid activity, it is unlikely that tTGase expression in Ishikawa cells is regulated by cortisol. This is based on the observation that the addition of P alone to Ishikawa cells leads to tTGase expression. Furthermore, the induction of tTGase in these cells in response to exogenous CT is not significantly inhibited by RU486. CT, therefore, emerges as a likely mediator of P effects on tTGase expression. Based on our data we, therefore, propose that the P-mediated production of CT drives tTGase expression in epithelial and stromal cells within endometrial tissue.

We investigated the pathways initiated by CT that lead to alteration in tTGase gene expression in these cells. Previous studies using cultured bone and kidney cells have shown that CTR, a G protein-coupled receptor, signals via heterotrimeric G proteins and activates either the adenyl cyclase and/or the phospholipase C pathways (23, 24, 25). The activation of adenyl cyclase elicits a transient rise in intracellular cAMP, which then activates cAMP-dependent protein kinase (PKA). Activated phospholipase C in contrast, catalyzes phosphatidylinositol diphosphate to produce the second messengers, diacylglycerol and inositol triphosphate. Diacylglycerol activates the PKC signaling pathway, whereas inositol triphosphate binds to calcium channel proteins on endoplasmic reticulum and releases calcium from intracellular stores. As the intracellular calcium level rises in response to CT, one or more calcium-sensitive signal transduction cascades, including PKC, calmodulin-dependent kinases, and MAPKs, are likely to be activated (27). Depending upon the target cells, these signaling pathways interact synergistically or in an antagonistic manner to modulate target gene expression (28, 29, 30).

In Ishikawa cells, the analysis of tTGase expression indicated the involvement of multiple signaling schemes initiated by the binding of CT to its cell surface receptor. We observed that both PKA and calcium-mediated signaling pathways are critical for CT-dependent expression of this gene. The inhibition of the PKA signaling pathway or blockade of the elevation in intracellular calcium by BAPTA-AM prevented the induction of tTGase expression by CT. In contrast, inhibition of PKC did not have any effect on CT-mediated gene expression. Clearly, a cooperative interaction between CT-induced PKA and calcium signaling pathways is essential for tTGase gene expression in Ishikawa cells. The mechanism by which these two pathways converge at the regulatory regions of the tTGase gene in Ishikawa cells remains to be determined.

Although we have identified tTGase as a downstream target of CT in Ishikawa cells, an important question is whether CT acts as an inducer of this gene in endometrial tissue. If this is true, one would predict that the expression profiles of these two molecules would temporally coincide. Indeed, maximal expression of tTGase occurred during the midsecretory phase of the menstrual cycle, when CT expression is at its highest. The observed pattern of tTGase expression in human endometrium is also consistent with an earlier study that reported a 10-fold higher enzymatic activity of tTGase in human endometrium during the midsecretory phase compared with other phases of the menstrual cycle (31). We observed that the expression of tTGase in endometrial tissue was restricted to the basal membrane of the glandular epithelium and surrounding stromal cells. Although this pattern of expression is consistent with the scenario that CT secreted by the glandular epithelium acts on epithelial and stromal cells to induce tTGase expression, additional studies involving primary cultures of human endometrial cells are necessary to establish this hypothesis.

One can envision a number of ways in which tTGase may function in human endometrium during implantation. A hallmark of the transglutaminase enzymes, of which there are eight encoded by the human genome, is their ability to catalyze the rapid generation of covalent cross-linking between proteins in a calcium-dependent manner (32). Various transglutaminase enzymes have been implicated in the generation of supramolecular protein assemblies that are important for biological processes, such as blood coagulation, creation of the fertilization envelope, and formation of extracellular matrix (32). Although the primary function of these enzymes was originally thought to be this cross-linking activity, other specialized noncatalytic actions of these proteins have also come to light. Particularly for tTGase, these actions may include modulation of cytoskeletal structure, cell adhesion, and signal transduction (18, 19, 20). It is believed that the cell surface tTGase functions as a novel integrin coreceptor to promote cell attachment, spreading, and migration in diverse tissues (18, 19, 20). Clearly, one or more of these cellular activities are likely to play a critical role in the implantation process. Previous studies reported that elevated tTGase expression and enzymatic activity in a number of cell types inhibit proliferation and are accompanied by cell differentiation (33). Consistent with this proposed role, a study by Fujimoto et al. (26), using tTGase inhibitors and antisense oligonucleotides directed against tTGase mRNA, reported that the expression of tTGase is required for P-induced decidualization of human endometrial stromal cells. Although the results obtained from Ishikawa cells may not faithfully reflect all the events that occur in normal endometrium, our study provides an important link between the known biological actions of P in the uterus during implantation to the expression of tTGase in this tissue. Future studies will determine whether CT-induced tTGase controls critical uterine functions during implantation.


    Acknowledgments
 
We acknowledge Dr. Sushma Kumar (Nassau County Medical Center) for providing the human endometrial biopsy tissues used in this work.


    Footnotes
 
This work was supported by National Institutes of Health Grants R01-HD-34527, R01-HD-39291, and R01-HD-43381 (to I.C.B.) and Grant R01-HD-44611 (to M.K.B.). This investigation was conducted in a facility constructed with support from Research Facilities Improvement Program Grant C06 RR from the National Center for Research Resources, National Institutes of Health (to I.C.B.).

Disclosure: Q. Li, M. K. Bagchi, and I. C. Bagchi have nothing to declare.

First Published Online January 26, 2006

Abbreviations: BAPTA/AM, 1,2-Bis(2-aminophenoxy)ethane-N,N,N', N'-tetraacetic acid acetoxymethyl ester; CGRP, calcitonin gene-related peptide; CT, calcitonin; CTR, CT receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; P, progesterone; PKA, protein kinase A; PKC, protein kinase C; qPCR, quantitative real-time PCR; tTGase, tissue tranglutaminase type II; PR, progesterone receptor.

Received September 1, 2005.

Accepted for publication January 19, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Psychoyos A 1973 Hormonal control of ovoimplantation. Vitam Horm 31:201–256[Medline]
  2. Psychoyos A 1986 Uterine receptivity for nidation. Ann NY Acad Sci 476:36–42[Medline]
  3. Carson DD, Bagchi I, Dey SK, Enders AC, Fazleabas AT, Lessey BA, Yoshinaga K 2000 Embryo implantation. Dev Biol 223:217–237[CrossRef][Medline]
  4. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, Wang H 2004 Molecular cues to implantation. Endocr Rev 25:341–373[Abstract/Free Full Text]
  5. Friedman J, Raisz LG 1965 Thyrocalcitonin: inhibitor of bone resorption in tissue culture. Science 150:1465–1467[Abstract/Free Full Text]
  6. Foster GV 1968 Calcitonin (thyrocalcitonin). N Engl J Med 279:349–360[Medline]
  7. Austin LA, Heath III H 1981 Calcitonin: physiology and pathophysiology. N Engl J Med 304:269–278[Medline]
  8. Ding YQ, Zhu LJ, Bagchi MK, Bagchi IC 1994 Progesterone stimulates calcitonin gene expression in the uterus during implantation. Endocrinology 135:2265–2274[Abstract]
  9. Zhu LJ, Cullinan-Bove K, Polihronis M, Bagchi MK, Bagchi IC 1998 Calcitonin is a progesterone-regulated marker that forecasts the receptive state of endometrium during implantation. Endocrinology 139:3923–3934[Abstract/Free Full Text]
  10. Li Q, Wang J, Armant DR, Bagchi MK, Bagchi IC 2002 Calcitonin down-regulates E-cadherin expression in rodent uterine epithelium during implantation. J Biol Chem 277:46447–46455[Abstract/Free Full Text]
  11. Zhu LJ, Bagchi MK, Bagchi IC 1998 Attenuation of calcitonin gene expression in pregnant rat uterus leads to a block in embryonic implantation. Endocrinology 139:330–339[Abstract/Free Full Text]
  12. Kumar S, Zhu LJ, Polihronis M, Cameron ST, Baird DT, Schatz F, Dua A, Ying YK, Bagchi MK, Bagchi IC 1998 Progesterone induces calcitonin gene expression in human endometrium within the putative window of implantation. J Clin Endocrinol Metab 83:4443–4450[Abstract/Free Full Text]
  13. Kobayashi T, Sugimoto T, Saijoh K, Fukase M, Chihara K 1994 Calcitonin directly acts on mouse osteoblastic MC3T3–E1 cells to stimulate mRNA expression of c-fos, insulin-like growth factor-1 and osteoblastic phenotypes (type 1 collagen and osteocalcin). Biochem Biophys Res Commun 199:876–880[CrossRef][Medline]
  14. Noyes RW, Hertig AT, Rock J 1975 Dating the endometrial biopsy. Am J Obstet Gynecol 122:262–263[Medline]
  15. Cheon YP, Li Q, Xu X, DeMayo FJ, Bagchi IC, Bagchi MK 2002 A genomic approach to identify novel progesterone receptor-regulated pathways in the uterus during implantation. Mol Endocrinol 16:2853–2871[Abstract/Free Full Text]
  16. Li Q, Zhang M, Kumar S, Zhu LJ, Chen D, Bagchi MK, Bagchi IC 2001 Identification and implantation stage-specific expression of an interferon-{alpha}-regulated gene in human and rat endometrium. Endocrinology 142:2390–2400[Abstract/Free Full Text]
  17. Chen JS, Mehta K 1999 Tissue transglutaminase: an enzyme with a split personality. Int J Biochem Cell Biol 31:817–836[CrossRef][Medline]
  18. Akimov SS, Belkin AM 2001 Cell-surface transglutaminase promotes fibronectin assembly via interaction with the gelatin-binding domain of fibronectin: a role in TGFß-dependent matrix deposition. J Cell Sci 114:2989–3000
  19. Isobe T, Takahashi H, Ueki S, Takagi J, Saito Y 1999 Activity-independent cell adhesion to tissue-type transglutaminase is mediated by {alpha}4ß1 integrin. Eur J Cell Biol 78:876–883[Medline]
  20. Akimov SS, Belkin AM 2001 Cell surface tissue transglutaminase is involved in adhesion and migration of monocytic cells on fibronectin. Blood 98:1567–1576[Abstract/Free Full Text]
  21. Chiba T, Yamaguchi A, Yamatani T, Nakamura A, Morishita T, Inui T, Fukase M, Noda T, Fujita T 1989 Calcitonin gene-related peptide receptor antagonist human CGRP-(8–37). Am J Physiol 256:E331–E335
  22. Lin HY, Harris TL, Flannery MS, Aruffo A, Kaji EH, Gorn A, Kolakowski Jr LF, Lodish HF, Goldring SR 1991 Expression cloning of an adenylate cyclase-coupled calcitonin receptor. Science 254:1022–1024[Abstract/Free Full Text]
  23. Chabre O, Conklin BR, Lin HY, Aruffo A, Kaji EH, Gorn A, Kolakowski Jr LF, Lodish HF, Goldring SR 1992 A recombinant calcitonin receptor independently stimulates 3',5'-cyclic adenosine monophosphate and Ca2+/inositol phosphate signaling pathways. Mol Endocrinol 6:551–556[Abstract/Free Full Text]
  24. Force T, Bonventre JV, Flannery MR, Gorn AH, Yamin M, Goldring SR 1992 A cloned porcine renal calcitonin receptor couples to adenylyl cyclase and phospholipase C. Am J Physiol 262:F1110–F1115
  25. Heersche JN, Marcus R, Aurbach GD 1974 Calcitonin and the formation of 3',5'-AMP in bone and kidney. Endocrinology 94:241–247[Abstract/Free Full Text]
  26. Fujimoto M, Kanzaki H, Nakayama H, Higuchi T, Hatayama H, Iwai M, Kaneko Y, Mori T, Fujita J 1996 Requirement for transglutaminase in progesterone-induced decidualization of human endometrial stromal cells. Endocrinology 137:1096–1101[Abstract]
  27. Chen Y, Shyu JF, Santhanagopal A, Inoue D, David JP, Dixon SJ, Horne WC, Baron R 1998 The calcitonin receptor stimulates Shc tyrosine phosphorylation and Erk1/2 activation. Involvement of Gi, protein kinase C, and calcium. J Biol Chem 273:19809–19816[Abstract/Free Full Text]
  28. Lacroix M, Body JJ 1997 Regulation of c-fos and c-jun expression by calcitonin in human breast cancer cells. Calcif Tissue Int 60:513–519[CrossRef][Medline]
  29. Arbogast LA, Shah GV, Voogt JL 1999 3,5 Cyclic adenosine monophosphate mediates the salmon calcitonin-induced increase in hypothalamic tyrosine hydroxylase activity. Endocrinology 140:3273–3281[Abstract/Free Full Text]
  30. Shah GV, Rayford W, Noble MJ, Austenfeld M, Weigel J, Vamos S, Mebust WK 1994 Calcitonin stimulates growth of human prostate cancer cells through receptor-mediated increase in cyclic adenosine 3',5'-monophosphates and cytoplasmic Ca2+ transients. Endocrinology 134:596–602[Abstract/Free Full Text]
  31. Signorini M, Pansini F, Bonaccorsi G, Mollica G, Ferrari C, Bergamini CM 1988 Regulation of endometrial transglutaminase activity during the menstrual cycle. Biochem Int 16:77–82[Medline]
  32. Lorand L, Graham RM 2003 Transglutaminases: crosslinking enzymes with pleiotropic functions. Nat Rev Mol Cell Biol 4:140–156[CrossRef][Medline]
  33. Aeschlimann D, Wetterwald A, Fleisch H, Paulsson M 1993 Expression of tissue transglutaminase in skeletal tissues correlates with events of terminal differentiation of chondrocytes. J Cell Biol 120:1461–1470[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
EndocrinologyHome page
L. Aghajanova, M. C. Velarde, and L. C. Giudice
The Progesterone Receptor Coactivator Hic-5 Is Involved in the Pathophysiology of Endometriosis
Endocrinology, August 1, 2009; 150(8): 3863 - 3870.
[Abstract] [Full Text] [PDF]


Home page
Mol Hum ReprodHome page
S. Bai, G. Grossman, L. Yuan, B. A. Lessey, F. S. French, S. L. Young, and E. M. Wilson
Hormone control and expression of androgen receptor coregulator MAGE-11 in human endometrium during the window of receptivity to embryo implantation
Mol. Hum. Reprod., February 1, 2008; 14(2): 107 - 116.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, Q.
Right arrow Articles by Bagchi, I. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals