| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Medicine, Division of Endocrinology and Metabolism (W.L., M.T.A.N., T.I., J.M.O.), University of California, San Diego, La Jolla, California 92093; and Laboratory of Genetics (O.S., I.M.V.), The Salk Institute for Biological Studies, La Jolla, California 92037
Address all correspondence and requests for reprints to: Jerrold M. Olefsky, M.D., Department of Medicine (0673), University of California, San Diego, 9500 Gilman Drive, La Jolla, California 92093-0673. E-mail: jolefsky{at}ucsd.edu.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Studies to decipher the role of a given gene product rely heavily on various knockout or knockdown strategies. Antisense nucleic acid derivatives for targeted inhibition of gene function have been used by many investigators for over two decades (7). The major classes of antisense agents currently used to knock down specific mRNAs are antisense oligonucleotides, ribozymes, DNAzymes, and small interfering RNA (siRNA). Currently, siRNA is the most potent and widely used method for inhibiting gene expression in cell cultures. It has become the method of choice among the antisense technologies. siRNAs can be chemically synthesized or expressed from plasmid vectors. Although such siRNAs provide powerful tools for targeted inhibition of gene expression, certain limitations exist. For example, the transfection efficiency of siRNAs can be limiting in some cell types, including 3T3-L1 adipocytes. In addition, even with successful siRNA delivery, the knockdown effects are generally short-lived.
Accordingly, we have used an alternate strategy for functional gene knockdown in 3T3-L1 adipocytes to assess the molecular mechanisms of insulin signaling. This was accomplished by using a lentiviral vector to express short hairpin RNA (shRNA) sequences in these cells. In this study, we chose to target GLUT4 to validate this approach and to better understand the role of GLUT4 translocation in the process of insulin stimulated glucose transport. First, our studies demonstrate that lentiviruses can efficiently deliver transgenes and siRNAs into fully differentiated 3T3-L1 adipocytes. Second, we established a strategy for identifying efficient siRNA sequences by transfecting 293 cells with the target gene fluorescent fusion protein plasmid along with a plasmid that expresses shRNA. Third, by using lentivirus-mediated shRNA expression, we show that siGLUT4 (siRNA against GLUT4) reduced endogenous GLUT4 expression to almost undetectable levels in 3T3-L1 adipocytes. However, insulin-stimulated glucose uptake was only 5060% reduced, suggesting that other glucose transporter(s) are involved in this process. After the introduction of siGLUT1 (siRNA against GLUT1) into GLUT4-deficient adipocytes, insulin-stimulated glucose uptake was essentially abolished, demonstrating that both GLUT4 and GLUT1 are important in transporting glucose in 3T3-L1 cells. These studies indicate that lentiviral shRNA constructs provide an excellent approach for delivering siRNA into 3T3-L1 adipocytes. Moreover, because the constructs are stably integrated into the host genome, they should be useful for a variety of studies of insulin signaling and adipocyte biology.
| Materials and Methods |
|---|
|
|
|---|
(peroxisome proliferator-activated receptor-
) monoclonal antibodies, rabbit anti-IRß, anti-IRS1, and anti-annexin II were from Santa Cruz Biotechnology (Santa Cruz, CA). Rabbit anti-RFP (red fluorescent protein) antibody was from BD Biosciences (Palo Alto, CA). Rabbit anti-IRS2 was from Upstate (Waltham, MA). Rabbit antiactin was from Sigma. Rabbit anti-IRAP (insulin-responsive aminopeptidase) antibody was from Dr. Steve Waters (Metabolex Inc., Hayward, CA). DMEM and fetal bovine serum were from Invitrogen (Carlsbad, CA). All radioisotopes were from ICN (Costa Mesa, CA). All other reagents were purchased from Sigma (St. Louis, MO).
Cell culture
Culture and differentiation of 3T3-L1 cells were described previously (8, 9). In brief, the cells were grown and maintained in high-glucose DMEM containing 10% fetal bovine serum in a 10% CO2 environment. The cells were allowed to grow for 2 d after confluency and then differentiated by the addition of isobutylmethylxanthine (500 µM), dexamethasone (25 µM), and insulin (4 µg/ml) for 4 d. The medium was then changed every 3 d.
Construction of GFP and RFP reporter plasmids
For these plasmids, the GFP cDNA in a lentiviral expressing plasmid (10) was excised by NheI/EcoRI digestion and replaced with a PCR product in which the GFP or RFP cDNA was flanked by N-terminal XbaI/NheI/SmaI sites and a C-terminal (His)6 tag and EcoRI/SalI site. To generate the cDNA for GLUT4-GFP (or -RFP) fusion protein, the PCR products were restricted with NheI and EcoRI and subcloned into the NheI/EcoRI site of the vector, and a mouse GLUT4 cDNA preceded by a Kozak consensus sequence franked with NheI at 5' and SmalI at 3'was inserted. The plasmids were verified by DNA sequencing.
Design and subcloning of shRNAs
shRNA sequence templates were inserted into human H1 promoter-containing pBluescript SK plasmid as described (11). Each hairpin consists of a BglII site, a 19-nucleotide sense sequence, a short spacer (TTCAAGAGA), a 19-nucleotide antisense sequence, five thymidines (a stop signal for RNA polymerase III), and a HindIII site. The oligos were annealed and inserted between the BglII and HindIII sites of the plasmid, next to a human H1-RNA promoter. We constructed four shRNAs for mouse GLUT4 using four oligo pairs (sense and antisense strands underlined; italics indicates loop): no. 1 forward (GATCCCCGGTGATTGAACAGAGCTACTTCAAGAGAGTAGCTCTGTTCAATCACCTTTTTGGAAA), no. 1 reverse (AGCTTTTCCAAAAAGGTGATTGAACAGAGCTACTCTCTTGAAGTAGCTCTGT TCAATCACCGGG); no. 2 forward (GATCCCCTGTCCTTGCTCCAGCTCCTTTCAAGAGAAGGAGC TGGAGCAAGGACATTTTTGGAAA), no. 2 reverse (AGCTTTTCCAAAAATGTCCTTGCTCCAGC TCCTTCTCTTGAAAGGAGCTGGAGCAAGGACAGGG); no. 3 forward (GATCCCCGGATGAGAAACGGAAGTTGTTCAAGAGACAACTTCCGTTTCTCATCCTTTTTGGAAA); no. 3 reverse (AGCTTTT CCAAAAAGGATGAGAAACGGAAGTTGTCTCTTGAACAACTTCCGTTTCTCATCCGGG); no. 4 forward (GATCCCCCAATGTCTTGGCCGTGTTGTTCAAGAGACAACACGGCCAAGACATTGTTTT TGGAAA), no. 4 reverse (AGCTTTTCCAAAAACAATGTCTTGGCCGTGTTGTCTCTTGAACAACA CGGCCAAGACATTGGGG). Oligo pairs for shRNA against luciferase were: siLUC forward (GATCCCCGATTTCGAGTCGTCTTAATTTCAAGAGAATTAAGACGACTCGAAATCTTTTTGGAAA), siLUC reverse (AGCTTTTCCAAAAAGATTTCGAGTCGTCTTAATTCTCTTGAAATTAAGACGA CTCGAAATCGGG). Oligo pairs for GFP shRNA were described previously (11).
To subclone the shRNA cassettes into the lentiviral vector, the hairpin along with the H1-RNA promoter was PCR-amplified as described previously (11) using two primers that contained XbaI site: forward primer (CGAGGTCGACGGTCTAGATAAGC) and reverse primer: (AATTAACCCTCACTAAAGGG). The PCR products were then digested by XbaI and inserted into the NheI site in the 3'-long terminal repeat of the lentiviral expression plasmid that contains a cytomegalovirus promoter and GFP (11). Correct insertions of shRNA cassettes were confirmed by restriction mapping and DNA sequencing.
Lentivirus production and infection of 3T3-L1 adipocytes
Recombinant lentiviruses were produced by cotransfecting 293T cells with the lentivirus expression plasmid and packaging plasmids using the calcium phosphate method (12, 13, 14). Infectious lentiviruses were harvested at 48 and 72 h after transfection and filtered through 0.22-µm cellulose acetate filters (15). Recombinant lentiviruses were concentrated by ultracentrifugation (2 h at 50,000 x g) and subsequently purified on a 20% sucrose cushion (2 h at 46,000 x g). The infectious titer was determined by FACS analysis of GFP positive in 293 cells.
The infection of 3T3-L1 adipocytes (810 d after differentiation) with siGLUT4 lentivirus was carried out by adding lentivirus into the cell culture at the MOI of approximately 120. The controls were infected with siLUC (siRNA against luciferase). Four hours after the incubation, the medium was changed.
Identification of efficient siRNA sequences
Optimal siRNA targets for GLUT4 knockdown were identified by cotransfecting 293T cells with GLUT4 reporter plasmid and siGLUT4 plasmid by using Lipofectamine 2000 (Invitrogen) according to the manufacturers instruction. Three days after transfection, reporter gene expression was examined using fluorescent microscopy and anti-GFP or anti-RFP immunoblots. We also cotransfected 293 cells with the GLUT4-GFP reporter plasmid and PCR-derived siGLUT4 cassettes that contain the H1 promoter and shRNA templates (forward primer, AATTAACCCTCACTAAAGGG; reverse primer, CGAGGTCGACGGTATCGATAAGC). This facilitated the identification of optimal siRNA sequences as 293T cells are highly transfectable using routine lipid-based reagents.
Immunoblot and glucose uptake analysis
For immunoblot analysis, the cells were lysed in a buffer containing 25 mM Tris-HCl (pH 7.4), 0.5 mM EGTA, 25 mM NaCl, 1% Nonidet P-40, 1 mM Na3VO4, 10 mM NaF, 0.2 mM leupeptin, 1 mM benzamidine, and 0.1 mM 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride and rocked for 40 min at 4 C. Insoluble material was removed by centrifugation at 12,000 x g for 10 min at 4 C. Cell lysates were separated by SDS-PAGE for immunoblot analysis. The proteins were detected by enhanced chemiluminescence with horseradish peroxidase-labeled secondary antibodies.
The procedure for 2-[3H] deoxyglucose uptake was described previously (16). 3T3-L1 adipocytes were serum-starved for 3 h, and the cells were stimulated with insulin for 20 min at 37 C. Glucose uptake was determined after the addition of 2-[3H] deoxyglucose (0.1 µCi, final concentration 0.1 mM) in KRP-HEPES buffer [10 mM HEPES (pH 7.4), 131.2 mM NaCl, 4.7 mM KCl, 1.2 mM MgSO4, 2.5 mM CaCl2, 2.5 mM NaH2PO4] for 10 min at 37 C.
Electroporation of siRNA into 3T3-L1 adipocytes
Six days after differentiation, 3T3-L1 adipocytes were electroporated with siGLUT1 (SmartPool; Darmacon, Lafayette, CO; 2.5 nmol per 1 x 107 cells) or siLUC oligonucleotides using the Gene Pulser Xcell (Bio-Rad, Hercules, CA; 250 V and 950 µF). Forty-eight hours after electroporation, glucose uptake assays were performed as described (16).
Oil Red O staining of triglycerides
3T3-L1 cells were fixed with 3.7% formaldehyde for 10 min and then stained with Oil Red O for 1 h followed by washing with 70% methanol and water (17). For fat quantitation, the plates were dried for 1 h at 37 C, and Oil Red O was extracted with isopropanol and quantitated as described (18).
| Results |
|---|
|
|
|---|
As shown in Fig. 1A
, 3 d after transfection of GFP plasmids using Lipofectamine 2000, GFP was readily detectable in 3T3-L1 preadipocytes but barely detectable in 3T3-L1 adipocytes (Fig. 1A
). In contrast, infection of cells with a lentivirus construct encoding GFP led to highly efficient expression in both cell types. Specifically, 3T3-L1 adipocytes were infected with lenti GFP 9 d after differentiation. Two days later, GFP expression was readily detected, and 5 d later more than 95% of cells exhibited fluorescence (Fig. 1B
). The transgene expression was quite stable because GFP was detected as late as 44 d after infection (Fig. 1B
). An additional experiment was performed by infecting the cells on d 20 of adipogenic differentiation. As shown in Fig. 1C
, 5 d after infection, most cells expressed GFP. Thus, lentiviruses provide an efficient system for delivering exogenous genes into fully differentiated 3T3-L1 adipocytes.
|
Lentiviral transduction does not interfere with insulin signaling in 3T3-L1 adipocytes
To determine whether lentiviral infection interferes with insulin action, the adipocytes were treated with lenti GFP, and insulin signaling was assessed 5 d later. As shown in Fig. 1E
, protein levels of IRß, IRS1, and AKT in the lentivirus-transduced cells were similar to those in the nontransduced control cells. The lentivirus-transduced cells also responded to insulin stimulation normally as assessed by insulin-stimulated phosphorylation of IRß, IRS1, and AKT. In addition, the lentivirus did not alter basal or insulin-stimulated 2-[3H] deoxyglucose uptake (Fig. 1F
).
Lentivirus-mediated siGFP efficiently blocks GFP expression
Fully differentiated 3T3-L1 adipocytes were infected with lenti GFP, either alone or in combination with a lenti siGFP (siRNA directed against GFP). Five, 10, and 20 d after infection, GFP was highly expressed in the lenti GFP cells but was barely detectable in the cells coinfected with lenti siGFP (Fig. 2
). These results show that lentiviruses provide efficient delivery of exogenous genes, as well as functional siRNAs into 3T3-L1 adipocytes.
|
|
As shown in Fig. 3C
, the siRNA expressing plasmid itself had no effect on GLUT4-GFP expression, whereas two siGLUT4 (i.e. 1 and 3) markedly silenced GLUT4-GFP expression, one had a moderate silencing effect (i.e. 4), and one had no effect (i.e. 2) as observed by fluorescence microscopy and immunoblot analysis. We also cotransfected 293T cells with the GLUT4-GFP reporter plasmid together with PCR-derived siGLUT4 cassettes that contain H1 promoter and hairpin shRNA templates. A similar effect was observed (Fig. 3D
): two siGLUT4 (i.e. 1 and 3) markedly silenced protein expression (fluorescence microscopy and immunoblot analysis), one had a moderate silencing effect (i.e. 4), and one had no effect (i.e. 2).
We further confirmed the silencing effect of siGLUT4 by cotransfecting 293T cells with the GLUT4-RFP reporter plasmid and siGLUT4 plasmids (data not shown). We then subcloned the most effective siGLUT4 siRNA together with the H1 promoter into a lentivirus expressing plasmid. Cotransfection of 293T cells with GLUT4-RFP and siGLUT4 plasmids showed that siGLUT4 markedly silenced GLUT4-RFP expression as observed by fluorescence microscopy and determined by immunoblot analysis (data not shown).
Silencing endogenous GLUT4 partially blocks insulin-stimulated glucose uptake
Fully differentiated 3T3-L1 adipocytes were infected with lenti siGLUT4 to assess the role of GLUT4 in glucose transport. As shown in Fig. 4A
, lenti siGLUT4 markedly reduced endogenous GLUT4 expression (>90%) but did not affect other proteins such as GLUT1, IRß, IRS1 and 2, PPAR
, annexin II, or actin. Insulin-stimulated 2-[3H] deoxyglucose uptake was reduced by approximately 55% in the lenti siGLUT4 cells compared with cells infected with control lentivirus (Fig. 4B
).
|
, or annexin II expression. When glucose transport was assessed, basal 2-[3H] deoxyglucose uptake was not affected, whereas insulin-stimulated uptake was decreased by approximately 60% in the lenti siGLUT4 adipocytes (Fig. 4D
It should be noted that although GLUT4 protein was reduced to undetectable levels in the lenti siGLUT4 cells, a significant proportion of insulin-stimulated glucose uptake (
40%) remained. This suggests that another glucose transporter(s) plays an important role in insulin-stimulated glucose transport in 3T3-L1 adipocytes. Because it is well known that 3T3-L1 adipocytes also express GLUT1, we electroporated siGLUT1 into the GLUT4-deficient adipocytes to assess glucose uptake. Again, siGLUT4 lentivirus reduced GLUT4 to an undetectable level (Fig. 5A
) and attenuated insulin-stimulated glucose uptake by 60% (Fig. 5B
). Electroporation of siGLUT1 reduced GLUT1 protein expression by approximately 70% (Fig. 5A
). As expected, this led to a marked decrease in basal glucose transport. We further found that GLUT1 depletion resulted in an approximately 68% reduction in insulin-stimulated glucose transport (Fig. 5B
). When GLUT1 was knocked down in the GLUT4-deficient adipocytes, insulin-stimulated glucose transport was almost completely abolished (Fig. 5B
). These data suggest that both GLUT4 and GLUT1 are of importance in the insulin-stimulated component of glucose uptake in 3T3-L1 adipocytes.
|
|
(an adipocyte differentiation marker) in GLUT4-deficient adipocytes (Fig. 4
|
| Discussion |
|---|
|
|
|---|
Recently, RNA interference has emerged as a powerful tool to assess mechanisms of intracellular signaling. As widely reported, this approach allows one to knock down (or knock out) selected gene products in a highly specific fashion (22, 23). Although this method has been applied to 3T3-L1 cells, unfortunately, once adipogenic differentiation occurs, these cells become very refractory to standard methods of transfection and only negligible efficiencies are achieved. Some successful studies have been reported using single cell microinjection (24) or electroporation of siRNAs into 3T3-L1 adipocytes (25, 26, 27), but each of these techniques has certain drawbacks. For example, microinjection can only be performed in a limited number of cells (several hundreds) so that only single cell, visual assays, can be used, precluding biochemical assays of global cell populations. Whole culture electroporation has been used in several papers (25, 26, 27), but this approach can only be used in early stage (56 d after differentiation), the electroporation process itself may have effects on cell viability or function, and the amount of siRNA needed is costly. A shortcoming common to both of these methods, and also with standard transfection, is that the target gene knockdown is transient over a period of 24 d. In this report, we have used a lentiviral vector to express specific shRNA in 3T3-L1 adipocytes. This method achieves near 100% efficiency and, importantly, because the lentivirus integrates into the cell genome, shRNA expression is permanent, leading to long-term knockdown of the targeted protein. As demonstrated in the current studies, this has important advantages when the experimental cell type manifests different stages (differentiation, cell cycle, apoptosis, etc.) with distinct cellular phenotypes. With the lenti-shRNA approach, targeted gene knockdown can be achieved at any phase of the cell cycle and maintained indefinitely.
In the current studies, we have used a lenti-shRNA vector targeted to GLUT4 to achieve a more than 90% knockdown of this protein and the effect appears permanent. Our results have led to several new insights into the role of GLUT4 in adipocyte biology and glucose transport. It is of interest that IRAP is colocalized to recycling vesicles that display high expression levels of GLUT4 and is considered a component of the GLUT4-containing vesicle. In previous studies, it has been shown that GLUT4 knockout mice demonstrate reduced levels of IRAP expression (19, 20, 21). In the current studies, we find that lentivirus-mediated introduction of GLUT4 shRNA, depending on the timing, affects IRAP expression differently. When introduced at the preadipocyte stage, GLUT4 shRNA leads to decreased IRAP expression after adipogenic differentiation. This is consistent with the KO mouse study (20, 21). However, in GLUT4 knockout mice, the IRAP expression in adipocytes was reported to be decreased in one study (21) but not in another study (19). By contrast, when introduced after the completion of adipogenesis, GLUT4 shRNA does not alter IRAP expression. This appears to dissociate the signals to impair IRAP expression, depending on the developmental stage of the cell. These results also illustrate the advantage of being able to time the deletion of a particular protein in understanding its full biological effects.
We also noted that lentivirus-mediated siGLUT4 expression in predifferentiated cells essentially abolished GLUT4 expression after differentiation in adipocytes but had no effect on the subsequent development of the fully differentiated adipocyte phenotype. However, once full differentiation occurred, GLUT4-deficient cells accumulated less lipid than the control cells, indicating some influence of GLUT4 activity on maintenance of the full lipogenic capacity of adipocytes, even though various other markers of adipocyte differentiation remained fully expressed.
Another important aspect of these studies was the relationship between GLUT4 content and overall insulin stimulated glucose transport. We found that nearly complete deletion of GLUT4 had little effect on basal glucose transport. This was to be expected given the low GLUT4 concentration at the cell surface under basal conditions. Interestingly, however, despite near complete deletion of GLUT4 protein, insulin-stimulated glucose transport was only decreased by approximately 50%. This indicated that some other glucose transport species was largely responsible for basal glucose transport and for a large component of the insulin stimulated glucose transport, which is consistent with a previous report (28). Our data strongly indicate GLUT1 as this alternate glucose transporter. Thus, we found no effect of GLUT1 knockdown on the expression of GLUT4 protein, but, nevertheless, GLUT1 contributed in an important way to both basal and insulin stimulated glucose transport. The results showed that, after siRNA-mediated knockdown of GLUT1, approximately 70% of basal glucose transport was lost. More interestingly, knockdown of GLUT1 led to a marked impairment of overall insulin-stimulated glucose transport. Furthermore, when GLUT1 was knocked down in adipocytes infected with the lentiviral GLUT4 shRNA, essentially no residual insulin-stimulated glucose transport was observed. These results lead us to conclude that GLUT1 is the major glucose transporter in 3T3-L1 adipocytes responsible for basal glucose transport, whereas both GLUT4 and GLUT1 contribute in a relatively comparable way to the overall effect of insulin to stimulate glucose transport. These studies raise questions concerning previous interpretation of many studies examining insulin stimulated glucose transport in these cells. Clearly, in future studies, both GLUT1- and GLUT4-mediated events need to be considered in interpretating overall glucose transport in insulin stimulated 3T3-L1 adipocytes. It is quite possible that, even though insulin stimulated translocation of both GLUT1 and GLUT4 appear to be phosphatidylinositol 3-kinase dependent, there may be more subtle differences in insulin signaling cascades that recruit GLUT4 vs. GLUT1 to the cell surface. This remains a question for future study.
In summary, we have used a lentiviral vector to transduce specific shRNA sequences into 3T3-L1 adipocytes. This method is highly efficient leading to near complete depletion of the target protein GLUT4. The lentiviral infection can be timed to different stages of the cell life cycle and, taken together, this method should prove useful in further studies of insulin action and adipocyte biology. In the current studies, we found that GLUT4 knockdown can lead to impaired IRAP protein expression, but this effect is dependent on whether GLUT4 is knocked down in the differentiating or differentiated stage. We also find that GLUT4 is necessary for the full lipogenic capacity of differentiated adipocytes, and importantly the data show that a relatively large component of insulin stimulated glucose transport is mediated by GLUT1.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure statement: All authors have nothing to declare.
First Published Online February 23, 2006
Abbreviations: GFP, Green fluorescent protein; IR, insulin receptor; IRAP, insulin-responsive aminopeptidase; IRS, insulin receptor substrate; PKC, protein kinase C; PPAR
, peroxisome proliferator-activated receptor-
; RFP, red fluorescent protein; shRNA, short hairpin RNA; siRNA, small interfering RNA.
Received December 22, 2005.
Accepted for publication February 10, 2006.
| References |
|---|
|
|
|---|
-q/11 protein plays a key role in insulin-induced glucose transport in 3T3-L1 adipocytes. Mol Cell Biol 19:67656774
mediate free fatty acid-induced insulin resistance in 3T3-L1 adipocytes. J Biol Chem 280:3536135371This article has been cited by other articles:
![]() |
J. Yin, Z. Gao, Q. He, D. Zhou, Z. Guo, and J. Ye Role of hypoxia in obesity-induced disorders of glucose and lipid metabolism in adipose tissue Am J Physiol Endocrinol Metab, February 1, 2009; 296(2): E333 - E342. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Hou, S. Xu, K. A. Maitland-Toolan, K. Sato, B. Jiang, Y. Ido, F. Lan, K. Walsh, M. Wierzbicki, T. J. Verbeuren, et al. SIRT1 Regulates Hepatocyte Lipid Metabolism through Activating AMP-activated Protein Kinase J. Biol. Chem., July 18, 2008; 283(29): 20015 - 20026. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Kaddai, T. Gonzalez, M. Bolla, Y. Le Marchand-Brustel, and M. Cormont The nitric oxide-donating derivative of acetylsalicylic acid, NCX 4016, stimulates glucose transport and glucose transporters translocation in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E162 - E169. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Umahara, S. Okada, E. Yamada, T. Saito, K. Ohshima, K. Hashimoto, M. Yamada, H. Shimizu, J. E. Pessin, and M. Mori Tyrosine Phosphorylation of Munc18c Regulates Platelet-Derived Growth Factor-Stimulated Glucose Transporter 4 Translocation in 3T3L1 Adipocytes Endocrinology, January 1, 2008; 149(1): 40 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kawamata, T. Imamura, J. L. Babendure, J.-C. Lu, T. Yoshizaki, and J. M. Olefsky Tumor Necrosis Factor Receptor-1 Can Function through a G{alpha}q/11-beta-Arrestin-1 Signaling Complex J. Biol. Chem., September 28, 2007; 282(39): 28549 - 28556. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Liao, M. T. A. Nguyen, T. Yoshizaki, S. Favelyukis, D. Patsouris, T. Imamura, I. M. Verma, and J. M. Olefsky Suppression of PPAR-{gamma} attenuates insulin-stimulated glucose uptake by affecting both GLUT1 and GLUT4 in 3T3-L1 adipocytes Am J Physiol Endocrinol Metab, July 1, 2007; 293(1): E219 - E227. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yu, J. Cresswell, M. G. Loffler, and J. S. Bogan The Glucose Transporter 4-regulating Protein TUG Is Essential for Highly Insulin-responsive Glucose Uptake in 3T3-L1 Adipocytes J. Biol. Chem., March 9, 2007; 282(10): 7710 - 7722. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chang, S.-H. Chiang, and A. R. Saltiel TC10{alpha} Is Required for Insulin-Stimulated Glucose Uptake in Adipocytes Endocrinology, January 1, 2007; 148(1): 27 - 33. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Williams, S. W. Hicks, C. E. Machamer, and J. E. Pessin Golgin-160 Is Required for the Golgi Membrane Sorting of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Mol. Biol. Cell, December 1, 2006; 17(12): 5346 - 5355. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gonzalez and T. E. McGraw Insulin Signaling Diverges into Akt-dependent and -independent Signals to Regulate the Recruitment/Docking and the Fusion of GLUT4 Vesicles to the Plasma Membrane Mol. Biol. Cell, October 1, 2006; 17(10): 4484 - 4493. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |