Endocrinology, doi:10.1210/en.2005-1404
Endocrinology Vol. 147, No. 5 2557-2566
Copyright © 2006 by The Endocrine Society
Activation of p70S6K Induces Expression of Matrix Metalloproteinase 9 Associated with Hepatocyte Growth Factor-Mediated Invasion in Human Ovarian Cancer Cells
Hong Y. Zhou and
Alice S. T. Wong
Department of Zoology, The University of Hong Kong, Hong Kong, China
Address all correspondence and requests for reprints to: Dr. Alice S. T. Wong, University of Hong Kong, Department of Zoology, 4S-14 Kadoorie Biological Sciences Building, Pokfulam Road, Hong Kong, China. E-mail: awong1{at}hku.hk.
 |
Abstract
|
|---|
The expression of hepatocyte growth factor (HGF) receptor, encoded by the Met oncogene, is elevated in ovarian and a variety of cancers. Here we show that human ovarian cancer cells with high Met expression were more sensitive to the cell motility and invasion effect of HGF. Met down-regulation by small interfering RNAs or K252a resulted in reduced migration in response to HGF. The invasive/migratory phenotype activated by HGF can be blocked by specific inhibitors of the phosphatidylinositol-3-kinase (PI3K) cascade, inhibitor of p70S6K, and also the expression of a dominant-negative Akt, demonstrating that HGF transmits the motogenic signal through PI3K and Akt to p70S6K. A significant role for p70S6K in cell invasion is further supported by the observation that expression of constitutively active forms of p70S6K is sufficient to induce invasive and migratory phenotypes in ovarian cancer cells. Importantly, activation of p70S6K stimulated expression and proteolytic activity of matrix metalloproteinase (MMP)-9 and cellular invasion, whereas it had little effect on MMP-2, suggesting for the first time that MMP-9 up-regulation by p70S6K as a key step for HGF-induced invasion and migration. These data suggest that interfering p70S6K may provide a novel means of controlling tumor cell invasiveness.
 |
Introduction
|
|---|
OVARIAN CANCER has the highest mortality rate among all gynecological malignancies in the Western world. This is in part due to the fact that most (60%) of patients are diagnosed with already advanced disease. The aggressive behavior of ovarian carcinoma cells to exfoliate and disseminate into the peritoneal cavity lead to a poor clinical outcome (1). Thus, a better understanding of mechanisms by which ovarian cancers exhibit highly invasive and metastatic potential is needed for development of therapeutic intervention.
Hepatocyte growth factor (HGF) is a stromal-derived factor that activates motogenesis on various types of carcinoma cells, leading cells to dissociate, scatter, and invade into extracellular matrices (2). HGF plays a pivotal role in stimulating growth and invasiveness of ovarian cancer cells (3, 4). Blocking the HGF effects by using antibodies or the antagonist NK4 can limit ovarian tumor cell invasion and metastasis (5, 6). High levels of HGF are found in ovarian cancer ascitic fluids and fluid of benign and malignant ovarian cysts (5, 7). In addition, the Met tyrosine kinase, the high-affinity receptor for HGF, is frequently overexpressed in ovarian carcinomas (8, 9), which further suggests that ovarian cancer could progress and metastasize through activation of the HGF-Met system.
Although the involvement and importance of Met in ovarian carcinomas have been clearly established, the molecular mechanisms by which HGF affect the progression of ovarian carcinomas remain elusive. The phosphatidylinositol 3-kinase (PI3K) signaling has previously been shown to play a crucial role in cytoskeletal rearrangement and subsequent cell motility by HGF (10, 11, 12, 13). The serine/threonine kinase Akt is the best-known downstream target of PI3K. Several lines of evidence have indicated the important function of Akt signal cascade in tissue invasion/metastasis. However, the mechanism(s) involved is not well understood.
We and others (4, 5) have previously identified HGF as a regulator of ovarian invasion and cell migration. In the present study, we further demonstrate that the availability of Met receptor modifies ovarian cancer cell response to HGF. We have also identified a potential novel mechanism for HGF-induced invasion and migration, which is mediated by p70S6K through regulation of matrix metalloproteinase (MMP) in response to PI3K/Akt signaling.
 |
Materials and Methods
|
|---|
Constructs, antibodies, and biochemical products
Recombinant human HGF and anti-HGF neutralizing antibody were purchased from R&D Systems, Inc. (Minneapolis, MN). PD98059, GF109203X, LY294002, wortmannin, rapamycin, K252a, MMP-9 inhibitor (SB-CT3), anti-MMP-9 antibody, and p-aminophenylmercuric acetate(APMA) were purchased from Calbiochem (San Diego, CA). Anti-tissue inhibitor of metalloproteinase (TIMP)-1, anti-TIMP-2, human MMP-2, and MMP-9 standards were from Chemicon International, Inc. (Temecula, CA). Anti-Met (25H2), the polyclonal phospho-specific antibodies to Akt (Ser473), p70S6K (Thr389), polyclonal anti-Akt, and p70S6K were purchased from Cell Signaling, Inc. (Austin, TX). Small interfering (si) RNA duplex oligo (Genome Center, Hong Kong University) targeting Met mRNA (14) or nonspecific RNAs with point-mutated bases as negative controls were produced using the pSilencer 1.0-U6 expression vector (Ambion, Austin, TX) according to the manufacturers instructions. The pRS2-containing human Met cDNA was kindly provided by Dr. Vande Woude (Van Andel Research Institute, Grand Rapids, MI) (15). Dominant-negative mutant of human Akt1 (DN-Akt) was obtained from Upstate Biotechnology (Lake Placid, NY). The cytomegalovirus plasmids expressing myc-tagged p70S6K
N54
C104 and D3E-E389 have been described elsewhere (16). The MMP-9 promoter plasmid was obtained from Dr. Douglas Boyd (M. D. Anderson Cancer Center, Houston, TX).
Cell culture and transfections
SKOV-3, CaOV-3, and OVCAR-3 were grown in 1:1 media 199-MCDB105 supplemented with 100 U/ml penicillin, 100 µg/ml streptomycin, and 5% fetal bovine serum. Cultures were maintained at 37 C in a humidified incubator containing 95% room air-5% CO2 atmosphere. For HGF stimulation, the culture medium was replaced by fresh medium containing 5% serum and 10 ng/ml HGF.
To express cDNA constructs, cells were grown on 35-mm dishes and transfected 1.5 µg of plasmid DNA using Lipofectamine reagent (Life Technologies, Inc., Gaithersburg, MD) according to the manufacturers instructions. Twenty-four hours later, the cells were collected for Western blotting or scattering assay. Cells transfected with siRNA duplex oligos were incubated for 72 h before Met levels determination or scattering assay.
Semiquantitative RT-PCR
Total RNA was extracted by the Trizol reagent, and reverse transcription was performed using the SuperScript II kit (Invitrogen, Carlsbad, CA) following the manufacturers instruction. One microliter of the reverse transcription products was amplified in a 15-µl PCR mixture containing 1x PCR buffer, 5 mM MgCl2, 0.67 mM deoxynucleotide triphosphates, and 1 U of DNA Taq polymerase, with 0.2 pmol of each set of oligonucleotide primers for Met (17) or MMP-2 (5'GGCCCTGTCACTCCTGAGAT3' and 5'GGCATCCAGGTTATGGGGGA3'), MMP-9 (5'CAACATCACCTATTGGATCC3' and 5'CGGGTGTAGAGTCTCTCGCT3'), TIMP-1 (5' CTGGCTTCTGGCATCCTGTTG3' and 5'AACTCCTCGCTGCGGTTCTG3'), or TIMP-2 (5'GCGGTCAGTGAGAAGGAAGTGG3' and 5'CTTGCACTCGCAGCCCATCTG3'). Semiquantitative RT-PCR was conducted using the housekeeping gene ß-actin as an internal standard. The number of amplification cycles during which PCR product formation was limited by template concentration was determined in pilot experiments. After amplification, the PCR products were analyzed on a 1% agarose gel.
Western blot analysis
Briefly, whole-cell lysates were boiled for 3 min in SDS sample buffer, subjected to SDS-PAGE, and transferred to nitrocellulose. Immunoblotting was performed with anti-phospho-Akt (1:1000), anti-phospho-p70S6K (1:1000), or polyclonal anti-Akt (1:1000) and p70S6K (1:1000), using the enhanced chemiluminescence system (Amersham Pharmacia Biotech, Piscataway, NJ) for detection. The density of the bands was quantified by densitometric analysis using an Image Tool (version 3.0) system.
Cell-scattering assay
The scattering assay was performed as described by Stoker et al. (18). Approximately 3000 cells/well were plated in 24-well plates in medium supplemented with 5% fetal bovine serum. After 5 d, small, cohesive, and discrete colonies were formed and then treated with 10 ng/ml HGF in the presence or absence of various inhibitors. Twenty-four hours later, cells were washed in PBS, fixed in methanol, and stained by crystal violet (Sigma, St. Louis, MO). Scattered colonies were judged by a typical change in morphology, characterized by cell-cell dissociation and the acquisition of a migratory, fibroblast-like phenotype. Scattering activity was measured in the total number of scattered colonies from 50 colonies under a light microscope.
Cell invasion assay
The invasion assay was performed in Boyden chambers essentially as reported previously (14). Filters (8-µm pore size) were coated with 50 µl Matrigel (BD BioSciences, Palo Alto, CA) and dried under a hood according to the manufacturers instructions. A total of 1 x 105 cells/well were seeded onto the Matrigel-coated wells and incubated in serum-free medium with 10 ng/ml HGF for 24 h. Noninvading cells were removed from the top of the wells with a moistened cotton swab. Cells that penetrated the membrane were fixed with ice-cold methanol and stained with 0.5% crystal violet. Results are presented as the mean cell number of five fields ± SD of triplicate filters.
Promoter assay
Cells were transiently cotransfected with 1 µg of the MMP-9 reporter plasmid and 0.2 µg of ß-galactosidase (ß-gal) gene plasmid using Lipofectamine. Six hours after transfection, cells were treated with or without 10 ng/ml HGF for an additional 24 h. Cell lysates were processed for luciferase assay (Promega, Madison, WI). Luciferase activity was normalized with the ß-gal activity in cell lysates.
Gelatin zymography
Aliquots (80 µg) of cell-conditioned media were loaded on SDS-PAGE gels containing 0.1% gelatin under nonreducing conditions. The gels were incubated overnight at 37 C in the developing buffer containing 50 mM Tris-HCl and 20 mM CaCl2 (pH 7.4). The proteinase activity was visualized by staining the gel with 0.5% Coomassie Brilliant Blue R-250 in 30% (vol/vol) methanol/10% (vol/vol) acetic acid for 6 h and, subsequently, destaining of the gel until bands became clear. APMA-activated human MMP-2 and MMP-9 standards were included as positive controls.
Statistical analysis
All experiments were performed in duplicates and repeated at least two to three times with each experiment yielding essentially identical results. Data were expressed as mean ± SD. Statistical comparisons of control group with treated groups were carried out using the paired-sample t test. Comparisons among three or more groups were made by one-way ANOVA followed by Tukeys least significant difference t test for post hoc analysis (GraphPad Software, San Diego, CA). P < 0.05 was considered statistically significant.
 |
Results
|
|---|
HGF induces cell motility in SKOV-3 and CaOV-3
The ovarian cancer cell lines SKOV-3, CaOV-3, and OVCAR-3, representatives of common serous adenocarcinomas, which express Met and respond to HGF by phosphorylation of the Met receptor, were studied (19). We used a scattering assay, the most classic and simple assay, to investigate the activities of HGF on cell motility (18). As shown in Fig. 1A
, all three lines formed discrete, compact colonies in the absence of HGF. HGF induced a typical change in morphology of SKOV-3 and CaOV-3, as revealed by loss of cell-cell contact and spindle-shaped or fibroblastic cell morphology, suggesting enhanced spreading and migration capacity, compared with untreated controls. In contrast, similar treatment of HGF had no effect on OVCAR-3.

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 1. Scattering of ovarian cancer cells in response to HGF. A, SKOV-3, CaOV-3, and OVCAR-3 cells were untreated or treated with 10 ng/ml HGF for 24 h. The effect on cell scattering was determined by microscopic evaluation and photography. Bar, 100 µm. B, Met expression in SKOV-3, CaOV-3, and OVCAR-3 were compared by semiquantitative RT-PCR and immunoblotting. C, Cells were transfected with Met-siRNA or NS-siRNA oligos, incubated for 72 h, and then Met expression was analyzed by immunoblotting. In parallel experiments, the transfectants were subjected to scattering assay in the presence of HGF. Cells were also incubated untreated or treated with 10 ng/ml HGF, in either the presence or absence of 50 nM K252a. The asterisk indicates significant difference from HGF alone with P < 0.001. D, Cells were transfected with the empty vector (control) or containing human Met cDNA. After 24 h, cells were analyzed for Met expression by immunoblotting or subjected to scattering assay. Scattered colonies were scored, and the histogram summarizes the mean percentage of scattering activity from three experiments performed in duplicate. The mean and SD are shown.
|
|
High level of Met is required for the induction of cell motility response
Figure 1B
shows that SKOV-3 and CaOV-3 expressed significantly higher levels of Met mRNA and protein than OVCAR-3. To further strengthen the idea that the high levels of Met receptor expression are responsible for the observed motile phenotype, we knocked down Met expression by siRNA with specific oligonucleotides shown previously to deplete Met (14). Treatment of cells with Met-siRNAs, but not nonspecific (NS)-siRNAs, resulted in a significant decrease in Met expression (Fig. 1C
, left panel). Importantly, Met-siRNAs suppressed more than 80% of the cell motility response induced by HGF in both SKOV-3 and CaOV-3 carcinoma cell lines (P < 0.001), whereas NS-siRNAs did not (Fig. 1C
, right panel). Pretreatment of cells with K252a, a chemical inhibitor that suppressed Met kinase activity and the signal downstream of Met activation (20), had a similar effect (Fig. 1C
). To investigate a possible direct cause effect of increasing Met expression on induction of cell motile response, we overexpressed Met in OVCAR-3 and tested whether this was sufficient to induce cell scattering. Overexpression of Met was confirmed by Western blot analysis (Fig. 1D
, left panel). Consistent with our biochemical data, Met-transfected OVCAR-3 cells showed an increased scattering in response to HGF stimulation. In empty vector-transfected control cells, HGF had no effect (Fig. 1D
, right panel).
PI3K inhibition decreases cell scattering
To investigate the influence of PI3K-Akt activation on scattering of HGF-treated cells, we used the pharmacological agents LY294002 and wortmannin, which act as specific inhibitors of PI3K activity. Pretreatment of cells with either 25 µM LY294002 (SKOV-3,
96% inhibition; CaOV-3,
87.5% inhibition) or 200 nM wortmannin (SKOV-3,
68.4% inhibition; CaOV-3,
73.5% inhibition) (P < 0.001) significantly reduced HGF-induced cell scattering (data not shown).
To confirm p70S6K is a downstream molecule of Akt that mediates cell motility, the effects of expressing DN-Akt (kinase-dead) on cell scattering as well as p70S6K biochemical activity were studied. Cells transfected by vector alone were used as a control. Specific inactivation of Akt in DN-Akt transfectants was confirmed by immunoblot analysis (Fig. 2A
). Expression of DN-Akt prevented the phosphorylation of p70S6K and decreased HGF-induced cell scattering, which could be reversed by expression of active forms of p70S6K (
N54
C104 and D3E-E389) in the cells, demonstrating that HGF transmits a motogenic signal through Akt to p70S6K (Fig. 2B
).
Role of rapamycin-sensitive in the regulation of the motility response of SKOV-3 and CaOV-3
To verify the role of p70S6K in cell motility, we expressed constitutively active variants of p70S6K (
N54
C104 and D3E-E389) (16) and tested whether this was sufficient to induce cell scattering. As shown in Fig. 3
, expression of
N54
C104 and D3E-E389 closely reproduced the motile response of HGF and stimulated scattering to HGF-dependent levels, even in the absence of HGF stimulation. In contrast, cells not expressing the active form of p70S6K retained the flat, polygonal morphology (data not shown). This result indicates that the p70S6K is sufficient to induce cell dispersion and migration in SKOV-3 and CaOV-3 cells. Preincubation with 20 nM rapamycin, a specific inhibitor of p70S6K activation by inhibition of its activator FKBP12-rapamycin-associated protein/mammalian target of rapamycin (mTOR), before HGF stimulation resulted in approximately 80% inhibition of cell scattering in SKOV-3 and CaOV-3 cells (P < 0.001) (Fig. 3B
), demonstrating that activation of p70S6K is necessary for HGF-induced motile response.
Although MAPKs can phosphorylate p70S6K in vitro (21) and protein kinase C (PKC) has been linked to p70S6K phosphorylation and activity (22), no decrease in phosphorylation of p70S6K was found in SKOV-3 and CaOV-3 cells after treatment with MAPK inhibitor PD98059 or pan-PKC inhibitor GF109203X (data not shown), indicating that mTOR, but not ERK1/2 and PKC activity, was required for HGF to phosphorylate and activate p70S6K in these cells.
The migratory phenotype is MMP-9 dependent
We then set out to characterize further the mechanism of HGF-mediated cell migratory and invasive phenotype by looking at the involvement of MMP-2, MMP-9, TIMP-1, and TIMP-2 during this process. MMP-2 is the predominant gelatinolytic enzyme expressed by ovarian cancer cells (23), and increased expression of both MMP-2 and MMP-9 in human ovarian cancer cells is directly associated with their invasive and metastatic potentials and poor prognosis of the disease (24, 25). As shown in Fig. 4
, the expression and activity of MMP-2 was not significantly altered by HGF, nor did it affect the expression of TIMP-2. In contrast to MMP-2, both expression and proteolytic activity of MMP-9 was found to be dramatically elevated after HGF treatment. There was, however, no change in protein and mRNA levels for TIMP-1.

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 4. HGF induces MMP-9 expression and proteolytic activity. A, Total RNA was extracted and RT-PCR was performed using sequence-specific primers to MMP-2, MMP-9, TIMP-1, and TIMP-2 in the absence or presence of 10 ng/ml HGF for 24 h. Total cell lysates were analyzed by Western blotting with anti-MMP-2, anti-MMP-9, anti-TIMP-1, and anti-TIMP-2 antibodies. ß-Actin was included as an internal control. The signal intensity of MMP-9 mRNA and protein was determined by densitometry, and the amount was normalized for the amount of ß-actin present. B, Conditioned media were collected and subjected to gelatin zymography. Migration of the MMP-9 and MMP-2 gelatinase activities as determined from protein standards are indicated by arrows. APMA converted pro-MMP-9 to active MMP-9, and similarly, pro-MMP-2 to active MMP-2.
|
|
To analyze possible signal transduction pathways involved in HGF-dependent up-regulation of MMP-9 mRNA modulation, SKOV-3 cells treated with or without HGF were incubated for 24 h in the presence or absence of inhibitors of various kinases and cDNA constructs (vide infra), and the expression of MMP-9 mRNA was determined by RT-PCR. As shown, Met inhibition by siRNA, and also p70S6K inhibition by rapamycin effectively inhibited HGF-dependent MMP-9 expression (Fig. 5A
) and activity (Fig. 5B
). On the other hand, expression of active forms of p70S6K
N54
C104 (data not shown) and D3E-E389 was sufficient to induce MMP-9 activity (Fig. 5B
) and expression (within 6 h) (Fig. 5C
) to HGF-dependent levels, indicating a role for p70S6K to regulate MMP-9. We showed that p70S6K-induced up-regulation of MMP-9 mRNA expression could be blocked by actinomycin D, an inhibitor of transcription. Cycloheximide did not affect the expression of MMP-9 mRNA induced by D3E-E389 expression (Fig. 5D
), suggesting that p70S6K regulation on MMP-9 gene transcription does not require de novo protein synthesis. Figure 5E
demonstrates that up-regulation of expression of MMP-9 gene was not a result of HGF-mediated stabilization of mRNA. In addition, we showed that p70S6K-induced epithelial cell scattering could be blocked by actinomycin D, suggesting that p70S6K-regulated gene expression is essential to the migratory response (Fig. 5F
).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 5. p70S6K induces MMP-9 expression. A, Cells were treated with or without 10 ng/ml HGF in the presence or absence of expression of Met-siRNA, N54 C104 ( N C) or D3E-E389, or 20 nM rapamycin (Rp). B, Cells were treated with 20 nM rapamycin (Rp) in the presence or absence of 10 ng/ml HGF or transfected with plasmids encoding D3E-E389. Conditioned media were collected and subjected to gelatin zymography. C, Time course of MMP-9 induction by expression of D3E-E389. Total RNA was extracted and RT-PCR was performed using sequence-specific primers to MMP-9. D, Cells were preincubated with actinomycin D (ActD) (4 µg/ml) or cycloheximide (CHX) (4 µg/ml) for 4 h before transfection with D3E-E389. E, Cells pretreated with HGF for 12 h were incubated with ActD over a time course of 1, 3, and 6 h. The MMP-9 mRNA levels before addition of ActD were set to be 100%. F, Cell scattering assay was performed. Scattered colonies were scored, and the histograms summarize the mean percentage of scattering activity from triplicate determination. The means and SD are shown.
|
|
The transcriptional activation of the MMP-9 gene was confirmed by promoter luciferase reporter assay. Consistent with the above result, we found a approximately 2-fold increase in MMP-9 promoter activity in HGF-treated cells relative to control cells (P < 0.05). Expression of active forms of p70S6K (
N54
C104 and D3E-E389) was able to increase the transcriptional activity of MMP-9 promoter (2- to 3-fold) (P < 0.05), whereas inhibition of p70S6K by rapamycin abolished the positive effect of HGF on MMP-9 activation (Fig. 6
).
We next determined whether MMP-9 activity might play a function role in HGF-induced cell motility. Addition of SB-3CT that selectively inhibits MMP-9 at high concentration (10 µM) or an anti-MMP-9-neutralizing antibody (10 µg/ml) resulted in more than 50 and 90% decrease in HGF-mediated cell scattering, respectively (Fig. 7
). Inhibitor alone had no effect, indicating that the inhibition of motility was not because of a cytotoxic effect of the inhibitor (data not shown). The MMP-9-mediated effect was specific because addition of MMP-2 inhibitor (OA-Hy) or other more general protease inhibitors (e.g. leupeptin, pepstatin A) did not inhibit HGF-induced cell motility (data not shown), suggesting a functional role of MMP-9 induction during the migratory response.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 7. Inhibition of HGF and p70S6K-induced cell scattering by MMP-9 inhibitor and MMP-9 neutralizing antibody. A, SKOV-3 and CaOV-3 cells were treated without or with 10 ng/ml HGF in the absence or presence of 10 µM SB-3CT, an inhibitor of MMP-9 activity, or 10 µg/ml MMP-9 neutralizing antibody for 24 h. Scattered colonies were scored, and the histograms summarize the mean percentage of scattering activity from triplicate determination. The means and SD are shown. The asterisks indicate significant difference for SB-3CT and anti-MMP-9 treated samples, compared with HGF alone, *, P < 0.05; **, P < 0.001.
|
|
Because MMP-9 is involved in tumor invasion, particularly through basement membrane components, we tested the capacity of SKOV-3 and CaOV-3 cells to pass through a Matrigel barrier in a modified Boyden chamber assay. HGF significantly increased the invasion of ovarian cancer cells. By contrast, inhibitors of PI3K and p70S6K or blocking antibodies directed to MMP-9 reversed HGF-induced invasiveness, whereas
N54
C104 and D3E-E389-expressing cells invaded through Matrigel to the similar level of HGF treatment, indicating that MMP-9 is an effector for HGF/PI3K/p70S6K-dependent increases in cell invasion of human ovarian cancer cells (Fig. 8
).
 |
Discussion
|
|---|
Mutations or overexpression of the Met oncogene are among the most frequent genetic alterations in human tumors, including those of the ovary (8, 9). The present study shows that HGF induces cell motility and invasive response selectively in ovarian cancer cells with high levels of the Met receptor. Reducing expression of Met in SKOV-3 and CaOV-3 by siRNA to levels approximately of OVCAR-3 resulted in blockade of HGF-activated motile response, whereas overexpression of exogenous Met induced OVCAR-3 cells to scatter in response to HGF. These experiments indicate that Met overexpression enhances cellular response to HGF, which is present at high concentrations in ovarian cancer ascitic fluid (5), and promotes cancer growth, spread, and invasion.
HGF receptor activation stimulates multiple signal transduction mechanisms, including the PI3K cascade. Interestingly, aberrant activity of the PI3K/Akt pathway is frequently (4068%) detected in human ovarian tumors, and the p110
catalytic subunit of PI3K has been implicated as a putative oncogene in ovarian cancer (26, 27). Whereas a role of the PI3K/Akt pathway in ovarian tumor cell growth and survival is well documented (28), our findings suggest that PI3K/Akt may be involved in other aspects of tumor progression, such as tumor invasion and metastasis.
The most intriguing aspect of this work was the finding that p70S6K by itself is sufficient to duplicate the invasive effects of HGF in ovarian cancer cells. A role of p70S6K and its ability to promote cell migration and invasion presents a novel function of p70S6K in epithelial cancer. This finding is relevant to a large number of ovarian carcinomas because approximately 55% of ovarian tumors express activated mTOR and, thus, mTOR/p70S6K perturbations may represent potentially important targets in human ovarian cancer (27).
Several reports using fibroblasts have proposed that p70S6K has the potential to regulate cell motility and is thought to be mediated through its interaction with the Rac1 and Cdc42; both are small GTPases involved in the regulation of membrane ruffling, actin polymerization, and potentially cell migration (29, 30). The idea that p70S6K may play a role in mediating cytoskeleton rearrangement is also supported by studies on TOR2, a yeast homologue of mTOR. Loss of TOR2 gene activity disrupts the polarized distribution of the actin cytoskeleton, and Rho-like GTPases mediate signaling from TOR2 to the actin cytoskeleton (31, 32). Because TOR/mTOR has a well-established role in protein synthesis via p70S6K, it has been suggested that their effects on migration may be related to synthesis of proteins required for cytoskeleton reorganization (30). Notably, the present study indicates that another mechanism by which p70S6K may promote cell migration and invasion is through increased expression and proteolytic activities of MMP-9, which demonstrates for the first time that p70S6K-expressing cells are also physically capable of degrading matrix. Degradation of type IV collagen is one of the most critical steps in the metastatic process of ovarian cancer (33), and up-regulation of MMP-9 is associated with increased cellular invasion and poor prognosis in late-stage or invasive ovarian cancer patients (25). MMP-9, independently of its enzymatic activity, may also promote cell motility by influencing cytoskeletal arrangements through its association with different families of adhesion receptors that include ß1-integrins, cell adhesion molecules, cadherins, and the hyaluronan receptor CD44 (34). In contrast to MMP-9, MMP-2 does not appear to be similarly expressed or activated. MMP-9 activation was not related to a decrease in the specific inhibitor of TIMP-1 in the cells. There was, however, an increase in MMP-9 to TIMP-1 ratio, which is important in determining the overall degradative process.
Our results show that p70S6K is a direct transcriptional activator of MMP-9 synthesis. In support of this finding, overexpression of p70S6K results in a rapid increase of the message (within 6 h), which can be blocked by actinomycin D, an inhibitor of transcription. In addition, cycloheximide did not inhibit the MMP-9 mRNA expression, suggesting that such expression does not require de novo protein synthesis. Finally, p70S6K expression directly induces MMP-9 promoter activity. Although the mechanism whereby p70S6K might regulate gene transcription is largely unknown; one possibility is through direct interaction with transcription factors. The transcription factor TNF receptor-associated factor-4 has been recently identified as a new binding partner for p70S6K in the nucleus, using a yeast two-hybrid approach (35). Alternatively, p70S6K may activate transcription factors, e.g. cAMP-responsive activator CREM (36), and hypoxia inducible factor 1 (37). Because these nuclear factors are not known to regulate MMP-9 gene transcription, it is possible that p70S6K could potentially regulate MMP-9 gene expression through as-yet-undetermined nuclear targets. Multiple transcription factor consensus binding motifs in the MMP-9 promoter, including those for nuclear factor-
B, Sp-1, Ets, activator protein-1, and a retinoblastoma binding element, have been implicated in the regulation of MMP-9 gene expression by a variety of growth factors, inflammatory cytokines, and protooncogenes (38, 39, 40, 41, 42). E1AF, an ets-related transcription factor, has previously been shown to mediate HGF-induced activation of MMP-9 gene in oral cancer cell invasion (43). Whether these putative regulatory elements in the MMP-9 promoter participate in the p70S6K-dependent activation of the MMP-9 gene remains to be determined.
In summary, these data emphasize the potential role of overexpression of the Met receptor in promoting cellular migration and matrix-degrading activities and point to the role for Met as indicator of ovarian cancer progression. Our results also propose a crucial role for p70S6K signaling in the regulation of invasion and cell motility. Recently p70S6K has been reported to promote angiogenesis in ovarian cancer cells via vascular endothelial growth factor production (37). Together, these findings suggest that activation of p70S6K may be critical in coordinating events associated with late-stage ovarian tumor development and suggest rapamycin and related compounds might be useful therapeutic agents in the treatment of ovarian cancer.
 |
Acknowledgments
|
|---|
We sincerely thank Dr. George Thomas (Friedrich Miescher-Institut, Basel, Switzerland) for providing us with the
N54
C104 and D3E-E389 plasmids; Dr. Douglas Boyd (M. D. Anderson Cancer Center, Houston, TX) for the MMP-9 promoter; and Dr. Nelly Auersperg (University of British Columbia, Vancouver, Canada) for SKOV-3, CaOV-3, and OVCAR-3 ovarian carcinoma cell lines. We also thank Yin Kei Keung for his assistance with scattering analysis.
 |
Footnotes
|
|---|
This work was supported by the Committee on Research and Conference Grant and Hong Kong Research Grants Council Grants HKU 7599/05M (to A.S.T.W.).
H.Y.Z. and A.S.T.W. have nothing to declare.
First Published Online February 9, 2006
Abbreviations: APMA, p-Aminophenylmercuric acetate; ß-gal, ß-galactosidase; DN-Akt, dominant-negative mutant of human Akt; HGF, hepatocyte growth factor; MMP, matrix metalloproteinase; mTOR, mammalian target of rapamycin; NS, nonspecific; PI3K, phosphatidylinositol 3-kinase; PKC, protein kinase C; si, small interfering; TIMP, tissue inhibitor of metalloproteinase.
Received November 4, 2005.
Accepted for publication January 30, 2006.
 |
References
|
|---|
- Naora H, Montell DJ 2005 Ovarian cancer metastasis: integrating insights from disparate model organisms. Nat Rev Cancer 5:355366[CrossRef][Medline]
- Comoglio PM, Trusolino L 2002 Invasive growth: from development to metastasis. J Clin Invest 109:857862[CrossRef][Medline]
- Corps AN, Sowter HM, Smith SK 1997 Hepatocyte growth factor stimulates motility, chemotaxis and mitogenesis in ovarian carcinoma cells expressing high levels of c-met. Int J Cancer 73:151155[CrossRef][Medline]
- Wong AS, Roskelley CD, Pelech S, Miller D, Leung PC, Auersperg N 2004 Progressive changes in Met-dependent signaling in a human ovarian surface epithelial model of malignant transformation. Exp Cell Res 299:248256[CrossRef][Medline]
- Sowter HM, Corps AN, Smith SK 1999 Hepatocyte growth factor (HGF) in ovarian epithelial tumour fluids stimulates the migration of ovarian carcinoma cells. Int J Cancer 83:476480[CrossRef][Medline]
- Matsumoto K, Nakamura T 2003 NK4 (HGF-antagonist/angiogenesis inhibitor) in cancer biology and therapeutics. Cancer Sci 94:321327[CrossRef][Medline]
- Baykal C, Demirtas E, Al A, Ayhan A, Yuce K, Tulunay G, Kose MF, Ayhan A 2004 Comparison of hepatocyte growth factor levels of epithelial ovarian cancer cyst fluids with benign ovarian cysts. Int J Gynecol Cancer 14:152156[Medline]
- Di Renzo MF, Olivero M, Katsaros D, Crepaldi T, Gaglia P, Zola P, Sismondi P, Comoglio P M 1994 Overexpression of the Met/HGF receptor in ovarian cancer. Int J Cancer 58:658662[Medline]
- Huntsman D, Resau JH, Klineberg E, Auersperg N 1999 Comparison of c-met expression in ovarian epithelial tumors and normal epithelia of the female reproductive tract by quantitative laser scan microscopy. Am J Pathol 155:343348[Abstract/Free Full Text]
- Hartmann G, Weidner KM, Schwarz H, Birchmeier W 1994 The motility signal of scatter factor/hepatocyte growth factor mediated through the receptor tyrosine kinase met requires intracellular action of Ras. J Biol Chem 269:2193621939[Abstract/Free Full Text]
- Ridley AJ, Comoglio PM, Hall A 1995 Regulation of scatter factor/hepatocyte growth factor responses by Ras, Rac, and Rho in MDCK cells. Mol Cell Biol 15:11101122[Abstract]
- Hordijk PL, ten Klooster JP, van der Kammen RA, Michiels F, Oomen LC, Collard JG 1997 Inhibition of invasion of epithelial cells by Tiam1-Rac signaling. Science 278:14641466[Abstract/Free Full Text]
- Royal I, Lamarche-Vane N, Lamorte L, Kaibuchi K, Park M 2000 Activation of cdc42, rac, PAK, and rho-kinase in response to hepatocyte growth factor differentially regulates epithelial cell colony spreading and dissociation. Mol Biol Cell 11:17091725[Abstract/Free Full Text]
- Pennacchietti S, Michieli P, Galluzzo M, Mazzone M, Giordano S, Comoglio PM 2003 Hypoxia promotes invasive growth by transcriptional activation of the met protooncogene. Cancer Cell 3:347361[CrossRef][Medline]
- Rong S, Bodescot M, Blair D, Dunn J, Nakamura T, Mizuno K, Park M, Chan A, Aaronson S, Vande Woude GF 1992 Tumorigenicity of the met proto-oncogene and the gene for hepatocyte growth factor. Mol Cell Biol 12:51525158[Abstract/Free Full Text]
- Jefferies HB, Fumagalli S, Dennis PB, Reinhard C, Pearson RB, Thomas G 1997 Rapamycin suppresses 5'TOP mRNA translation through inhibition of p70s6k. EMBO J 16:36933704[CrossRef][Medline]
- Wong AS, Pelech SL, Woo MMM, Yim G, Rosen B, Ehlen T, Leung PC, Auersperg N 2001 Coexpression of hepatocyte growth factor-Met: an early step in ovarian carcinogenesis? Oncogene 20:13181328[CrossRef][Medline]
- Stoker M, Gherardi E, Perryman M, Gray J 1987 Scatter factor is a fibroblast-derived modulator of epithelial cell mobility. Nature 327:239242[CrossRef][Medline]
- Maggiora P, Lorenzato A, Fracchioli S, Costa B, Castagnaro M, Arisio R, Katsaros D, Massobrio M, Comoglio PM, Flavia Di Renzo M 2003 The RON and MET oncogenes are coexpressed in human ovarian carcinomas and cooperate in activating invasiveness. Exp Cell Res 288:382389[CrossRef][Medline]
- Morotti A, Mila S, Accornero P, Tagliabue E, Ponzetto C 2002 K252a inhibits the oncogenic properties of Met, the HGF receptor. Oncogene 21:48854893[CrossRef][Medline]
- Grammer TC, Cheatham L, Chou MM, Blenis J 1996 The p70S6K signalling pathway: a novel signalling system involved in growth regulation. Cancer Surv 27:271292[Medline]
- Romanelli A, Martin KA, Toker A, Blenis J 1999 p70 S6 kinase is regulated by protein kinase C
and participates in a phosphoinositide 3-kinase-regulated signalling complex. Mol Cell Biol 19:29212928[Abstract/Free Full Text] - Fishman DA, Bafetti LM, Stack MS 1996 Membrane-type matrix metalloproteinase expression and matrix metalloproteinase-2 activation in primary human ovarian epithelial carcinoma cells. Invasion Metastasis 16:150159[Medline]
- Schmalfeldt B, Prechtel D, Harting K, Spathe K, Rutke S, Konik E, Fridman R, Berger U, Schmitt M, Kuhn W, Lengyel E 2001 Increased expression of matrix metalloproteinases (MMP)-2, MMP-9, and the urokinase-type plasminogen activator is associated with progression from benign to advanced ovarian cancer. Clin Cancer Res 7:23962404[Abstract/Free Full Text]
- Davidson B, Goldberg I, Gotlieb WH, Kopolovic J, Ben-Baruch G, Nesland JM, Reich R 2002 The prognostic value of metalloproteinases and angiogenic factors in ovarian carcinoma. Mol Cell Endocrinol 187:3945[CrossRef][Medline]
- Shayesteh L, Lu Y, Kuo WL, Baldocchi R, Godfrey T, Collins C, Pinkel D, Powell B, Mills GB, Gray JW 1999 PIK3CA is implicated as an oncogene in ovarian cancer. Nat Genet 21:99102[CrossRef][Medline]
- Altomare DA, Wang HQ, Skele KL, De Rienzo A, Klein-Szanto AJ, Godwin AK, Testa JR 2004 AKT and mTOR phosphorylation is frequently detected in ovarian cancer and can be targeted to disrupt ovarian tumor cell growth. Oncogene 23:58535857[CrossRef][Medline]
- Mills GB, Lu Y, Fang X, Wang H, Eder A, Mao M, Swaby R, Cheng KW, Stokoe D, Siminovitch K, Jaffe R, Gray J 2001 The role of genetic abnormalities of PTEN and the phosphatidylinositol 3-kinase pathway in breast and ovarian tumorigenesis, prognosis, and therapy. Semin Oncol 28:125141[CrossRef][Medline]
- Chou MM, Blenis J 1996 The 70 kDa S6 kinase complexes with and is activated by the Rho family G proteins Cdc42 and Rac1. Cell 85:573583[CrossRef][Medline]
- Berven LA, Willard FS, Crouch MF 2004 Role of the p70(S6K) pathway in regulating the actin cytoskeleton and cell migration. Exp Cell Res 296:183195[CrossRef][Medline]
- Schmidt A, Bickle M, Beck T, Hall MN 1997 The yeast phosphatidylinositol kinase homolog TOR2 activates RHO1 and RHO2 via the exchange factor ROM2. Cell 88:531542[CrossRef][Medline]
- Schmidt A, Kunz J, Hall MN 1996 TOR2 is required for organization of the actin cytoskeleton in yeast. Proc Natl Acad Sci USA 93:1378013785[Abstract/Free Full Text]
- Bar JK, Grelewski P, Popiela A, Noga L, Rabczynski J 2004 Type IV collagen and CD44v6 expression in benign, malignant primary and metastatic ovarian tumors: correlation with Ki-67 and p53 immunoreactivity. Gynecol Oncol 95:2331[CrossRef][Medline]
- Sancéau J, Truchet S, Bauvois B 2003 Matrix metalloproteinase-9 silencing by RNA interference triggers the migratory-adhesive switch in Ewings sarcoma cells. J Biol Chem 278:3653736546[Abstract/Free Full Text]
- Fleckenstein DS, Dirks WG, Drexler HG, Quentmeier H 2003 Tumor necrosis factor receptor-associated factor (TRAF) 4 is a new binding partner for the p70S6 serine/threonine kinase. Leuk Res 27:687694[CrossRef][Medline]
- de Groot RP, Ballou LM, Sassone-Corsi P 1994 Positive regulation of the cAMP-responsive activator CREM by the p70 S6 kinase: an alternative route to mitogen-induced gene expression. Cell 79:8191[CrossRef][Medline]
- Skinner HD, Zheng JZ, Fang J, Agani F, Jiang BH 2004 Vascular endothelial growth factor transcriptional activation is mediated by hypoxia-inducible factor 1
, HDM2, and p70S6K1 in response to phosphatidylinositol 3-kinase/AKT signaling. J Biol Chem 279:4564345651[Abstract/Free Full Text] - Sato H, Seiki M 1993 Regulatory mechanism of 92 kDa type IV collagenase gene expression which is associated with invasiveness of tumor cells. Oncogene 8:395405[Medline]
- Sato H, Kita M, Seiki M 1993 v-Src activates the expression of 92-kDa type IV collagenase gene through the AP-1 site and the GT box homologous to retinoblastoma control elements. A mechanism regulating gene expression independent of that by inflammatory cytokines. J Biol Chem 268:2346023468[Abstract/Free Full Text]
- Gum R, Lengyel E, Juarez J, Chen JH, Sato H, Seiki M, Boyd D 1996 Stimulation of 92-kDa gelatinase B promoter activity by ras is mitogen-activated protein kinase kinase 1-independent and requires multiple transcription factor binding sites including closely spaced PEA3/ets and AP-1 sequences. J Biol Chem 271:1067210680[Abstract/Free Full Text]
- Himelstein BP, Lee EJ, Sato H, Seiki M, Muschel RJ 1997 Transcriptional activation of the matrix metalloproteinase-9 gene in an H-ras and v-myc transformed rat embryo cell line. Oncogene 14:19951998[CrossRef][Medline]
- Watabe T, Yoshida K, Shindoh M, Kaya M, Fujikawa K, Sato H, Seiki M, Ishii S, Fujinaga K 1998 The Ets-1 and Ets-2 transcription factors activate the promoters for invasion-associated urokinase and collagenase genes in response to epidermal growth factor. Int J Cancer 77:128137[CrossRef][Medline]
- Hanzawa M, Shindoh M, Higashino F, Yasuda M, Inoue N, Hida K, Ono M, Kohgo T, Nakamura M, Notani K, Fukuda H, Totsuka Y, Yoshida K, Fujinaga K 2000 Hepatocyte growth factor up-regulates E1AF that induces oral squamous cell carcinoma cell invasion by activating matrix metalloproteinase genes. Carcinogenesis 21:10791085[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
Y. L. Pon, H. Y. Zhou, A. N.Y. Cheung, H. Y.S. Ngan, and A. S.T. Wong
p70 S6 Kinase Promotes Epithelial to Mesenchymal Transition through Snail Induction in Ovarian Cancer Cells
Cancer Res.,
August 15, 2008;
68(16):
6524 - 6532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jin, R. Yang, Z. Zheng, M. Romero, J. Ross, H. Bou-Reslan, R. A.D. Carano, I. Kasman, E. Mai, J. Young, et al.
MetMAb, the One-Armed 5D5 Anti-c-Met Antibody, Inhibits Orthotopic Pancreatic Tumor Growth and Improves Survival
Cancer Res.,
June 1, 2008;
68(11):
4360 - 4368.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Kong, S. Banerjee, W. Huang, Y. Li, Z. Wang, H.-R. C. Kim, and F. H. Sarkar
Mammalian Target of Rapamycin Repression by 3,3'-Diindolylmethane Inhibits Invasion and Angiogenesis in Platelet-Derived Growth Factor-D-Overexpressing PC3 Cells
Cancer Res.,
March 15, 2008;
68(6):
1927 - 1934.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ye, D. Hu, L. Tu, X. Zhou, F. Lu, B. Wen, W. Wu, Y. Lin, Z. Zhou, and J. Qu
Involvement of PI3K/Akt Signaling Pathway in Hepatocyte Growth Factor-Induced Migration of Uveal Melanoma Cells
Invest. Ophthalmol. Vis. Sci.,
February 1, 2008;
49(2):
497 - 504.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Y. Zhou, Y. L. Pon, and A. S. T. Wong
Synergistic Effects of Epidermal Growth Factor and Hepatocyte Growth Factor on Human Ovarian Cancer Cell Invasion and Migration: Role of Extracellular Signal-Regulated Kinase 1/2 and p38 Mitogen-Activated Protein Kinase
Endocrinology,
November 1, 2007;
148(11):
5195 - 5208.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. W.T. Cheung, P. C.K. Leung, and A. S.T. Wong
Gonadotropin-Releasing Hormone Promotes Ovarian Cancer Cell Invasiveness through c-Jun NH2-Terminal Kinase-Mediated Activation of Matrix Metalloproteinase (MMP)-2 and MMP-9.
Cancer Res.,
November 15, 2006;
66(22):
10902 - 10910.
[Abstract]
[Full Text]
[PDF]
|
 |
|