help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2005-1216
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ukropec, J.
Right arrow Articles by Kozak, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ukropec, J.
Right arrow Articles by Kozak, L. P.
Endocrinology Vol. 147, No. 5 2468-2480
Copyright © 2006 by The Endocrine Society

Leptin Is Required for Uncoupling Protein-1-Independent Thermogenesis during Cold Stress

Jozef Ukropec, Rea V. P. Anunciado, Yann Ravussin and Leslie P. Kozak

Pennington Biomedical Research Center, Louisiana State University, Baton Rouge, Louisiana 70808

Address all correspondence and requests for reprints to: Leslie P. Kozak, Pennington Biomedical Research Center, 6400 Perkins Road, Baton Rouge, Louisiana 70808. E-mail: kozaklp{at}pbrc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We investigated the role of leptin in regulating energy metabolism through induction of uncoupling protein (UCP)-1-based brown fat thermogenesis by comparing phenotypes of energy balance in ob/ob and double-mutant ob/ob.Ucp1–/– mice. Measurements of adiposity and lean body mass (nuclear magnetic resonance), energy expenditure (indirect calorimetry), body weight, food intake, and core body temperature were determined in the two mutant stocks of 3-month-old mice maintained at an initial ambient temperature of 28 C for 21 d and then at 21 C for 16 d, and finally with leptin administration for 8 d at 21 C. No phenotypic differences between ob/ob and ob/ob.Ucp1–/– mice were detected, suggesting that UCP1-based thermogenesis is not essential for the regulation of adiposity in ob/ob mice at temperatures between 21 and 28 C. Although both Ucp1–/– and ob/ob mice can survive in extreme cold at 4 C, provided they are adapted to the cold by gradually lowering ambient temperature, ob/ob.Ucp1–/– mice could not adapt and survive at temperatures lower than 12 C unless they were administered leptin. As the ambient temperature was reduced from 20 to 16 C, ob/ob.Ucp1–/– mice treated with leptin have elevated levels of circulating T3 that correlate with elevated sarcoendoplasmic reticulum Ca2+ ATPase 2a mRNA levels in gastrocnemius muscle. Furthermore, ob/ob.Ucp1–/– mice, treated with T3, were able to maintain body temperature and stimulate sarcoendoplasmic reticulum Ca2+ ATPase 2a expression when the ambient temperature was gradually reduced to 4 C. Thus, in the absence of UCP1, leptin-induced thermogenesis protects body temperature in part through its action on the thyroid hormone axis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MUTATIONS TO THE leptin and leptin receptor genes are associated with hyperphagia, increased adiposity, inability to oxidize fat, and cold intolerance. The cold-sensitive phenotype of ob/ob and db/db was reported at a time when brown adipose tissue thermogenesis had been identified as the most important mechanism for the protection of body temperature in rodents (1). It was therefore proposed that the reduced nonshivering thermogenesis of ob/ob and db/db mice was a primary defect that could also increase metabolic efficiency in the mice at normal ambient temperature and lead to obesity (2, 3). This idea was further strengthened by the finding that obese mice and rats with lesions to the hypothalamus have impaired sympathetic signaling and consequently reduced sympathetic activation of brown adipose tissue, the thermogenic component of the sympathetic nervous system (3, 4). Because evidence for reduced energy expenditure in the ob/ob mouse led to the idea that slow metabolism is a predisposing factor in the development of obesity, the increased sympathetic activity and increased brown fat mass in rats and mice fed palatable diets of high caloric density was interpreted as indicating that diet-induced thermogenesis, derived largely from brown adipose tissue, mitigated the development of obesity (5, 6). Thus, a lean phenotype in individuals might be a result, in part, from a wasting or burning off of excess calories due to an inefficient energy metabolism associated with increased energy expenditure. In the rodent this inefficiency is thought to be due to nonshivering thermogenesis of brown fat; however, in the adult human with very low brown fat, the thermogenic mechanisms are unknown.

Arguably adiposity in mice with defects in leptin signaling could involve uncoupling protein (UCP)-1-based thermogenesis. Consistent with this proposed role for brown adipose tissue in the regulation of body weight, mice that lack the three ß-adrenergic receptors are very sensitive to diet-induced obesity, are cold intolerant, and have virtually undetectable levels of UCP1 (7). However, there is evidence from studies on dopamine ß-hydroxylase mice that the obese phenotype may be due more to the extreme imbalance between {alpha}- and ß-adrenergic signaling than the lack of UCP1 (8). The observed reduction of Ucp1 expression in ob/ob mice is likely due to the secondary effects of extreme obesity, such as ß-adrenergic receptor density (9), because Ucp1 is normally induced by cold exposure in young 3-wk-old mutant ob/ob and db/db mice before severe obesity sets in (10). Furthermore, mice with reductions in brown fat or with an inactive Ucp1 gene are both cold sensitive and resistant to diet-induced obesity (11, 12). Yet the idea that reduced thermogenesis in interscapular brown fat is crucial to the obese phenotype in leptin-impaired mice and various transgenic models persists (13, 14).

To investigate more rigorously the dependence of adiposity and cold intolerance in ob/ob mice on UCP1, we constructed ob/ob.Ucp1–/– mice (i.e. a double knockout of leptin and UCP1 expression) and compared subphenotypes of energy balance with that of ob/ob mice. We found that at ambient temperatures between 21 and 28 C, all phenotypes of adiposity and energy expenditure of ob/ob.Ucp1–/– mice in the presence or absence of exogenous leptin are indistinguishable from those of ob/ob mice. Accordingly, neither obesity nor total body energy expenditure, as determined by indirect calorimetry, were dependent on UCP1-mediated thermogenesis from brown adipose tissue. On the other hand, adaptation of UCP1-deficient mice to the cold at 4 C requires an intact leptin signaling system as shown by the inability of ob/ob.Ucp1–/– mice to survive, unless they are administered leptin. We also present evidence that leptin stimulates thermogenesis to induce sarcoendoplasmic reticulum Ca2+ ATPase (SERCA) in ob/ob.Ucp1–/– mice by acting on the thyroid hormone axis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Experimental animals
Ucp1–/– mice on a C57BL/6J (B6) genetic background were generated as previously described (12, 15). B6 wild-type and B6.ob/+ mice were obtained from the Jackson Laboratory (Bar Harbor, ME). Double-mutant ob/ob.Ucp1–/– mice were generated at the Pennington Biomedical Research Center from an ob/+.Ucp1–/– intercross. Animals were raised in a specific pathogen-free barrier facility maintained with a 12-h light, 12-h dark cycle (lights on at 0600 h) and an ambient temperature of 28 C because newborn Ucp1–/– mice on an inbred genetic background do not survive at a normal ambient temperature of 23 C (15).

All experimental mice were group housed with corncob bedding at weaning and singly housed 1 wk before the start of an experiment. Mice were fed rodent chow (5053, LabDiet; PMI, Richmond, IN) ad libitum and maintained at 28 C until indicated in the experimental protocols. We previously demonstrated that body weight and composition for 2-month-old, chow-fed Ucp1–/– and wild-type mice are indistinguishable at 28 C (16). All experiments measuring the regulation of body weight and energy expenditure were performed on age-matched males. Females and nonaged matched males were tested for their ability to adapt to the cold at 4 C by reducing the ambient temperature 2–3 C/d. Animals were administered recombinant mouse leptin (1 µg/g body weight·d; R&D Systems, Inc., Minneapolis, MN) or T3 (14 ng/g body weight·d; Sigma, St. Louis, MO) in two ip injections, the first in the morning (0800–0900 h) and the second in the afternoon (1700–1800 h). The dose of leptin, delivered in two ip injections, necessary to achieve a strong response is about 3 times higher than the total dose delivered by osmotic pumps (17, 18). Upon completion of the in vivo physiological experiments, animals were killed by cervical dislocation and tissue samples collected and stored at –80 C. Serum was obtained and stored at –20 C. All animal experiments were approved by the Pennington Biomedical Research Center Institutional Animal Care and Use Committee in accordance with National Institutes of Health guidelines for the care and use of laboratory animals.

Phenotypes of energy balance
Body temperature was measured with a rectal thermoprobe (TH-8, Physitemp Instruments Inc., Clifton, NJ) and body composition was analyzed by nuclear magnetic resonance (Bruker, The Woodlands, TX). Energy expenditure was evaluated by indirect calorimetry (Oxymax; Columbus Instruments, Columbus, OH). Animals with ad libitum access to food (specified above) were singly housed in air-proof plastic metabolic cages 2 d before initiation of an experiment. Cages were connected to the oxygen (O2) and carbon dioxide (CO2) sensors and placed in an incubator enabling precise temperature control. {alpha}-Dri (Shepherd Specialty Papers Inc., Watertown, TN) was used as the nestling material during the indirect calorimetry experiment. Calibration of gas sensors and body weight corrections were performed daily. The Oxymax Flow Max system allowed 16 individually housed animals to be monitored simultaneously. Energy expenditure and respiratory exchange ratio were measured over a 60-sec period in 40-min intervals. Physical activity was measured by interruption of infrared beams that sensed movement in Y and Z directions, and data were expressed as counts per hour. For a Y count a mouse has to move more than 0.5 in. in a horizontal direction and for a Z count the mouse has to raise its body 1.5 in. above the chamber floor.

Quantitative RT-PCR
TRI-reagent and BCP phase separation reagent (Molecular Research Center Inc., Cincinnati, OH) were used for the RNA isolation. RNA was further purified by using the RNAeasy minikit and Rnase-Free-DNase set (QIAGEN, Valencia, CA). RNase protection of isolated RNA from degradation was secured with using SUPERase-In (Ambion, Austin, TX). Quantity and quality of RNA was determined by spectrophotometry and confirmed with the Agilent 2100 bioanalyzer (Agilent Technologies, Palo Alto, CA). Total RNA was reverse transcribed to single-stranded cDNA using high-capacity cDNA archive kit (Applied Biosystems, Foster City, CA). Quantitative RT-PCR was performed with the following primers: SERCA1a, forward primer, AACGCGAGGAGATGGTTCTG, reverse primer, CAACATGCCCACAACACCAA, probe, AAACGTCAGGTCCATCTCATACTCCATGAACTT; SERCA2a, forward primer, TCCAGAAGGTGTCATCGATAGGT, reverse primer, ACTCCCGAATGACAGACATAATCTT, probe, CACCCACATCCGAGTTGGAAGTACCAA; cyclophilin b, forward primer, GGTGGAGAGCACCAAGACAGA, reverse primer, GCCGGAGTCGACAATGATG, probe, ATCCTTCAGTGGCTTGTCCCGGCT. Assays-on-Demand gene expression primer and probe set for UCP3 was obtained from Applied Biosystems. Amplification of each target cDNA was performed with TaqMan universal PCR master mix and AmpErase UNG in the Applied Biosystems 7900 sequence detection system. All the gene expression data were normalized to the level of cyclophilin b.

Metabolite and hormone determinations
Blood glucose levels were determined by the OneTouch profile blood glucose meter (Lifescan Inc., Milipitas, CA). Serum insulin was measured by a rat insulin RIA kit (Linco, St. Charles, MO) and ß-hydroxybutyrate determined with Autokit 3HB (Wako Chemicals, Richmond, VA). Serum T3 and T4 levels were measured with T3 and T4 solid-phase RIA kit (Diagnostic Products Corp., Los Angeles, CA).

Statistical analysis
All the data are expressed as means ± SE. Two-way ANOVA with repeated measures or Student’s t test assessed the statistical analysis of difference between mean values (StatView, version 5.0.1; SAS Institute Inc., Cary, NC).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phenotypes of energy balance in ob/ob and ob/ob.Ucp1–/– mice at 28 C and during acclimation to 21 C
To evaluate the role of leptin in regulating energy balance through modulation of UCP1-based brown fat thermogenesis, we determined the effects of ambient temperature, first at near thermoneutrality (28 C) and then at 21 C in the presence and absence of leptin, on body composition and energy expenditure in ob/ob mice with or without a mutant Ucp1 gene. Energy balance phenotypes of mutant mice, maintained at 28 C from birth, were measured at 3 months of age and continued for 3 wk at 28 C. Body weight and fat mass increased during this period, but there was no difference between ob/ob and ob/ob.Ucp1–/– (Fig. 1Go, A and B). Lean body mass did not change during this period, and there was no difference between mutant stocks (Fig. 1CGo). There were no differences in food intake at 28 C between the double-mutant and ob/ob mice (Fig. 1DGo). Oxygen consumption and respiratory exchange ratio (RER) were measured on the last 2 d at 28 C before the reduction of ambient temperature to 21 C, and whereas oxygen consumption was similar for ob/ob and ob/ob.Ucp1–/– mice (Fig. 2Go, A and B, and Table 1Go), the RER was about 3% lower in the double mutant. This similarity in phenotypes for the two genotypes at 28 C is predictable because at temperatures near thermoneutrality the need for UCP1-based thermogenesis is minimal.


Figure 1
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 1. Changes in body weight (A) fat mass (B), and fat-free mass (C) in 3-month-old ob/ob.Ucp1–/– ({blacksquare}) and ob/ob ({circ}) mice maintained at 28 C for 21 d, 21 C for 16 d, and 21 C plus leptin treatment (1 µg·g–1·d–1) for 8 d. Data are expressed as mean ± SE for 10 ob/ob.Ucp1–/– and six ob/ob male mice. D, Daily food intake in ob/ob.Ucp1–/– ({blacksquare}) and ob/ob ({circ}) mice during cold acclimation before and after peripheral leptin administration. Data in this figure were obtained with six ob/ob.Ucp1–/– and four ob/ob male mice in a separate experiment designed as in A. Data are given as the mean ± SE.

 

Figure 2
View larger version (71K):
[in this window]
[in a new window]
 
FIG. 2. Effects of reducing ambient temperature to 21 C and treatment with a peripheral injection of leptin (1 µg·g–1·d–1) on oxygen consumption (VO2) (A), RER (B), and physical activity (C) in ob/ob.Ucp1–/– (bullet) and ob/ob ({circ}) mice. Data are expressed as an average. Gray shaded areas in the background represent the dark phase of the diurnal cycle. Repeated-measure analyses for individual animals were made to evaluate the effects of leptin on each animal independently. Six male ob/ob mice and 10 male ob/ob.Ucp1–/– mice were analyzed.

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Effects of ambient temperature on metabolic characteristics and physical activity of ob/ob and ob/ob.Ucp1–/– mice

 
We anticipated that reducing the ambient temperature to 21 C would cause differences in body weight and composition between genotypes to emerge. However, during the subsequent 17 d at 21 C, body weight, fat mass, and fat-free mass were attenuated equally in both mutant animals (Fig. 1Go, A–C). Most interesting was the 50% increase in food intake when the ambient temperature was reduced 21 C, even though the mice just before the temperature shift from 28 to 21 C were already eating twice as much as a normal mice (Fig. 1DGo). Thus, a mechanism by which food intake is stimulated by reduced ambient temperature is operating that is independent of leptin and the nutritional requirements of the animal. The absence of leptin must somehow signify the unavailability of the excess nutrient stores in these mice. Oxygen consumption increased immediately to a similar degree in both ob/ob and ob/ob.Ucp1–/– (Fig. 2AGo); however, this increased oxygen consumption was not sustained because it became similar to that observed at 28 C after an additional 15 d at 21 C (Fig. 2AGo and Table 1Go). The RER was not affected by either the ambient temperature or the presence or absence of an active Ucp1 gene (Fig. 2BGo and Table 1Go). Thus, at an ambient temperature of 21 C, when thermogenesis is necessary to maintain body temperature, there were no differences in subphenotypes of energy balance between ob/ob and ob/ob.Ucp1–/– mice.

If the action of leptin on the regulation of body weight depends on stimulation of energy expenditure through UCP1-dependent thermogenesis, then the reduction of adiposity in ob/ob.Ucp1–/– mice treated with leptin should be less than that occurring in ob/ob mice. Accordingly, with the ambient temperature maintained at 21 C, mice received daily injections of leptin for 7 d. Food intake was reduced to normal levels characteristic for wild-type B6 mice (Fig. 1DGo). Body weight, fat mass, and possibly lean mass decreased in a manner that was indistinguishable for ob/ob and ob/ob.Ucp1–/– mice (Fig. 1Go). During the first night after leptin treatment, ob/ob mice transiently showed a slightly higher level of oxygen consumption than ob/ob.Ucp1–/– mice (Fig. 2AGo); however, this difference, which did not reach statistical significance, was due to an episodic reduction in oxygen consumption in the double mutant and was no longer observed during the following 6 d of leptin treatment (Figs. 2AGo and 3AGo). A highly significant reduction in RER to approximately 0.71 was observed in both genotypes, suggesting that almost 100% of the energy requirements were provided from fat oxidation on treatment with leptin, and this shift in substrate use did not depend on the presence of a functional Ucp1 gene (Figs. 2BGo and 3Go and Table 1Go). The only obvious phenotypic difference between ob/ob and ob/ob.Ucp1–/– mice was the level of ambulatory physical activity, but this was not accompanied by an increase in oxygen consumption (Figs. 3CGo and 4Go). Rectal temperature was similar (~36.5 C) in ob/ob and ob/ob.Ucp1–/– mice and was only slightly reduced in both groups of animals during the 2 wk of acclimation to 21 C, suggesting the presence of UCP1-independent thermogenic mechanisms in ob/ob.Ucp1–/– mice (Table 2Go).


Figure 3
View larger version (21K):
[in this window]
[in a new window]
 
FIG. 3. Analysis of leptin’s effect on the 23-h oxygen consumption (VO2) (A), RER (B), and physical activity (C) in ob/ob.Ucp1–/– (bullet) and ob/ob ({circ}) mice, 1 d prior (–1) and during the 7 consecutive days of leptin treatment period (1 2 3 4 5 6 7 ). *, Significant differences between the two genotypes (t test, P < 0.05). Shaded vertical bars represent the dark period of the day cycle.

 

Figure 4
View larger version (25K):
[in this window]
[in a new window]
 
FIG. 4. Body weight (A), fat mass (B), fat-free mass (C), daily food consumption (D), and body temperature (E) in ob/ob.Ucp1–/– ({blacksquare}) and ob/ob ({circ}) mice during cold adaptation. Temperature was reduced from 21 to 4 C at a rate of 2 C/d. The ob/ob mice were maintained at 4 C for an additional 4 wk. On the other hand, ob/ob.Ucp1–/– mice were removed from the experiment when core body temperature dropped less than 30 C. Data are expressed as the mean ± SE of four ob/ob.Ucp1–/– and six ob/ob mice. Significant differences between the two genotypes are indicated by an asterisk (*).

 

View this table:
[in this window]
[in a new window]
 
TABLE 2. Effects of leptin on body temperature and circulating glucose, insulin, and ß -HB

 
Leptin normalized fasting serum glucose, insulin, and ß-hydroxybutyrate
The leptin-induced metabolic switch from glucose to fat use resulted in elevated levels of ß-hydroxybutyrate in the serum of ob/ob.Ucp1–/– mice. This was associated with a normalizing of the hyperglycemia and hyperinsulinemia associated with both ob/ob and ob/ob.Ucp1–/– genotypes (Table 2Go).

ob/ob.Ucp1–/– mice cannot acclimatize to 4 C
Leptin-deficient (ob/ob) and UCP1-deficient (Ucp1–/–) mice are able to tolerate the cold at 4 C, provided they proceed through a cold adaptation protocol (19, 20), suggesting that a thermogenic mechanism must be induced. The previous experiment (Fig. 1Go) showed that ob/ob.Ucp1–/– mice are able to tolerate an ambient temperature of 21 C over a 3-wk period during which they maintain their body weight and composition. Body temperature was reduced by 2 C, but it can be restored by treatment with leptin (Table 2Go). We next compared the ability of ob/ob.Ucp1–/– and ob/ob mice to adapt to 4 C, after acclimation at 21 C, by reducing the ambient temperature 2 C/d over an 8-d period. Figure 4Go shows that as the temperature is reduced to 8 C, body weight, fat mass, lean body mass, and body temperature were essentially maintained in ob/ob mice. Food intake of ob/ob mice increased further from that consumed at 21 C. In contrast, the double-mutant mice could not survive when the ambient temperature dropped less than 12 C. Body weight and fat-free mass declined (Fig. 4Go, A and B), but fat mass was maintained even as food intake and body temperature was reduced (Fig. 4Go, D and E). Additional groups of nine ob/ob and 19 ob/ob.Ucp1–/– mice of mixed sex and age were subsequently tested for their ability to adapt to the cold. All ob/ob mice were able to maintain a normal body temperature at 4 C, whereas all ob/ob.Ucp1–/– mice became hypothermic, some by 10 C and all by 8 C.

Leptin and T3 rescue ob/ob.Ucp1–/– mice from the cold
In the next experiment, we tested whether leptin, administered to the mice beginning at 20 C and during the subsequent days as the ambient temperature dropped, could stimulate a thermogenic mechanism that would enable ob/ob.Ucp1–/– mice to survive at a final ambient temperature of 4 C. Figure 5AGo shows that double-mutant mice receiving a daily injection of leptin beginning at 66 d of age were able to increase oxygen consumption to a level that maintained their body temperature as the ambient temperature drops less than 8 C. In the absence of leptin administration, oxygen consumption could not be increased, despite an attempt by double-mutant mice to increase fat oxidation, as evident by the lower RER (Fig. 5Go, A and B). The ability of mice to stimulate oxygen consumption with decreasing ambient temperature seems to be the most predictive indicator of the capacity of a mouse to tolerate the cold. The RER was a less useful predictor of thermogenic capacity because, irrespective of treatment, it was very similar as the temperature was reduced, i.e. until it reached 8 C when the RER suddenly dropped in untreated double ob/ob.Ucp1–/– mice. In contrast to the reduction in the RER of leptin-treated mice maintained at 21 C, which averaged about 0.75, reflecting almost pure fat oxidation (Fig. 2BGo), double-mutant mice treated with leptin during cold adaptation to 4 C had an average RER of approximately 0.87, indicating a maintenance of carbohydrate oxidation.


Figure 5
View larger version (56K):
[in this window]
[in a new window]
 
FIG. 5. Oxygen consumption (VO2) (A) and RER (B) in ob/ob.Ucp1–/– mice during cold acclimation from an ambient temperature of 20 C to 6 C in the presence of T3 (bullet), leptin ({circ}), and vehicle (control; thick black line). Data represent measurements of metabolic parameters for the 24-h period before the treatments followed by continuous measurements during the subsequent 5 d of the leptin, T3, or vehicle treatment, during which the ambient temperature was gradually lowered from 20 to 6 C. Six mice received leptin, five mice T3, and 4 mice vehicle. Shaded vertical bars represent the dark period of the day cycle.

 
Analysis of serum T3 levels of the leptin-treated mice and controls were 323 ± 11 and 186 ± 22 ng/dl, respectively, and T4 levels were 3.28 ± 0.10 and 1.97 ± 0.20 µg/dl, respectively, indicating that leptin induced the production of T3 in double-mutant mice. It is also apparent that the induction occurred at 21 and 16 C (Fig. 6Go). The lower temperature in itself increased T3 in the double-mutant mice, but it apparently was not sufficient to protect the mice from hypothermia. We have found that all strains of Ucp1–/– mice have an induction of brown adipocytes in the inguinal fat depot and a corresponding increase in type 2 deiodinase in the tissue that could provide a source for T3 production (16). However, because neither an increase in brown adipocytes was detected histologically in the double-mutant nor was an increase in type 2 deiodinase mRNA detected by quantitative RT-PCR in ob/ob.Ucp1–/– mice treated with leptin (data not shown), it is probable that leptin enhances T3 production by its action centrally on TRH neurons (21) and possibly type 1 deiodinase in liver (22).


Figure 6
View larger version (23K):
[in this window]
[in a new window]
 
FIG. 6. Serum T3 (A) and T4 (B) levels in wild-type and ob/ob.Ucp1–/– mice acclimated to 21 and 16 C. In the 21 C cold acclimation experiment, wild-type (two females, two males) and ob/ob.Ucp1–/– (three females, six males) were kept at 28 C for 1 wk after which ambient temperature was reduced by 2 C daily until 22 C. The mice were kept at 21 C for 3 d and then treated with leptin (1 µg/g·d ip in divided doses given at 0830 and 1630 h, respectively) for another 3 d. Animals were killed on d 7 at 21 C, 1–3 h after the last 0830 h leptin injection. In the 16 C-cold acclimation experiment, ob/ob.Ucp1–/– mice (eight females, two males) were kept at 28 C for 1 wk. Ambient temperature was reduced by 2 C daily until 16 C. Mice received leptin injections (1 µg/g·d ip in divided doses at 0830 and 1630 h, respectively) for 3 d, whereas ambient temperature changed from 20 C until 16 C. Animals were killed 24 h after temperature reached 16 C, 1–3 h after the last morning leptin injection. Data are expressed as means ± SEM.

 
The ability of leptin administration to stimulate energy expenditure in double-mutant mice to maintain normal body temperature during cold exposure at 5 C, together with induction of circulating thyroid hormone levels, prompted us to test whether administration of T3 by itself could protect the mice from the cold. The ob/ob.Ucp1–/– mice were exposed to the cold in the Oxymax metabolic chambers by reducing ambient temperature 3 C/d from a starting ambient temperature of 28 C. When the temperature of the chambers reached 20 C and below, T3 was administered by an ip injection in the morning and evening of each day (14 ng/g body weight·d), a dose of T3 that resulted in high physiological concentrations of T3 at 1 and 3 h after injection (1233 ± 115 and 217.9 ± 38.5 ng/dl, respectively) and a reduction in T4 to undetectable levels. The T3 levels 3 h after injection were less than those measured in the leptin treated mice (Fig. 6Go). The control animals in this experiment were ob/ob.Ucp1–/– mice treated with leptin in parallel with T3-treated mice. Remarkably, T3 was able to protect the mice from extreme cold exposure in a manner indistinguishable from leptin-treated mice. Five of six double-mutant mice treated with leptin survived the cold, and similarly five of six T3-treated mice survived the cold. As shown in Fig. 5Go, oxygen consumption increased comparably in both leptin and T3-treated mice as the temperature declined, whereas vehicle-treated mice lacked the capacity to increase oxygen consumption and, correspondingly, could not maintain body temperature. Whereas leptin was able to cause an immediate reduction in RER, about 2 d passed before a comparable shift to fat oxidation occurred in T3-treated mice (Fig. 5BGo).

If thyroid hormone is able to stimulate thermogenesis, a promising mechanism to evaluate is the SERCA. The analysis of mRNA levels in muscle of ob/ob.Ucp1–/– mice showed that SERCA2a was expressed at higher levels in red gastrocnemius muscle (oxidative type 1 fibers) than in white gastrocnemius muscle (glycolytic type 2 fibers) or quadriceps muscle (Fig. 7AGo). SERCA2a was induced by both leptin and T3 in red gastrocnemius but not in the other muscle types. Induction was greater in animals treated with T3 than with leptin (Fig. 7AGo). On the other hand, no induction of SERCA1a by either leptin or T3 was detected (Fig. 7BGo), a surprising result, given previous evidence indicating that SERCA1 was more responsive to induction by T3 than SERCA2a in type 1 skeletal muscle from rats with manipulated thyroid status (23). Ucp3 expression was measured as a control and consistent with published results (24, 25) that this gene is highly expressed in type 2 muscle fibers and is induced by T3 (Fig. 7CGo). Regression analysis of mRNA levels of SERCA2a in red gastrocnemius from leptin-treated ob/ob.Ucp1–/– mice with levels of circulating T3 and T4 showed a highly significant correlation (SERCA2a vs. T3, R = 0.951, P < 0.0001: SERCA2a vs. T4, R = 0.815, P < 0,005). We were not able to detect differences in the amount of SERCA2a protein by Western blot in ob/ob.Ucp1–/– mice treated with PBS, compared with those treated with leptin for 3 d. It is probable that 3 d was an insufficient period of time to result in a change in the amount of a protein integral to the sarcoendoplasmic membrane.


Figure 7
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 7. Gene expression of SERCA2a (A), SERCA1a (B), and UCP3 (C) was analyzed by RT-PCR in the ob/ob.Ucp1–/– mice gastrocnemius-red (Gast-Red) portion (14 females, six males), gastrocnemius-white (Gast-White) portion (14 females, five males), and quadriceps (Quad) muscle (eight females, four males). Mice were kept at 28 C for 1 wk, and then ambient temperature was reduced by 2 C daily. Mice received leptin (1 µg/g·d in divided doses at 0830 and 1630 h) from 20 C until 16 C. In the thyroid hormone experiment, mice received T3 (14 ng/g·d ip, in divided doses at 0830 and 1630 h) from 20 C until 4 C. Animals were killed 24 h after ambient temperature reached 16 C for leptin-treated mice and 4 C for T3-treated mice, 1–3 h after the last 0830 h injection. Data are expressed as means ± SEM. Values that do not share common letters are significantly different at P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
This study on energy balance and leptin in a mouse deficient in UCP1 can be considered from two perspectives: first, on the contribution of UCP1-based nonshivering thermogenesis in brown fat to the obesity phenotype of ob/ob mice and second, on the contribution of leptin to the thermogenic mechanisms that enable mice to tolerate the cold in the absence of UCP1. From the first perspective, indistinguishable adiposity and energy expenditure phenotypes of ob/ob and ob/ob.Ucp1–/– mice between 28 and 21 C suggest that the presence or absence of a functional Ucp1 gene has no effect on the body weight regulation of leptin-deficient mice. If the Ucp1 gene is a mechanism for achieving energy balance by stimulating energy expenditure in brown fat, then one would predict that as the ambient temperature is reduced ob/ob.Ucp1–/– mice would become more obese than ob/ob mice. In contrast, there was no difference in the obesity phenotypes. We previously showed that B6.Ucp1–/– were more resistant to diet-induced obesity than B6 wild-type mice in a temperature-dependent manner and hypothesized that this occurred because UCP1-deficient mice were required to use more costly thermogenic mechanisms to maintain body temperature (16). If this mechanism also applied to the obese condition in ob/ob vs. ob/ob.Ucp1–/– mice, then the latter would be less obese than the former. Because no differences were observed, one interpretation is that the postulated alternative thermogenic mechanisms are leptin dependent and would therefore be inoperative in ob/ob mice. If leptin is a significant activator of UCP1-based thermogenesis that can burn off fat from obese mice, then administration of leptin to ob/ob and ob/ob.Ucp1–/– mice at 21 C should show greater energy expenditure and enhanced loss of fat in ob/ob mice. However, the absence of differences in the reduction of food intake, adiposity, and the RER and no differences in oxygen consumption as a consequence of leptin treatment indicated that the phenotypes of energy balance for the two genotypes were essentially indistinguishable.

In conclusion, these studies show that UCP1-based brown fat thermogenesis is not a factor in determining the obesity phenotype of ob/ob mice at near-normal ambient temperatures. In addition, although leptin strongly reduced food intake and enhanced fat oxidation, as shown from RER data at normal ambient temperature, there was no evidence that it can stimulate energy expenditure as evidenced from oxygen consumption data.

In contrast to the similarity in energy balance phenotypes for ob/ob and ob/ob.Ucp1–/– mice observed at ambient temperatures between 28 and 21 C, at temperatures less than 21 C, which can threaten the survival of ob/ob mice, major differences in the phenotypes of ob/ob and ob/ob.Ucp1–/– mice become apparent. Ob/ob mice were able to adapt to the cold as evidenced by an increase in oxygen consumption and survive at 4 C, but ob/ob.Ucp1–/– mice could not stimulate oxygen consumption and correspondingly, could not survive at temperatures less than 12 C. However, upon leptin administration, oxygen consumption of ob/ob.Ucp1–/– mice increased and they mounted an adaptive thermogenic response that enabled them to survive in the cold. Mechanistically, leptin appears to increase energy expenditure in UCP1-deficient mice by novel thermogenic mechanisms, very possibly those that involve the thyroid axis and adaptive shivering-like mechanisms in skeletal muscle. In support of this, we presented preliminary evidence that leptin stimulates expression of SERCA2a, a component of a Ca2+ cycling-based thermogenic mechanism in skeletal muscle, possibly through the thyroid axis.

The peripheral target for the effects of leptin on energy expenditure has focused almost exclusively on brown adipose tissue (13, 26), which is problematic for extending the model to the human because adult humans have very low levels of brown fat (27). We have virtually no knowledge on specific mechanisms of energy expenditure in the human, and even in rodents there is conflicting evidence on the role of brown fat thermogenesis in the regulation of body weight (11, 16, 28, 29). Additionally in rodents, it is not known what alternative mechanisms to brown fat thermogenesis exist for the regulation of body weight. At the most basic level, there has been lack of agreement on whether leptin stimulates energy expenditure as estimated by indirect calorimetry (30). Although several studies have reported that ob/ob mice have reduced energy expenditure (31, 32, 33, 34, 35), variation in the experimental designs as well as the methods of data analysis has led to conflicting conclusions. As pointed out by Himms-Hagen (30), a major part of the problem has been the practice of calculating oxygen consumption as per kilogram of total body weight or body weight raised to the power of 0.7. Both calculations assume incorrectly that fat and lean body mass contribute equally to metabolic activity. Such incorrect assumptions have led to conclusions that, compared with lean controls, ob/ob mice are hypometabolic and that treatment of ob/ob mice with leptin stimulated oxygen consumption. When oxygen consumption is based on the entire mouse or lean body mass, as recommended by Himms-Hagen, leptin does not stimulate oxygen consumption, and ob/ob mutant mice do not differ from lean controls. In our study leptin did not stimulate oxygen consumption at normal ambient temperature in either ob/ob or ob/ob.Ucp1–/– double mutants. In addition, there was no difference in oxygen consumption when ob/ob mice were compared with the double mutants. Our studies are in agreement with those from the human in which leptin did not stimulate oxygen consumption in leptin-deficient individuals (36).

Whereas leptin did not stimulate oxygen consumption in ob/ob or double mutants, a strong reduction in the RER was found in both genotypes, signifying that leptin caused a shift in substrate use from carbohydrate to fat. The reduced RER in ob/ob mice treated with leptin is in agreement with results previously published by Hwa et al. (37). An increase in fat use is predicted from recent studies showing the ability of leptin treatment to stimulate fatty acid oxidation by a mechanism that is mediated by AMP kinase inhibition of acetyl coenzyme A carboxylase and removal of the inhibition of carnitine palmitoyl transferase 1 (38). When body weight is reduced in ob/ob mice by food restriction, percent body fat is still excessive like the nonrestricted animal, whereas reduction of body weight by leptin treatment selectively reduces fat mass (39). Because the absence of UCP1 did not reduce the ability of leptin to stimulate fat oxidization, as evidenced from the reductions in both body composition and respiratory quotient during leptin treatment, the target for the enhanced oxidation of the fat in the ob/ob mouse in response to leptin is clearly not brown adipose tissue. Although there is evidence that leptin acts centrally by stimulating adrenergic signaling in target tissues, including brown adipose tissue and skeletal muscle (40, 41), there is also evidence that leptin can directly stimulate both thermogenesis and fatty acid oxidation in muscle ex vivo (42, 43). Thus, the effects of leptin on regulation of body weight in ob/ob mice can largely be explained by reductions in food intake and enhanced oxidation of fat, without invoking activation of UCP1 thermogenesis in brown adipose tissue. The possibility that leptin can stimulate UCP1-independent thermogenesis for the regulation of body weight, as it seems to do for the regulation of body temperature, remains to be explored.

The lack of an effect of UCP1 deficiency on the energy balance and obese phenotypes of ob/ob mice is surprising in view of several lines of evidence: leptin administration stimulates sympathetic nerve activity to other tissues as well as brown adipose tissue (40, 41) and leptin administration increases Ucp1 expression in brown adipose tissue (33, 44, 45) and white fat depots (46). We propose that the modest increases in Ucp1 expression in brown adipocytes of nontransgenic animals after leptin administration do not increase whole-body thermogenesis sufficiently to affect body weight, even though some of the transgenic and gene knockout models of Ucp1 overexpression have effects on adiposity with comparable modest levels of Ucp1 induction (47, 48, 49, 50). An important factor to consider when interpreting phenotypic data from transgenic mice is that unlike the energetically efficient adrenergic regulation of the endogenous Ucp1 gene, the Ucp1 transgenes have been overexpressed from constitutively regulated promoters. Energy wasted from essentially unregulated UCP1 activity or nonspecific mitochondrial protein leaks (51) may be the basis for the antiobesity phenotype.

Whereas the presence or absence of Ucp1 expression has no detectable effects on regulation of body weight, food intake, adiposity, or body temperature in ob/ob mice housed at ambient temperatures between 28 and 21 C, the absence of leptin is critical for the regulation of body temperature in UCP1-deficient mice when the ambient temperature drops less than 12 C. Increased energy expenditure in response to leptin under conditions of cold and nutritional stress is predicted from other studies. It has been shown that leptin stimulates energy expenditure in 7- to 16-d-old rat pups raised at thermoneutrality and then shifted to an ambient temperature of 26 C (52). In food-restricted adult mice, maintained at a modestly low temperature (22–24 C), leptin reduces the severe drop in metabolic rate that occurs during the daily minima but not during the maxima (53). At the minima, body temperature is also reduced as part of a condition called torpor that occurs diurnally (just before the light phase) and that is accompanied by a metabolic response to energy depletion. The ability of leptin to reverse the torpor state has also been described in food restricted ob/ob mice (54). Importantly, investigating the ability of leptin to reverse torpor in marsupials that do not possess thermogenetically active brown fat, Geiser et al. (55) concluded that leptin could activate thermogenic mechanisms that are independent of brown fat-based thermogenesis. Accordingly, our results showing that leptin can increase oxygen consumption, and presumably thermogenesis, during extreme cold stress is consistent with recent concepts that leptin has a key function in survival responses in conjunction with nutritional stress (56).

The neuropeptide regulatory circuit for energy balance is based on mechanisms for activation and repression of food intake and energy expenditure that are coordinated by the central nervous system. Our understanding of the food intake mechanisms has become quite advanced; however, biochemical mechanisms of thermogenesis that can be activated to maintain a normal body composition are not known. To pursue this problem, the UCP1-deficient mouse is a useful model because it allows us to evaluate alternatives to UCP1-based thermogenesis. Using this model, Nedergaard and colleagues (20) concluded that only shivering could protect the animal from the cold and that there was no substitution of shivering by any adaptive nonshivering thermogenic process.

Shivering is considered to be an acute physiological response to protect body temperature after exposure to the cold. Normal healthy men immersed in water at a temperature of 16.7 C were able to keep normal body temperature for only 9–14 h (57). This limited capacity of humans to survive in the cold is probably due to the fact that the human depends almost exclusively on shivering for thermogenesis as the skin temperature begins to decrease (58). If 2-month-old wild-type mice, maintained at 28 C since birth, are placed in a cooler at 5 C, these mice will shiver and manage to survive in the cold indefinitely because brown fat nonshivering thermogenesis is rapidly induced within minutes of cold exposure (59). In contrast, if nonadapted UCP1-deficient mice on an inbred background are similarly exposed to the cold, they will shiver, but they will generally not survive the cold, the exception being UCP1-deficent mice on a hybrid genetic background (15). Thus, the capacity for shivering in the B6 or 129.Ucp1–/– mice is not sufficient to generate the heat necessary to protect the mouse from the cold; the basis for resistance to the cold by the F1-hybrid mice is unknown. Thus, in the absence of an active brown fat system thermogenesis in the mouse is not much different from the human.

In addition to mice with leptin and UCP1 deficiency, mice lacking the capacity to synthesize norepinephrine due to a mutation in dopamine ß-hydroxylase are cold sensitive (60), as are mice lacking the ß-adrenergic receptors (7). Additionally, mice with deficiencies in fatty acid oxidation due to the inactivation of short, medium and long chain acyl coenzyme A dehydrogenase are cold sensitive (59, 61). Together these mutant animals provided evidence for various aspects of energy metabolism that are essential to support thermogenic mechanisms to control body temperature. It is apparent that an alternative UCP1-independent thermogenic mechanism is being induced.

The ability of leptin to rescue ob/ob.Ucp1–/– mice when ambient temperatures drop less than 18 C provides new insights into alternative mechanisms of thermogenesis that will enable them to survive the cold. The leptin-treated mice responded by elevating circulating T3 levels in a manner consistent with recent results by others (62, 63, 64). Accordingly, we tested T3 itself and found that, like leptin, it was able to stimulate thermogenesis sufficiently by increasing oxygen consumption and fat oxidation to protect the mice during exposure to low temperature. The increased expression of SERCA2a in skeletal muscle of double-mutant mice points to a T3-inducible thermogenic mechanism that could be part of an adaptive thermogenic response (23, 65). The recent study by Marrif et al. (66) on defective thermoregulation in thyroid receptor-{alpha} knockout mice despite normal induction of Ucp1 expression provides additional evidence that alternative nonshivering thermogenic mechanisms could be based on muscle SERCAs (23, 67, 68).

The idea that T3 stimulates muscle thermogenesis comes from evidence of increased oxygen consumption and actual heat production in perfused limbs together with induction of SERCA activity. Ca2+ cycling from the cytoplasm to the sarcoendoplasmic reticulum (SR) through the action of SERCA and ryanodine receptors involves ATP hydrolysis. Normally Ca2+ in the SR is required for muscle contraction; however, a mechanism has been proposed for heat production in the heater organ of billfish called excitation uncoupling by which depolarization-induced Ca2+ release from the SR can trigger thermogenesis without contraction. The components for such a mechanism are present in the skeletal muscles of mammals, as evident by a condition called malignant hyperthermia. This is caused by a mutation in the ryanodine receptor gene that increases calcium-induced Ca2+ efflux from the SR to generate heat through elevated ATP turnover. A physiological regulatory mechanism by which a similar increase in Ca2+ flux could be generated in response to the thermogenic demands of a mammal has not been described. However, it is hypothesized that a similar thermogenic mechanism might be triggered by elevated levels of thyroid hormone in rabbits (69). Further studies by de Meis (68) suggested that thermogenic process might augmented by lowering the efficiency of ATP-induced Ca2+ reuptake into the SR via SERCA. However, it is important to emphasize that thyroid hormone is capable of inducing expression of many genes of energy metabolism (70) and whether SERCA has a role in maintaining body temperature in the double-mutant mice after leptin or T3 treatment, it is probably one of many mechanisms that the animal can recruit when survival is at stake.

In summary, many investigations have implicated UCP1-based nonshivering thermogenesis in the regulation of adiposity and energy expenditure as a thermogenic mechanism underlying the effects of leptin. The availability of mice carrying a targeted mutation in Ucp1 has prompted this study to compare phenotypes of adiposity and energy expenditure of ob/ob and ob/ob.Ucp1–/– mice and the role of UCP1 in leptin-mediated regulation of body weight and temperature. We have found that the presence or absence of Ucp1 expression has no detectable effects on regulation of body weight, food intake, adiposity, or body temperature in ob/ob mice housed between 28 and 21 C. Furthermore, there is no evidence that leptin stimulates energy expenditure in either ob/ob or ob/ob.Ucp1–/– mice when the ambient temperature is between 28 and 21 C. However, leptin is vital for the maintenance of normal body temperature in UCP1-deficient mice when the ambient temperature drops less than 12 C. One plausible thermogenic mechanism induced by leptin is SERCA activity in skeletal muscle, a mechanism supported by our finding that T3 is able to substitute for leptin in stimulating thermogenesis in ob/ob.Ucp1–/– mice. The evidence in this study strongly supports the idea that leptin is a regulator of UCP1-independent thermogenesis during cold stress by increasing energy expenditure; however, in these mice, under conditions of normal ambient temperature, leptin functions to control food intake and the selection of substrates for oxidation without increasing energy expenditure. This behavior of leptin in the regulation of energy expenditure in mouse is consistent with recent studies of its action in humans (71)


    Acknowledgments
 
We thank Christie Bearden, Michael Morris, Ryan Jackson, and Megan Morris for excellent technical assistance and Drs. Andrew Butler and Robert Koza for critical readings of the manuscript.


    Footnotes
 
This work was supported by National Institutes of Health Grant R01-HD08431.

Disclosure Summary: J.U., R.V.P.A., Y.R., and L.P.K. have nothing to declare.

First Published Online February 9, 2006

Abbreviations: RER, Respiratory exchange ratio; SERCA, sarcoendoplasmic reticulum Ca2+ ATPase; SR, sarcoendoplasmic reticulum; UCP, uncoupling protein.

Received September 22, 2005.

Accepted for publication January 30, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Foster DO, Frydman ML 1979 Tissue distribution of cold-induced thermogenesis in conscious warm- or cold-acclimated rats reevaluated from changes in tissue blood flow: the dominant role of brown adipose tissue in the replacement of shivering by nonshivering thermogenesis. Can J Physiol Pharmacol 57:257–270[Medline]
  2. Trayhurn P, Thurlby PL, James WPT 1977 Thermogenic defect in pre-obese ob/ob mice. Nature 266:60–62[CrossRef][Medline]
  3. Himms-Hagen J 1989 Brown adipose tissue thermogenesis and obesity. Prog Lipid Res 28:67–115[CrossRef][Medline]
  4. Bray GA, York DA 1998 The MONA LISA hypothesis in the time of leptin. Recent Prog Horm Res 53:95–117; discussion 117–118[Medline]
  5. Rothwell NJ, Stock MJ 1979 A role for brown adipose tissue in diet-induced thermogenesis. Nature 281:31–35[CrossRef][Medline]
  6. Lowell BB, Bachman ES 2003 ß-Adrenergic receptors, diet-induced thermogenesis, and obesity. J Biol Chem 278:29385–29388[Free Full Text]
  7. Bachman ES, Dhillon H, Zhang CY, Cinti S, Bianco AC, Kobilka BK, Lowell BB 2002 ß-AR signaling required for diet-induced thermogenesis and obesity resistance. Science 297:843–845[Abstract/Free Full Text]
  8. Ste Marie L, Luquet S, Curtis W, Palmiter RD 2005 Norepinephrine- and epinephrine-deficient mice gain weight normally on a high-fat diet. Obes Res 13:1518–1522[Medline]
  9. Collins S, Daniel KW, Rohlfs EM, Ramkumart V, Taylor IL, Gettys TW 1994 Impaired expression and functional activity of the ß3- and ß1-adrenergic receptors in adipose tissue of congenitally obese (C57BL/6J ob/ob) mice. Mol Endocrinol 8:518–527[Abstract/Free Full Text]
  10. Jacobsson A, Stadler U, Glotzer MA, Kozak LP 1985 Mitochondrial uncoupling protein from mouse brown fat. Molecular cloning, genetic mapping, and mRNA expression. J Biol Chem 260:16250–16254[Abstract/Free Full Text]
  11. Stefl B, Janovska A, Hodny Z, Rossmeisl M, Horakova M, Syrovy I, Bemova J, Bendlova B, Kopecky J 1998 Brown fat is essential for cold-induced thermogenesis but not for obesity resistance in aP2-Ucp mice. Am J Physiol 274:E527–E533
  12. Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME, Kozak LP 1997 Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387:90–94[CrossRef][Medline]
  13. Cannon B, Nedergaard J 2004 Brown adipose tissue: function and physiological significance. Physiol Rev 84:277–359[Abstract/Free Full Text]
  14. Wang L, Liu J, Saha P, Huang J, Chan L, Spiegelman B, Moore DD 2005 The orphan nuclear receptor SHP regulates PGC-1{alpha} expression and energy production in brown adipocytes. Cell Metab 2:227–238[CrossRef][Medline]
  15. Hofmann WE, Liu X, Bearden CM, Harper M-E, Kozak LP 2001 Effects of genetic background on thermoregulation and fatty acid-induced uncoupling of mitochondria in UCP1-deficient mice. J Biol Chem 276:12460–12465[Abstract/Free Full Text]
  16. Liu X, Rossmeisl M, McClaine J, Riachi M, Harper ME, Kozak LP 2003 Paradoxical resistance to diet-induced obesity in UCP1-deficient mice. J Clin Invest 111:399–407[CrossRef][Medline]
  17. Halaas JL, Gajiwala KS, Maffei M, Cohen SL, Chait BT, Rabinowitz D, Lallone RL, Burley SK, Friedman JM 1995 Weight-reducing effects of the plasma protein encoded by the obese gene. Science 269:543–546[Abstract/Free Full Text]
  18. Halaas JL, Boozer C, Blair-West J, Fidahusein N, Denton DA, Friedman JM 1997 Physiological response to long-term peripheral and central leptin infusion in lean and obese mice. Proc Natl Acad Sci USA 94:8878–8883[Abstract/Free Full Text]
  19. Coleman DL 1982 Thermogenesis in diabetes-obesity syndromes in mutant mice. Diabetologia 22:205–211[Medline]
  20. Golozoubova V, Hohtola E, Matthias A, Jacobsson A, Cannon B, Nedergaard J 2001 Only UCP1 can mediate adaptive nonshivering thermogenesis in the cold. FASEB J 15:2048–2050[Free Full Text]
  21. Harris M, Aschkenasi C, Elias CF, Chandrankunnel A, Nillni EA, Bjoorbaek C, Elmquist JK, Flier JS, Hollenberg AN 2001 Transcriptional regulation of the thyrotropin-releasing hormone gene by leptin and melanocortin signaling. J Clin Invest 107:111–120[Medline]
  22. Lisboa PC, Oliveira KJ, Cabanelas A, Ortiga-Carvalho TM, Pazos-Moura CC 2003 Acute cold exposure, leptin, and somatostatin analog (octreotide) modulate thyroid 5'-deiodinase activity. Am J Physiol Endocrinol Metab 284:E1172–E1176
  23. Simonides WS, Thelen MH, van der Linden CG, Muller A, van Hardeveld C 2001 Mechanism of thyroid-hormone regulated expression of the SERCA genes in skeletal muscle: implications for thermogenesis. Biosci Rep 21:139–154[CrossRef][Medline]
  24. Hesselink MK, Keizer HA, Borghouts LB, Schaart G, Kornips CF, Slieker LJ, Sloop KW, Saris WH, Schrauwen P 2001 Protein expression of UCP3 differs between human type 1, type 2a, and type 2b fibers. FASEB J 15:1071–1073[Free Full Text]
  25. Gong DW, He Y, Karas M, Reitman M 1997 Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, ß3-adrenergic agonists, and leptin. J Biol Chem 272:24129–24132[Abstract/Free Full Text]
  26. Lowell BB, Spiegelman BM 2000 Towards a molecular understanding of adaptive thermogenesis. Nature 404:652–660[Medline]
  27. Lean MEJ, James WPT 1986 Brown adipose tissues in man. In: Trayhurn P, Nicholls DG, eds. Brown adipose tissue. London: Arnold; 339–365
  28. Lowell BB, S-Susulic V, Hamann A, Lawitts JA, Himms-Hagen J, Boyer BB, Kozak LP, Flier JS 1993 Development of obesity in transgenic mice after genetic ablation of brown adipose tissue. Nature 366:740–742[CrossRef][Medline]
  29. Kozak LP, Harper ME 2000 Mitochondrial uncoupling proteins in energy expenditure. Annu Rev Nutr 20:339–363[CrossRef][Medline]
  30. Himms-Hagen J 1997 On raising energy expenditure in ob/ob mice. Science 276:1132–1133[Free Full Text]
  31. Pelleymounter MA, Cullen MJ, Baker MB, Hecht R, Winters D, Boone T, Collins F 1995 Effects of the obese gene product on body weight regulation in ob/ob mice. Science 269:540–546[Abstract/Free Full Text]
  32. Hwa JJ, Ghibaudi L, Compton D, Fawzi AB, Stroder CD 1996 Intracerebroventricular injection of leptin increases thermogenesis and mobilizes fat metabolism in ob/ob mice. Horm Metab Res 28:659–663[Medline]
  33. Scarpace PJ, Matheny M, Pollock BH, Tumer N 1997 Leptin increases uncoupling protein expression and energy expenditure. Am J Physiol 273:E226–E230
  34. Mistry AM, Swick AG, Romsos DR 1997 Leptin rapidly lowers food intake and elevates metabolic rates in lean and ob/ob mice. J Nutr 127:2065–2072[Abstract/Free Full Text]
  35. Breslow MJ, Min-Lee K, Brown DR, Chacko VP, Palmer D, Berkowitz DE 1999 Effect of leptin deficiency on metabolic rate in ob/ob mice. Am J Physiol 276:E443–E449
  36. Farooqi IS, Jebb SA, Langmack G, Lawrence E, Cheetham CH, Prentice AM, Hughes IA, McCamish MA, O’Rahilly S 1999 Effects of recombinant leptin therapy in a child with congenital leptin deficiency. N Engl J Med 341:879–884[Free Full Text]
  37. Hwa JJ, Fawzi AB, Graziano MP, Ghibaudi L, Williams P, Heek MV, Davis H, Rudinski M, Sybertz E, Strader CD 1997 Leptin increases energy expenditure and selectively promotes fat metabolism in ob/ob mice. Am J Physiol 272:R1204–R1209
  38. Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB 2002 Leptin stimulates fatty-acid oxidation by activating AMP-activated protein kinase. Nature 415:339–343[CrossRef][Medline]
  39. Levin N, Nelson C, Gurney A, Vandlen R, De Sauvage F 1996 Decreased food intake does not completely account for adiposity reduction after ob protein infusion. Proc Natl Acad Sci USA 93:1726–1730[Abstract/Free Full Text]
  40. Collins S, Kuhn CM, Petro AE, Swick AG, Chrunyk BA, Surwit RS 1996 Role of leptin in fat regulation. Nature 380:677[CrossRef][Medline]
  41. Haynes WG, Morgan DA, Walsh SA, Mark AL, Sivitz WI 1997 Receptor-mediated regional sympathetic nerve activation by leptin. J Clin Invest 100:270–278[Medline]
  42. Dulloo AG, Stock MJ, Solinas G, Boss O, Montani JP, Seydoux J 2002 Leptin directly stimulates thermogenesis in skeletal muscle. FEBS Lett 515:109–113[CrossRef][Medline]
  43. Muoio DM, Dohm GL, Fiedorek Jr FT, Tapscott EB, Coleman RA, Dohn GL 1997 Leptin directly alters lipid partitioning in skeletal muscle. Diabetes 46:1360–1363[Abstract]
  44. Scarpace PJ, Matheny M 1998 Leptin induction of UCP1 gene expression is dependent on sympathetic innervation. Am J Physiol 275:E259–E264
  45. Rouru J, Cusin I, Zakrzewska KE, Jeanrenaud B, Rohner-Jeanrenaud F 1999 Effects of intravenously infused leptin on insulin sensitivity and on the expression of uncoupling proteins in brown adipose tissue. Endocrinology 140:3688–3692[Abstract/Free Full Text]
  46. Commins SP, Watson PM, Padgett MA, Dudley A, Argyropoulos G, Gettys TW 1999 Induction of uncoupling protein expression in brown and white adipose tissue by leptin. Endocrinology 140:292–300[Abstract/Free Full Text]
  47. Kopecky J, Clarke G, Enerback S, Spiegelman B, Kozak LP 1995 Expression of the mitochondrial uncoupling protein gene from the aP2 gene promoter prevents genetic obesity. J Clin Invest 96:2914–2923[Medline]
  48. Kopecky J, Hodny Z, Rossmeisl M, Syrovy I, Kozak LP 1996 Reduction of dietary obesity in aP2-Ucp transgenic mice: physiology and adipose tissue distribution. Am J Physiol 270:E768–E775
  49. Cummings DE, Brandon EP, Planas JV, Motamed K, Idzerda RL, McKnight GS 1996 Genetically lean mice result from targeted disruption of the RII ß subunit of protein kinase A. Nature 382:622–626[CrossRef][Medline]
  50. Li B, Nolte LA, Ju JS, Han DH, Coleman T, Holloszy JO, Semenkovich CF 2000 Skeletal muscle respiratory uncoupling prevents diet-induced obesity and insulin resistance in mice. Nat Med 6:1115–1120[CrossRef][Medline]
  51. Harper JA, Stuart JA, Jekabsons MB, Roussel D, Brindle KM, Dickinson K, Jones RB, Brand MD 2002 Artifactual uncoupling by uncoupling protein 3 in yeast mitochondria at the concentrations found in mouse and rat skeletal-muscle mitochondria. Biochem J 361:49–56[CrossRef][Medline]
  52. Stehling O, Doring H, Nuesslein-Hildesheim B, Olbort M, Schmidt I 1997 Leptin does not reduce body fat content but augments cold defense abilities in thermoneutrally reared rat pups. Pflugers Arch 434:694–697[CrossRef][Medline]
  53. Doring H, Schwarzer K, Nuesslein-Hildesheim B, Schmidt I 1998 Leptin selectively increases energy expenditure of food-restricted lean mice. Int J Obes Relat Metab Disord 22:83–88[CrossRef][Medline]
  54. Gavrilova O, Leon LR, Marcus-Samuels B, Mason MM, Castle AL, Refetoff S, Vinson C, Reitman ML 1999 Torpor in mice is induced by both leptin-dependent and -independent mechanisms. Proc Natl Acad Sci USA 96:14623–14628[Abstract/Free Full Text]
  55. Geiser F, Kortner G, Schmidt I 1998 Leptin increases energy expenditure of a marsupial by inhibition of daily torpor. Am J Physiol 275:R1627–R1632
  56. Dagon Y, Avraham Y, Magen I, Gertler A, Ben-Hur T, Berry EM 2005 Nutritional status, cognition and survival-a new role for leptin and AMPK. J Biol Chem 280:42142–42148[Abstract/Free Full Text]
  57. Xu X, Tikuisis P, Gonzalez R, Giesbrecht G 2005 Thermoregulatory model for prediction of long-term cold exposure. Comput Biol Med 35:287–298[CrossRef][Medline]
  58. Tikuisis P, Bell DG, Jacobs I 1991 Shivering onset, metabolic response, and convective heat transfer during cold air exposure. J Appl Physiol 70:1996–2002[Abstract/Free Full Text]
  59. Guerra C, Koza RA, Walsh K, Kurtz DM, Wood PA, Kozak LP 1998 Abnormal nonshivering thermogenesis in mice with inherited defects of fatty acid oxidation. J Clin Invest 102:1724–1731[Medline]
  60. Thomas SA, Palmiter RD 1997 Thermoregulatory and metabolic phenotypes of mice lacking noradrenaline and adrenaline. Nature 387:94–97[CrossRef][Medline]
  61. Kurtz DM, Rinaldo P, Rhead WJ, Tian L, Millington DS, Vockley J, Hamm DA, Brix AE, Lindsey JR, Pinkert CA, O’Brien WE, Wood PA 1998 Targeted disruption of mouse long-chain acyl-CoA dehydrogenase gene reveals crucial roles for fatty acid oxidation. Proc Natl Acad Sci USA 95:15592–15597[Abstract/Free Full Text]
  62. Cettour-Rose P, Burger AG, Meier CA, Visser TJ, Rohner-Jeanrenaud F 2002 Central stimulatory effect of leptin on T3 production is mediated by brown adipose tissue type II deiodinase. Am J Physiol Endocrinol Metab 283:E980–E987
  63. Cettour-Rose P, Theander-Carrillo C, Asensio C, Klein M, Visser TJ, Burger AG, Meier CA, Rohner-Jeanrenaud F 2005 Hypothyroidism in rats decreases peripheral glucose utilisation, a defect partially corrected by central leptin infusion. Diabetologia 48:624–633[CrossRef][Medline]
  64. Vettor R 2005 The metabolic actions of thyroid hormone and leptin: a mandatory interplay or not? Diabetologia 48:621–623[CrossRef][Medline]
  65. Simonides WS, Brent GA, Thelen MH, van der Linden CG, Larsen PR, van Hardeveld C 1996 Characterization of the promoter of the rat sarcoplasmic endoplasmic reticulum Ca2+-ATPase 1 gene and analysis of thyroid hormone responsiveness. J Biol Chem 271:32048–32056[Abstract/Free Full Text]
  66. Marrif H, Schifman A, Stepanyan Z, Gillis MA, Calderone A, Weiss RE, Samarut J, Silva JE 2005 Temperature homeostasis in transgenic mice lacking thyroid hormone receptor-{alpha} gene products. Endocrinology 146:2872–2884[Abstract/Free Full Text]
  67. Block BA 1994 Thermogenesis in muscle. Ann Rev Physiol 56:535–577[CrossRef][Medline]
  68. de Meis L 2002 Ca2+-ATPases (SERCA): energy transduction and heat production in transport ATPases. J Membr Biol 188:1–9[CrossRef][Medline]
  69. Arruda AP, Da-Silva WS, Carvalho DP, De Meis L 2003 Hyperthyroidism increases the uncoupled ATPase activity and heat production by the sarcoplasmic reticulum Ca2+-ATPase. Biochem J 375:753–760[CrossRef][Medline]
  70. Silva JE 1995 Thyroid hormone control of thermogenesis and energy balance. Thyroid 5:481–492[Medline]
  71. Hukshorn CJ, Saris WH 2004 Leptin and energy expenditure. Curr Opin Clin Nutr Metab Care 7:629–633[CrossRef][Medline]



This article has been cited by other articles:


Home page
EndocrinologyHome page
A. P. Arruda, L. A. Ketzer, M. Nigro, A. Galina, D. P. Carvalho, and L. de Meis
Cold Tolerance in Hypothyroid Rabbits: Role of Skeletal Muscle Mitochondria and Sarcoplasmic Reticulum Ca2+ ATPase Isoform 1 Heat Production
Endocrinology, December 1, 2008; 149(12): 6262 - 6271.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. A. Adams, S. L. Gray, E. R. Isaac, A. C. Bianco, A. J. Vidal-Puig, and N. M. Sherwood
Feeding and Metabolism in Mice Lacking Pituitary Adenylate Cyclase-Activating Polypeptide
Endocrinology, April 1, 2008; 149(4): 1571 - 1580.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. A. Henry, F. R. Dunshea, M. Gould, and I. J. Clarke
Profiling Postprandial Thermogenesis in Muscle and Fat of Sheep and the Central Effect of Leptin Administration
Endocrinology, April 1, 2008; 149(4): 2019 - 2026.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. B. Jakus, A. Sandor, T. Janaky, and V. Farkas
Cooperation between BAT and WAT of rats in thermogenesis in response to cold, and the mechanism of glycogen accumulation in BAT during reacclimation
J. Lipid Res., February 1, 2008; 49(2): 332 - 339.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
S C P Dutra, E G Moura, A L Rodrigues, P C Lisboa, I Bonomo, F P Toste, and M C F Passos
Cold exposure restores the decrease in leptin receptors (OB-Rb) caused by neonatal leptin treatment in 30-day-old rats
J. Endocrinol., November 1, 2007; 195(2): 351 - 358.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ukropec, R. P. Anunciado, Y. Ravussin, M. W. Hulver, and L. P. Kozak
UCP1-independent Thermogenesis in White Adipose Tissue of Cold-acclimated Ucp1-/- Mice
J. Biol. Chem., October 20, 2006; 281(42): 31894 - 31908.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ukropec, J.
Right arrow Articles by Kozak, L. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ukropec, J.
Right arrow Articles by Kozak, L. P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals