help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0070
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hondares, E.
Right arrow Articles by Villarroya, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hondares, E.
Right arrow Articles by Villarroya, F.
Endocrinology Vol. 147, No. 6 2829-2838
Copyright © 2006 by The Endocrine Society

Thiazolidinediones and Rexinoids Induce Peroxisome Proliferator-Activated Receptor-Coactivator (PGC)-1{alpha} Gene Transcription: An Autoregulatory Loop Controls PGC-1{alpha} Expression in Adipocytes via Peroxisome Proliferator-Activated Receptor-{gamma} Coactivation

Elayne Hondares, Ofelia Mora, Pilar Yubero, Marisa Rodriguez de la Concepción, Roser Iglesias, Marta Giralt and Francesc Villarroya

Department of Biochemistry and Molecular Biology, University of Barcelona, 08028 Barcelona, Spain

Address all correspondence and requests for reprints to: Francesc Villarroya, Ph.D., Department of Biochemistry and Molecular Biology, University of Barcelona, Avda Diagonal 645, 08028 Barcelona, Spain. E-mail: fvillarroya{at}ub.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Thiazolidinediones (TZDs) are insulin-sensitizing drugs currently used to treat type 2 diabetes. They are activators of peroxisome proliferator-activated receptor (PPAR)-{gamma}, and adipose tissue constitutes a major site for their biological effects. PPAR coactivator (PGC)-1{alpha} is a transcriptional coactivator of PPAR{gamma} and other transcription factors. It is involved in the control of mitochondrial biogenesis, and its activity has been linked to insulin sensitization. Here we report that PGC-1{alpha} gene expression in brown and white adipocytes is a direct target of TZDs via PPAR{gamma} activation. Activators of the retinoid X receptor also induce PGC-1{alpha} gene expression. This is due to the presence of a PPAR{gamma}-responsive element in the distal region of the PGC-1{alpha} gene promoter that binds PPAR{gamma}/retinoid X receptor heterodimers. Moreover, there is a positive autoregulatory loop of control of the PGC-1{alpha} gene through coactivation of PPAR{gamma} responsiveness to TZDs by PGC-1{alpha} itself. These data indicate that some of the effects of TZDs, especially promotion of mitochondrial biogenesis and oxidative pathways in adipose depots, entail PGC-1{alpha} up-regulation via enhanced transcription of the PGC-1{alpha} gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THIAZOLIDINEDIONES (TZDS) ARE insulin-sensitizing drugs of current use in type 2 diabetes. They are strong agonists of peroxisome proliferator-activated receptor (PPAR)-{gamma}, and most of their effects are believed to involve the activation of this receptor (1). The mechanisms of insulin sensitization elicited by TZDs are not fully understood. Although TZDs can act on skeletal muscle, adipose tissue is their major target. PPAR{gamma} is highly expressed in adipose tissue and it acts as a master transcription factor of adipogenesis. Thus, it has been proposed that the main mechanisms of action of TZDs include stimulation of adipogenesis and subsequent fatty acid storage in adipose tissue, sparing other tissues such as liver, muscle, or ß-cells from excessive exposure to free fatty acids (2). However, the effects of TZDs are complex, and several other mechanisms have been implicated in insulin sensitization, including the promotion of mitochondrial oxidative activity in adipose tissue (3).

PPAR-coactivator (PGC)-1{alpha} is a transcriptional coactivator involved in the control of energy metabolism. It coactivates members of the type II class of nuclear hormone receptors, including PPAR{gamma} as well as nuclear respiratory factors-1 and -2, responsible for concerted activation of genes determining mitochondrial respiratory capacity (4). PGC-1{alpha} is implicated in the control of multiple biological pathways related to energy metabolism in liver, muscle, and adipose tissues. It is required for efficient activation of gluconeogenesis in the liver (5), and it promotes mitochondrial biogenesis in skeletal muscle (6). PGC-1{alpha} is strongly expressed in brown adipose tissue from rodents and, to a lesser extent, white adipose tissue of humans and rodents (7, 8). When overexpressed in either rodent or human adipocytes, PGC-1{alpha} drives differentiation toward a brown adipocyte phenotype, characterized by the expression of the mitochondrial uncoupling protein (UCP)-1 and enhancement of overall mitochondrial oxidative activity (7, 9). It has been proposed that PGC-1{alpha} mediates the conversion of white adipocytes from storage to fat-oxidizing cells in response to such signals as leptin (10).

A deficient mitochondrial oxidative capacity associated with reduced expression of PGC-1{alpha} target genes has recently been identified as a primary event associated with insulin resistance in skeletal muscle (11, 12), and recent studies indicate that reduced expression of PGC-1{alpha} accounts for a reduction in the oxidative capacity in subjects prone to insulin resistance (13). Whereas this impairment of oxidative capacity has been reported mainly in skeletal muscle, recent data indicate that it may also be relevant in adipose tissue. Corvera and collaborators (14, 15) identified mitochondrial biogenesis as a key process in the differentiation of white adipose tissue, similarly to brown fat differentiation. They recently reported that TZDs favor this process, including the induction of PGC-1{alpha}, in white adipose tissue depots in rodents. An overall reduction in marker genes characteristic of brown adipose phenotype, including PGC-1{alpha}, in sc adipose tissue of human adults has been associated with insulin resistance (16). This has led to the proposal that up-regulation of PGC-1{alpha} could constitute a strategy for preventing and reversing insulin resistance and obesity (17). PGC-1{alpha} gene transcription is induced by cAMP-dependent pathways. In response to adrenergic stimulus in brown adipose tissue, transcriptional activation is mediated by phosphorylation of activating transcription factor (ATF)-2 via p38 MAPK, which is activated by protein kinase A (PKA) in response to cAMP (18). A similar mechanism involving direct phosphorylation of cAMP response element-binding protein (CREB) by PKA takes place in liver in response to glucagon (19). ATF-2 and CREB action on the PGC-1{alpha} gene occurs through a cAMP-responsive site in the proximal promoter region. Myocyte enhancer factor-2, a specific myogenic transcription factor, is another transcription factor implicated in PGC-1{alpha} gene expression in skeletal muscle and its responsiveness to calcium (20).

Considering that TZDs exert most of their effects on adipose tissue and recent data indicating that they may up-regulate oxidative activity in adipose tissue of diabetic patients (3), we examined their effect on the transcription of the PGC-1{alpha} gene in brown and white adipose cells. We identified PGC-1{alpha} as a direct target of TZDs acting via a PPAR{gamma}-responsive element in the PGC-1{alpha} gene promoter as well as a positive autoregulatory loop of control of the PGC-1{alpha} gene through coactivation of PPAR{gamma} responsiveness by PGC-1{alpha} itself.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
Rosiglitazone and ciglitazone were from Cayman Chemicals (Ann Arbor, MI). Troglitazone was provided by Glaxo Wellcome (Greenford, UK). Norepinephrine, 9-cis retinoic acid (9-cis RA), T3, insulin, propanolol, prazosin, and cycloheximide were from Sigma (St. Louis, MO). AGN194204 was a gift from Dr. R. A. Chandraratna (Allergan Pharmaceuticals, Irvine, CA). TTNPB, GW9662, and H89 were from EMD Biosciences (La Jolla, CA).

Cell culture
The care and use of mice were in accordance with European Community Council Directive 86/609/EEC and were approved by the Comitè Ètic d’Experimentació Animal of University of Barcelona. Primary cultures of brown adipocytes from mice were performed as described previously (21), and experiments were done on d 9 of culture when 80–90% of the cells were differentiated. HIB-1B cells were cultured and differentiated as described elsewhere (22). 3T3-L1 cells were maintained and differentiated following standard procedures (23) and were studied 1 wk after induction of differentiation when more than 90% of the cells were differentiated on the basis of lipid accumulation. Human preplated adipocytes, corresponding to a mix of cells from six healthy individuals with normal body mass index, were obtained from Zen-Bio (Research Triangle Park, NC), cultured according to supplier’s instructions, and studied 2 wk after induction of differentiation. Cells were exposed to 10 µM rosiglitazone, 10 µM troglitazone, 30 µM ciglitazone, or 1 µM 9-cis RA for 24 h, unless otherwise indicated. Treatment with norepinephrine was at 0.5 µM for 6 h. The effects of PPAR{gamma} inhibition were determined by using 30 µM GW9662 and those of retinoid X receptor (RXR) activation with 1 µM AGN194204. Propanolol plus prazosin were used at 10 µM for 24 h. H89 was used at 10 µM and cycloheximide was used at 5 µg/ml, as reported elsewhere (21).

RNA isolation, Northern blot, and quantitative real-time PCR analyses
RNA was extracted using the RNeasy minikit (QIAGEN, Hilden, Germany). Northern blot analysis and hybridization were carried out as described (24), using as probes the cDNA for mouse PGC-1{alpha} (7), rat UCP1 (25), adipocyte P2 (aP2)/fatty acid binding protein (FABP) (26), mouse cytochrome oxidase subunit II (COII) (27) and subunit IV (COIV) (American Type Culture Collection, Manassas, VA), and mouse ß-actin (28). Hybridization signals were quantified using Molecular Image System GS-525 (Bio-Rad Laboratories, Foster City, CA). After individual densitometric analysis of the 6.5- and 5.0-kb transcript signals for PGC-1{alpha}, no differential changes in their expression were detected in any of the experimental treatments studied, except for the positive control norepinephrine (see Fig. 1Go), and both transcripts were modified in parallel in response to the TZDs or rexinoids. Therefore, data are expressed by integrating densitometry signals for both transcripts. For quantitative real-time PCR analysis of mRNA expression, TaqMan RT-PCR was performed on the ABI PRISM 7700HT sequence detection system and reagents (Applied Biosystems, Foster City, CA). One microgram of RNA was transcribed into cDNA using MultiScribe reverse transcriptase and random-hexamer primers. The reaction was performed in a final volume of 25 µl using TaqMan universal PCR master mix, No-AmpErase UNG reagent, and the specific gene expression primer pair probes. The Assay-on-Demand probes used were Mm00447183 for mouse PGC-1{alpha}, Hs00173304 for human PGC-1{alpha}, Hs00222453 for human UCP1, Mm00437762 for mouse ß2-microglobulin, and Hs99999904 for human cyclophilin A (housekeeping reference controls). Human COII mRNA was analyzed (Assay-by-Design, Applied Biosystems) using as primers CAAACCACTTTCACCGCTACAC (forward) and GGACGATGGGCATGAAACTGT (reverse), and the FAM-labeled probe was AAATCTGTGGAGCAAACC. The relative amount of PGC-1{alpha} mRNA in each sample was normalized to that of the reference control using the comparative (2{Delta}CT) method according to the manufacturer’s instructions.


Figure 1
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1. Effects of rosiglitazone, 9-cis-RA, and norepinephrine on PGC-1{alpha} mRNA in brown adipocytes in primary culture. Murine brown adipocytes differentiated in primary culture were used for all figure panels. Cells were treated 24 h with 10 µM or the other indicated concentrations of rosiglitazone, 1 µM 9-cis RA, 1 µM AGN 194204, 30 µM GW9662, 10 µM propanolol plus prazosin or for 6 h with 0.5 µM norepinephrine. A, Example of Northern blot analysis PGC-1{alpha} mRNA expression. B, Dose response of the effects of rosiglitazone on PGC-1{alpha} mRNA levels. C, Effects of 10 µM rosiglitazone on UCP1 mRNA, COII mRNA, and COIV mRNA expression. D, Effects of the PPAR{gamma} inhibitor GW 9662, the adrenergic inhibitors propanolol plus prazosin, and the PKA inhibitor H89 on the induction of PGC-1{alpha} mRNA by rosiglitazone, 9-cis RA, or norepinephrine. Results are the mean ± SEM of four to five independent experiments. *, Significant differences (P < 0.05) with respect to controls; #, Significant differences due to GW9662, propanolol plus prazosin, or H89 for each experimental situation.

 
Immunoblot assays
Immunoblot analysis of PGC-1{alpha} was performed as reported elsewhere (24). Protein extracts from brown adipocytes were prepared by homogenization in a buffer containing 100 mM Tris (pH 8.5), 250 mM NaCl, 1% Igepal CA-630 (Sigma), 1 mM EDTA, a cocktail of protease inhibitors (Complete-Mini; Roche Diagnostic, Sant Cugat del Valles, Spain), and 0.1% phenylmethylsulfonyl fluoride. Proteins (40 µg/lane) were separated by 8% SDS-PAGE, transferred to Immobilon-P membranes (Millipore, Bedford, MA), and probed with an antibody against murine PGC-1{alpha} (SC-5816; Santa Cruz Biotechnology, Santa Cruz, CA). As a positive control, protein extracts of HEK-293 cells infected with the adenovirus driving murine PGC-1{alpha} (40 µg/lane) were run in parallel (see below). Incubation with an anti-ß-actin antibody (Sigma, A5441) was performed to establish equal loading of protein samples.

Plasmids and transfection assays
The plasmid –2553-PGC-1{alpha}-Luc, in which the region –2553 to +78 of the mouse PGC-1{alpha} gene drives the promoterless luciferase gene from firefly, was a gift from Dr. B. Spiegelman (Dana-Farber Cancer Institute and Department of Cell Biology, Harvard Medical School, Boston, MA). The plasmid –2553-PPREmut-PGC-1{alpha}-Luc, a version containing point mutations at the putative PPAR-responsive element (PPRE) (GT instead of AG at sites –2043 and –2044, and GCT instead of AGG at sites –2050 to –2052) was generated using the Quikchange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and checked by direct DNA sequencing. The plasmid in which the proximal region containing the cAMP-responsive element at –146/–129 (19) had been removed (–2553-CREmut-PGC-1{alpha}-Luc) was obtained by digestion of the parental plasmid –2553-PGC-1{alpha}-Luc with PvuII and ZraI and further ligation. Plasmid expression vectors pSG5-PPAR{gamma} (29), pRSV-RXR{alpha} (30), pSV-PGC-1{alpha} (7), and SR{alpha}-PKA (31) are described elsewhere. HIB-1B cells were transiently transfected using FuGENE-6 (Roche Molecular Biochemicals, Indianapolis, IN) for 16 h. Unless otherwise indicated, each transfection contained 1.5 µg of –2553-PGC-1{alpha}-Luc, 0.3 µg of plasmid expression vectors, and 3 ng of pRL-CMV (Promega Corp., Madison, WI), an expression vector of Renilla reniformis luciferase. Cells were incubated for 48 h after transfection and, when indicated, were treated for 24 h before harvest with or without 10 µM rosiglitazone or 1 µM 9-cis RA. Luciferase activities were measured in a Turner Designs luminometer TD20/20 using the dual luciferase reporter assay system (Promega). Luciferase activity elicited by wild-type and mutant –2553-PGC-1{alpha}-Luc constructs was normalized for variation in transfection efficiency using Renilla luciferase as internal standard.

EMSA experiments
Nuclear proteins were isolated from rat brown adipose tissue or differentiated primary brown adipocytes as described elsewhere (32). cDNAs for mouse PPAR{gamma} and human RXR{alpha} were transcribed and translated in vitro using the TNT quick-coupled transcription/translation systems (Promega). The PGC-1{alpha}-PPRE double-stranded oligonucleotide used in EMSAs corresponds to positions –2036 to –2062 of the mouse PGC-1{alpha} gene, and its sequence is 5'-GTAAAATTCAGGACAAAGGTCATGGGCTC-3' (wild type). The mutated version of PGC-1{alpha}-PPRE designed to have impaired PPAR{gamma}/RXR binding had GT instead of AG at sites –2043 and –2044 and GCT instead of AGG at sites –2050 to –2052. The 32P-labeled PGC-1{alpha}-PPRE wild-type or mutated oligonucleotides (10,000–20,000 cpm) were incubated for 30 min at 25 C with 5 µg of nuclear protein extract or 5 µl of in vitro-transcribed/translated proteins. Reactions were carried out in a volume of 20 µl containing 10 mM Tris-HCl (pH 8.0), 0.05% Nonidet P-40, 1 mM dithiothreitol, 40 mM KCl, 6% glycerol, and 2 µg of poly(dI)/(dC). Samples were analyzed by electrophoresis at 4 C in nondenaturing 5% polyacrylamide gels in 0.5 x 44.5 mM Tris, 44.5 mM borate, and 1 mM EDTA. In the competition experiments, 100-fold molar excess of unlabeled oligonucleotide was included. When indicated, 1 µl of antiserum against PPAR{gamma} (sc-7196; Santa Cruz Biotechnology) or CCAAT/enhancer-binding protein (C/EBP){delta} (sc-151; Santa Cruz Biotechnology) was used.

Chromatin immunoprecipitation (ChIP) assay
HIB-1B cells were transfected with the PPAR{gamma} expression vector and exposed to 10 µM rosiglitazone as described above. When indicated, cells were transfected with –2553-PGC-1{alpha}-Luc or –2553-PPREmut-PGC-1{alpha}-Luc. Cells were chilled at 4 C for 10 min and treated with 5 mM HEPES-KOH (pH 8.0), 0.1 mM EDTA, 0.05 mM EGTA, 10 mM NaCl, and 1.1% formaldehyde. After centrifugation (600 g, 10 min at 4 C), cell pellets were lysed in ice-cold lysis buffer [50 mM HEPES-KOH (pH 7.4), 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 10% glycerol, 0.5% Nonidet P-40, 0.25% Triton X-100] supplemented with protease inhibitors (1 mM phenylmethylsulfonyl fluoride and 1 µg/ml each of aprotinin, leupeptin, and pepstatin A). After incubation at 4 C for 10 min, crude nuclei were collected by centrifugation (600 x g, for 5 min at 4 C). Nuclei were resuspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, and 200 mM NaCl plus protease inhibitors, collected as above, and resuspended in radioimmunoprecipitation assay buffer [10 mM Tris-HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 140 mM NaCl, 5% glycerol, 0.1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1% Triton X-100, supplemented with protease inhibitors]. Samples were sonicated with Branson Sonifier 250 and lysates were cleared by centrifugation (16,000 x g, 15 min at 4 C) and used for immunoprecipitation with 2 µg of anti-PPAR{gamma} antibody (sc-7196, Santa Cruz Biotechnology) or an equal amount of an unrelated immunoglobulin (sc-9314, Santa Cruz Biotechnology).

Immunoprecipitations were performed for 16 h at 4 C, and immune complexes were collected by nutating the lysates for 1 h at 4 C with 30 µl/sample of 50% slurry protein G agarose beads (Santa Cruz Biotechnology) preincubated with 100 µg/ml salmon sperm DNA (Life Technologies). The beads were washed with radioimmunoprecipitation assay buffer supplemented with 1 mM phenylmethylsulfonyl fluoride and 100 µg/ml yeast tRNA (Life Technologies). The beads were then incubated in 100 µl of Tris/EDTA buffer, 0.5% sodium dodecyl sulfate, and 200 µg/ml proteinase K (Sigma) for 3 h at 55 C, and cross-links were reversed for 6 h at 65 C. After phenol-chloroform extraction, DNA was used for PCR analysis. Primers for amplifying a 378-bp fragment encompassing the putative PPRE in the PGC-1{alpha} gene were: forward, 5'GTATCAGTTACCATCAGG 3' and reverse, 5'AACAAGATGGCCAACAGC3'; those amplifying a 237-bp fragment of the murine cyclophilin A gene, used as control, were: forward, 5' AAGACTGAATGGCTGGATGG 3' and reverse, 5' TTACAGGACATTGCGAGCAG 3'. After 35 cycles of amplification, PCR products were electrophoresed in a 1.5% agarose gel and visualized by ethidium bromide staining.

Transduction of brown adipocytes with an adenoviral vector driving PGC-1{alpha}
Differentiated brown adipocytes were infected with an adenoviral vector driving murine PGC-1{alpha} (AdCMV-PGC-1{alpha}, provided by B. Spiegelman) or AdCMV-GFP (control) at a multiplicity of infection of 400 for 4 h in DMEM/F12 medium. Further culture of cells with regular culture medium for brown adipocytes (21) was performed for 48 h. This treatment led to an efficiency of transduction of about 80%, on the basis of assessment of green fluorescent protein (GFP) fluorescence. In these conditions, transduction increased the 120-kDa immunoblot signal for PGC-1{alpha} protein at least 10-fold with respect to controls.

Statistical analysis were performed using the Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TZDs and rexinoids induce PGC-1{alpha} gene expression in brown adipocytes
Rosiglitazone increased PGC-1{alpha} mRNA expression in mouse primary brown adipocytes differentiated in culture (Fig. 1AGo). This effect was dose and time dependent (Fig. 1BGo). PGC-1{alpha} mRNA expression was significantly higher than the controls 4 h after exposure to 10 µM rosiglitazone (4.8 ± 0.5-fold induction), peaked 24 h after exposure (see Fig. 1BGo), and remained high for 48 h (not shown). Other TZDs, such as troglitazone or ciglitazone, had similar effects. Thus, 10 µM troglitazone caused a 5.3 ± 0.4-fold induction in PGC-1{alpha} mRNA levels (P < 0.05); and 30 µM ciglitazone caused a 3.9 ± 0.3-fold induction in PGC-1{alpha} mRNA (P < 0.05). Treatment of cells with 9-cis RA also induced PGC-1{alpha} mRNA expression (Fig. 1AGo). Similar activation by AGN194204, a specific RXR agonist (Fig. 1AGo), but not TTNPB, a retinoic acid receptor activator (data not shown), indicated that RXR activation was responsible for the effects of 9-cis RA. Parallel experiments in which brown adipocytes were exposed to norepinephrine indicated a robust induction, consistent with the known adrenergic, cAMP-dependent, activation of PGC-1{alpha} gene transcription (18). However, whereas the induction elicited by norepinephrine occurred mainly for the 5.0-kb PGC-1{alpha} mRNA transcript, changes elicited by TZDs and rexinoids occurred equally for the 5.0- and 6.5-kb transcripts. A concomitant increase in the mRNAs for the genes encoding the mitochondrial proteins UCP1, COII, and COIV, known targets of PGC-1{alpha} effects, was observed in response to rosiglitazone (Fig. 1CGo). Rosiglitazone also increased significantly PGC-1{alpha} mRNA in HIB-1B cells, a cell line representative of brown adipocytes (7.3 ± 0.9-fold induction, P < 0.05) as did 9-cis RA, albeit to a lesser extent (3.4 ± 0.5-fold induction, P < 0.05).

The induction of PGC-1{alpha} by TZDs and rexinoids is mediated by a PPAR{gamma}-dependent pathway
The effects of both rosiglitazone and 9-cis RA on PGC-1{alpha} gene expression were blunted in the presence of GW9662, a specific PPAR{gamma} antagonist, thus indicating that rosiglitazone acted through PPAR{gamma} and that 9-cis RA effects via RXR also required an active PPAR{gamma} (Fig. 1DGo). This indicates that PPAR{gamma}/RXR heterodimers mediate TZD and 9-cis RA effects on PGC-1{alpha} gene expression. The PPAR{gamma} antagonist GW9662 did not alter the induction of PGC-1{alpha} mRNA levels by norepinephrine, thus indicating that TZDs and adrenergic, cAMP-mediated activation of PGC-1{alpha} gene expression take place through distinct mechanisms. This was further established by the use of a mixture of ß- and {alpha}-adrenergic antagonists, propanolol plus prazosin, which reduced the norepinephrine effects on PGC-1{alpha} mRNA expression, whereas it did not alter the action of rosiglitazone or 9-cis RA (Fig. 1DGo). The PKA inhibitor H89 also reduced the action of norepinephrine on PGC-1{alpha} mRNA expression, whereas it did not have any effect on rosiglitazone- and 9-cis RA-dependent induction (Fig. 1DGo). Cycloheximide did not affect the induction of PGC-1{alpha} by rosiglitazone (5.8 ± 0.7-fold induction by rosiglitazone in control cells, 6.5 ± 0.9-fold induction by rosiglitazone in cycloheximide-treated cells), thus indicating that rosiglitazone acts on PGC-1{alpha} gene expression through protein synthesis-independent mechanisms, compatible with a ligand-dependent activation of PPAR{gamma}.

TZDs induce the expression of the PGC-1{alpha} protein in brown adipocytes
We determined whether the observed induction of PGC-1{alpha} mRNA levels by TZDs result in an increase in the PGC-1{alpha} protein in brown adipocytes. A robust time-dependent induction of PGC-1{alpha} protein abundance in brown adipocyte protein extracts was observed as a consequence of treatment with rosiglitazone (Fig. 2Go).


Figure 2
View larger version (24K):
[in this window]
[in a new window]
 
FIG. 2. Effects of rosiglitazone on PGC-1{alpha} protein levels in brown adipocytes in primary culture. Murine brown adipocytes differentiated in primary culture were treated with rosiglitazone at the indicated times and concentration. Data are means ± SEM of at least three independent experiments and are shown as the ratio of the densitometric intensity of the immunoreactive signal of PGC-1{alpha} protein normalized by the immunoreactive signal for ß-actin (top). *, Significant differences (P < 0.05) with respect to controls. Representative immunoblot analysis of PGC-1{alpha} protein levels (bottom). Control corresponds to the immunoreactive signal using a protein extract of HEK-293 cells stably transduced with a cytomegalovirus-driven adenoviral construct for murine PGC-1{alpha} expression.

 
TZDs and rexinoids activate PGC-1{alpha} gene expression in white adipocytes
The effects of rosiglitazone were analyzed in differentiated 3T3-L1 white adipocytes. As expected, PGC-1{alpha} mRNA levels were much lower (~100-fold less) than in brown adipocytes and required a more sensitive method (real-time PCR) of quantification. Rosiglitazone induced PGC-1{alpha} mRNA expression as did 9-cis RA, albeit to a lesser extent (Fig. 3Go). The effects of rosiglitazone and 9-cis RA were also analyzed in human white adipocytes differentiated in primary culture. As for 3T3-L1 cells, PGC-1{alpha} mRNA abundance was in a range much lower than brown adipocytes. However, rosiglitazone and 9-cis RA induced significantly PGC-1{alpha} mRNA levels (Fig. 3Go). Known targets of PGC-1{alpha} such as UCP1 mRNA and COII mRNA were also significantly induced (P < 0.05) in response to rosiglitazone (2.6 ± 0.3-fold induction and 1.5 ± 0.1-fold induction, respectively) and 9-cis RA (2.8 ± 0.2-fold induction and 1.48 ± 0.1-fold induction, respectively).


Figure 3
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 3. Effects of rosiglitazone and 9-cis RA on PGC-1{alpha} mRNA in white adipocytes. Murine 3T3-L1 adipocytes and human white adipocytes differentiated in primary culture were treated for 24 h with 10 µM rosiglitazone or 1 µM 9-cis RA. Relative abundance of PGC-1{alpha} mRNA was determined by quantitative real-time PCR (see Materials and Methods). Results are the mean ± SEM of three to four independent experiments. *, Significant differences (P < 0.05) with respect to controls.

 
The PGC-1{alpha} gene is a target of PPAR{gamma}-mediated transcriptional activation via a PPAR{gamma}-responsive element in the promoter region
To determine whether the PGC-1{alpha} gene is a target of transcriptional regulation by TZDs, HIB-1B cells were transiently transfected using the –2553-PGC-1{alpha}-Luc plasmid construct. Rosiglitazone induced a dose-dependent increase in the PGC-1{alpha} gene promoter activity (see Fig. 4AGo). When cells were cotransfected with PPAR{gamma} and rosiglitazone was added, an enhancement in the dose-dependent induction was observed. Parallel experiments indicated a more than 2-fold induction by 9-cis RA, and this was enhanced to around 6-fold induction by cotransfection with PPAR{gamma} or RXR{alpha} (Fig. 4BGo). Maximal induction was achieved with PPAR{gamma} plus RXR{alpha} cotransfection and addition of rosiglitazone. This result indicates that rosiglitazone acts on the PGC-1{alpha} gene via ligand-dependent activation of PPAR{gamma}/RXR heterodimers. Cotransfection with an expression vector driving the catalytic subunit of PKA led to a significant induction of the PGC-1{alpha} promoter activity, in the range of that achieved via rosiglitazone activation of PPAR{gamma}/RXR{alpha} heterodimers. This is consistent with the presence of cAMP-responsive elements in the PGC-1{alpha} promoter (18, 19). Moreover, as for endogenous PGC-1{alpha} gene expression, the activation of the PGC-1{alpha} promoter was also observed for other TZDs. Troglitazone and ciglitazone led to a 2.7 ± 0.4- and 2.3 ± 0.3-fold induction of PGC-1{alpha} promoter activity, respectively, in the absence of cotransfected PPAR{gamma}, and 3.8 ± 0.5- and 2.9 ± 0.4-fold induction when PPAR{gamma} had been cotransfected.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
FIG. 4. Effects of rosiglitazone, 9-cis RA, and PPAR{gamma} on PGC-1{alpha} gene promoter activity. Transient transfection experiments were performed in HIB-1B cells with –2553 PGC-1{alpha}-Luc. A, Dose-response effects of rosiglitazone on –2553 PGC-1{alpha}-Luc activity in the absence or presence of cotransfected PPAR{gamma}. B, When indicated, the expression vectors for PPAR{gamma}, RXR{alpha}, or for constitutively active PKA were cotransfected and 24 h previous to harvest 10 µM rosiglitazone or 1 µM 9-cis RA were added to the cells. B, Results show the mean ± SEM of at least three independent experiments done in triplicate. *, Statistically significant differences with respect to untreated controls (P < 0.05).

 
Computer-assisted analysis of the sequence of the mouse PGC-1{alpha} promoter region (MatInspector) revealed the presence of a direct repeat with one bp spacing, i.e. a potential PPAR{gamma}-responsive element, at position –2043 to –2055. The sequence of this element was practically identical with consensus PPAR{gamma}-response elements, and it was fully conserved in the promoter of human PGC-1{alpha} gene and PGC-1{alpha} genes from the other mammalian species (rat, bovine) in which the 5' noncoding region sequence is available in databases (accession no. NT_078473 for mouse, NM_031347 for rat, NT_006316 for human, AY547550 for bovine). Position around –2 kb of the transcription initiation is also conserved among species (Fig. 5AGo). A point-mutation construction that disrupts PPAR{gamma} binding capacity at that site was designed, and, when transfected into HIB-1B cells, it showed a diminished capacity to be activated by rosiglitazone either alone or in the presence of cotransfected PPAR{gamma} (Fig. 5BGo). Both the wild-type and the PPRE mutant forms of the promoter were significantly activated by PKA, in agreement with the location of a cAMP-responsive element, CREB, and ATF-2 binding site, in the proximal region of the PGC-1{alpha} promoter (18, 19). In contrast, a deletion mutant lacking the cAMP-responsive element showed impaired PKA-dependent activation but remained completely sensitive to activation by rosiglitazone (Fig. 5BGo). The separate actions of cAMP-dependent pathways and TZD effects on PGC-1{alpha} gene transcription are consistent with the distant placement of their respective cis-acting elements in the PGC-1{alpha} promoter.


Figure 5
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 5. Identification of a PPAR{gamma}-responsive element in the PGC-1{alpha} gene promoter. A, Sequence of the PPAR{gamma}-response element in the mouse PGC-1{alpha} gene promoter and comparison with similar sequences in PGC-1{alpha} promoters from other species. Arrows indicate one-base spaced direct repeat alignment. B, Effects of points mutations in the PPAR{gamma}-response element (shown as asterisks in A) or deletion mutation of the proximal cAMP response element (see Materials and Methods) on the responsiveness of the PGC-1{alpha} gene promoter activity to rosiglitazone, PPAR{gamma}, and PKA. The wild-type (2553 PGC-1{alpha}-Luc) and mutated (2553-PPREmutPGC-1{alpha}-Luc, 2553-CREmutPGC-1{alpha}-Luc) plasmid constructs were transfected and treated as in Fig. 4Go. Results show the mean ± SEM of three to five independent experiments done in triplicate. *, Statistically significant differences (P < 0.05) due to rosiglitazone treatment or PKA cotransfection; #, Statistically significant differences (P < 0.05) observed after comparing either constructs at equal conditions of cotransfection or treatment.

 
To determine whether PPAR{gamma} binds the PGC-1{alpha} promoter, EMSA was performed using as probe an oligonucleotide corresponding to the –2036 to –2062 region. Incubation with a mixture of PPAR{gamma} and RXR{alpha} translation products led to the appearance of a specific retarded band. (Fig. 6Go, left panel) When the labeled probe was incubated with nuclear extracts from brown adipose tissue, several specific bands appeared. Incubation with the antibody against PPAR{gamma} led to the appearance of a novel, low-mobility, band (supershift) associated with a marked reduction in the intensity of two bands of higher mobility (Fig. 6Go, center panel). Incubation with an unrelated antibody (against C/EBP{delta}), used as a negative control, did not show any effect on the pattern of retarded bands. When a parallel EMSA was performed using nuclear extracts from brown adipocytes differentiated in primary culture, results were identical (Fig. 6Go, right panel). These findings indicate that the PPAR{gamma}-responsive sequence in the PGC-1{alpha} promoter binds PPAR{gamma} present in brown adipocyte nuclei. EMSA of an oligonucleotide corresponding to the mutated form used to disrupt PPAR{gamma} responsiveness confirmed the loss of binding of the PPAR{gamma}-containing complexes when incubated with either PPAR{gamma}/RXR{alpha} translation products (Fig. 6Go, left panel) or differentiated brown adipocyte nuclear extracts (Fig. 6Go, right panel).


Figure 6
View larger version (55K):
[in this window]
[in a new window]
 
FIG. 6. EMSA of PPAR{gamma} binding to the PPAR{gamma}-response element in the PGC-1{alpha} gene promoter. Double-stranded oligonucleotides corresponding to –2036/–2062 region of the mouse PGC-1{alpha} gene promoter (–2036/–2062 wt) or a mutated version designed to impair PPAR{gamma}/RXR binding (–2036/–2062 mut) (see Materials and Methods) were used as a labeled probes. Five microliters of in vitro-transcribed/translated PPAR{gamma} plus RXR{alpha} protein extract or unprogrammed lysate (left), 5 µg of nuclear protein extracts from mouse brown adipose tissue (center), or 5 µg of nuclear protein extracts from brown adipocytes in primary culture (right) were incubated as described in Materials and Methods and when indicated, antibodies (Ab) against PPAR{gamma} and C/EBP{delta} (negative control) were added. x 100 wt means addition of 100-fold excess unlabeled nonmutated probe (Comp). Arrows indicate super-shifted (up) or weakened (down) bands.

 
To further examine the interaction of PPAR{gamma} with the PGC-1{alpha} distal promoter region in vivo, ChIP experiments were performed in HIB-1B cells. Immunoprecipitation of protein-DNA complexes with the PPAR{gamma} antibody caused a dramatic enrichment in the 378-bp PCR product corresponding to the –2172/–1794 region of the endogenous PGC-1{alpha} gene containing the PPRE (Fig. 7AGo). To establish the involvement of the PPRE element, ChIP experiments were performed comparing HIB-1B cells transfected with the –2553-PGC-1{alpha}-Luc or the –2553-PPREmut-PGC-1{alpha}-Luc plasmids. After immunoprecipitation with the PPAR{gamma} antibody, PCR amplification detected enrichment in the 378-bp fragment of DNA region containing the PPRE in cells transfected with –2553-PGC-1{alpha}-Luc (Fig. 7BGo). Conversely, when the –2553-PPREmut-PGC-1{alpha}-Luc was transfected, immunoprecipitation of that DNA fragment with the PPAR{gamma} antibody was not enriched, compared with a similarly handled sample in the absence of the specific antibody. These results confirm the interaction of PPAR{gamma} with the PPRE element in the distal region of the PGC-1{alpha} gene promoter.


Figure 7
View larger version (29K):
[in this window]
[in a new window]
 
FIG. 7. ChIP analysis of PPAR{gamma} binding to the PGC-1{alpha} gene promoter. PPAR{gamma} antibody (+) or an unrelated Ig (–) was used to immunoprecipitate the protein-DNA complexes (see Materials and Methods). A, ChIP analysis of the PPAR{gamma} binding to the endogenous PGC-1{alpha} gene promoter in HIB-1B cells transfected with the PPAR{gamma} expression vector and treated with 10 µM rosiglitazone. Arrows indicate the 378-bp PGC-1{alpha} and 237-bp cyclophylin A (Cyp) PCR products. No DNA and control represent negative and positive PCR controls. B, HIB-1B cells were transfected with the plasmids –2553-PGC-1{alpha}-Luc and –2553-PPREmut-PGC-1{alpha}-Luc always in the presence of PPAR{gamma} expression vector and 10 µM rosiglitazone. Immunoprecipitation and PCR amplification were performed as in A.

 
PGC-1{alpha} coactivate the PPAR{gamma}-dependent activation of its own gene in response to TZDs
The identification of PGC-1{alpha} as a target gene of PPAR{gamma}-mediated TZDs activation suggested the possibility that PGC-1{alpha}, as a coactivator of PPAR{gamma}, could be involved in the regulation of its own gene expression. To check this possibility, primary cultures of brown adipocytes were transduced with an adenoviral vector driving PGC-1{alpha} expression. Northern blot analyses using the PGC-1{alpha} cDNA as probe allowed discrimination between the adenoviral-driven recombinant PGC-1{alpha} transcript (3.0 kb) and the endogenous PGC-1{alpha} transcripts (6.5 and 5.0 kb) (Fig. 8AGo). In the absence of exogenous PGC-1{alpha}, rosiglitazone caused a 5.4 ± 0.6-fold induction of PGC-1{alpha} mRNA (Fig. 8AGo), and when exogenous PGC-1{alpha} was overexpressed, the induction became significantly higher (9.1 ± 1.2-fold, P < 0.05). PGC-1{alpha} alone did not modify endogenous PGC-1{alpha} mRNA expression in the absence of rosiglitazone. The same results were obtained in HIB-1B cells (not shown). For comparison, we analyzed the expression of UCP1 mRNA, a bona-fide target of PGC-1{alpha} coactivation of PPAR{gamma}-dependent regulation (7). As for the endogenous PGC-1{alpha} mRNA, the stimulus of UCP1 mRNA expression by rosiglitazone was enhanced by PGC-1{alpha} overexpression (Fig. 8AGo). However, in this case PGC-1{alpha} alone also induced UCP1 mRNA. In contrast, aP2/FABP mRNA was induced by rosiglitazone, but this was not enhanced by PGC-1{alpha} overexpression. To establish whether the coactivation of PGC-1{alpha} gene expression by itself involves the transcriptional activation of the promoter in response to TZDs, HIB-1B cells were transfected with –2553-PGC-1{alpha}-Luc and exposed to rosiglitazone in the presence or absence of a cotransfected expression vector for PGC-1{alpha}. Cotransfection with PGC-1{alpha} increased the expression of PGC-1{alpha} promoter activity in response to rosiglitazone in the presence of PPAR{gamma} (Fig. 8BGo).


Figure 8
View larger version (37K):
[in this window]
[in a new window]
 
FIG. 8. PGC-1{alpha} coactivate the PPAR{gamma}-mediated effects of rosiglitazone on its own gene expression. A, Representative Northern blot analysis of RNA from murine brown adipocytes in primary culture transduced with an adenoviral vector driving recombinant PGC-1{alpha} expression (Ad-PGC-1{alpha}) or a control vector (Ad-GFP), treated or not with 10 µM rosiglitazone. Blot was probed with PGC-1{alpha} cDNA as well as with the UCP1 cDNA and aP2/FABP cDNA probes to detect recombinant, adenoviral mediated PGC-1{alpha} transcript and the endogenous PGC-1{alpha} mRNA. B, Effects of cotransfection with a PGC-1{alpha} expression vector on PGC-1{alpha} promoter activity in response to rosiglitazone and cotransfected PPAR{gamma}. Experimental details were as in Fig. 5Go. Results show the mean ± SEM of at least three independent experiments done in triplicate. *, Statistically significant differences (P < 0.05) with respect to controls; #, Statistically significant differences (P < 0.05) due to PGC-1{alpha} cotransfection.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Present findings indicate that the PGC-1{alpha} gene is a direct target of TZD in brown and white adipocytes, and this is due to the presence of a PPAR{gamma}-responsive site in the distal PGC-1{alpha} promoter region. This constitutes a novel regulatory pathway of the PGC-1{alpha} gene, distinct from the adrenergic, cAMP-mediated regulation. This induction of PGC-1{alpha} expression would be amplified by the occurrence of an autoregulatory loop mediated by the coactivation of the PPAR{gamma} action on PGC-1{alpha} gene transcription by PGC-1{alpha} itself, a mechanism of feed-forward regulation in response to TZDs. This capacity of PGC-1{alpha} to coactivate the action of PPAR{gamma} to the PPAR-responsive element in the PGC-1{alpha} gene in response to TZDs is similar to that of other genes, such as the brown fat UCP1 gene (present results and Refs.7 and 33). However, it contrasts with the behavior of other genes such as aP2/FABP, which, in accordance with previous reports (7), is insensitive to PGC-1{alpha} coactivation, although it is also PPAR{gamma} responsive. Differential control of the transcriptional activity of PPAR{gamma} and TZDs on target genes expressed in adipocytes has recently been shown to involve selective dissociation of corepressors (34). During the present study, it was reported that TZDs induce PGC-1{alpha} in white adipocytes, in agreement with our present findings, and this has been proposed to contribute to the regulation by TZDs of the expression of genes such as glycerol kinase (34).

The presence of a PPAR{gamma}-responsive element in the PGC-1{alpha} gene explains the induction of PGC-1{alpha} gene expression in white adipose tissue depots after chronic treatment of rodents with TZDs (14) and even with non-TZD PPAR{gamma} activators (35). Moreover, the presence of a PPAR{gamma}-responsive element in the PGC-1{alpha} gene that binds PPAR{gamma}/RXR heterodimers is consistent with the observed induction of the PGC-1{alpha} gene by rexinoids, selective RXR activators, considering the known ligand-dependent sensitivity of the RXR moiety in the PPAR{gamma}/RXR heterodimers (36). Treatment of experimental animals with rexinoids mimics some of the effects of PPAR{gamma} activation by TZDs, including insulin sensitization. However, the more pleiotropic effects of rexinoids caused by the capacity of RXR to dimerize with members of the nuclear hormone receptor superfamily other than PPAR{gamma} have precluded to date their clinical use in type 2 diabetes (37). Finally, the presence of a PPAR{gamma}-responsive element in the PGC-1{alpha} gene raises the possibility that this element could also mediate regulation by other PPAR subtypes. In some target genes of PPAR{gamma}, such as lipoprotein lipase gene, the PPAR{gamma}-responsive element mediates response to TZDs in adipose tissue but also response to fibrates in liver, via PPAR{alpha}-dependent activation (38). It has been reported that PPAR{delta} activators induce PGC-1{alpha} gene expression in differentiated muscle cells, whereas activators of PPAR{alpha} do not (39). Further research will be needed to assess the action of PPAR subtypes on the PGC-1{alpha} gene and their relation to the tissue-specific effects of drugs capable of activating these receptors.

The effects of PGC-1{alpha} induction by TZDs in adipocytes may entail enhancement of oxidative capacity in adipose tissue, which could constitute a major therapeutic mechanism of TZD action. PGC-1{alpha} overexpression in rodent or human white adipose cells in culture promotes mitochondriogenesis (6, 9). Moreover, the present findings may explain recent reports indicating that TZDs induce a coordinate up-regulation of genes encoding the mitochondrial oxidation machinery in human adipose tissue from diabetic patients (3, 40). Accordingly, experimental treatments in rodents had already evidenced mitochondrial remodeling and enhanced energy expenditure in white fat in response to TZDs (15), including increased PGC-1{alpha} expression (14). Impaired mitochondrial oxidative capacity in skeletal muscle, particularly of genes that are targets of PGC-1{alpha}, has been identified as an early event associated with insulin resistance and type 2 diabetes (11, 12). Although this has not been unequivocally established in adipose tissue, experimental interventions promoting white adipose tissue oxidative capacity, i.e. through ectopic expression of the brown fat UCP1, improve overall energy expenditure and protect against diet-induced obesity (41). In fact, some of the biological effects of TZDs acting via the induction of PGC-1{alpha} gene expression would consist in promoting a brown fat-like phenotype in adipose depots. It has recently been demonstrated that reduced expression of marker genes characteristic of the brown adipocyte phenotype is associated with insulin resistance in patients with type 2 diabetes (16). Enhancement of brown fat-like features in adipose depots, i.e. high PGC-1{alpha} expression and promotion of mitochondrial oxidative activity and energy expenditure in response to TZDs, could be a major element in the insulin sensitizing action of these drugs because it would enhance fatty acid oxidation inside the adipose depots, thus contributing to the lowering in free fatty acids and subsequent prevention of lipotoxicity.


    Acknowledgments
 
We thank Drs. B. Spiegelman and P. Puigserver for PGC-1{alpha} expression vectors and promoter construct and for HIB-1B cells and Drs. R. Evans and H. H. Samuels for expression vectors.


    Footnotes
 
This work was supported by Grants SAF2002-03648 and SAF2005-01722 from Ministerio de Ciencia y Tecnologia and Grant C03/08 from Instituto Carlos III. Ministerio de Sanidad y Consumo, Spain. O.M. was supported by Generalitat de Catalunya (2004PIV210) and Programa de Apoyo para la Superación del Personal Académico, Universidad Nacional Autónoma de México.

Present address for O.M.: Laboratorio de Rumiología y Metabolismo Nutricional. Facultad de Estudios Superiores Cuautitlán, Universidad Nacional Autónoma de México.

Disclosure statement: E.H., O.M., P.Y., M.R.d.l.C., R.I., M.G., and F.V. have nothing to declare.

First Published Online March 2, 2006

Abbreviations: aP2, Adipocyte P2; C/EBP, CCAAT/enhancer-binding protein; ChIP, chromatin immunoprecipitation; 9-cis RA, 9-cis retinoic acid; COII, cytochrome oxidase subunit II; COIV, cytochrome oxidase subunit IV; CREB, cAMP response element-binding protein; FABP, fatty acid binding protein; GFP, green fluorescent protein; PGC, PPAR coactivator; PKA, protein kinase A; PPAR, peroxisome proliferator-activated receptor; PPRE, PPAR-responsive element; RXR, retinoid X receptor; TZD, thiazolidinedione; UCP, uncoupling protein.

Received January 18, 2006.

Accepted for publication February 23, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Yki-Jarvinen H 2004 Thiazolidinediones. N Engl J Med 351:1106–1118[Free Full Text]
  2. Kintscher U, Law RE 2005 PPAR{gamma}-mediated insulin sensitization: the importance of fat versus muscle. Am J Physiol Endocrinol Metab 288:E287–E291
  3. Boden G, Homko C, Mozzoli M, Showe LC, Nichols C, Cheung P 2005 Thiazolidinediones upregulate fatty acid uptake and oxidation in adipose tissue of diabetic patients. Diabetes 54:880–885[Abstract/Free Full Text]
  4. Puigserver P, Spiegelman BM 2003 Peroxisome proliferator-activated receptor-{gamma} coactivator 1{alpha} (PGC-1{alpha}): transcriptional coactivator and metabolic regulator. Endocr Rev 24:78–90[Abstract/Free Full Text]
  5. Yoon JC, Puigserver P, Chen G, Donovan J, Wu Z, Rhee J, Adelmant G, Stafford J, Kahn CR, Granner DK, Newgard CB, Spiegelman BM 2001 Control of hepatic gluconeogenesis through the transcriptional coactivator PGC-1. Nature 413:131–138[CrossRef][Medline]
  6. Wu Z, Puigserver P, Andersson U, Zhang C, Adelmant G, Mootha V, Troy A, Cinti S, Lowell B, Scarpulla RC, Spiegelman BM 1999 Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1. Cell 98:115–124[CrossRef][Medline]
  7. Puigserver P, Wu Z, Park CW, Graves R, Wright M, Spiegelman BM 1998 A cold-inducible coactivator of nuclear receptors linked to adaptive thermogenesis. Cell 92:829–839[CrossRef][Medline]
  8. Larrouy D, Vidal H, Andreelli F, Laville M, Langin D 1999 Cloning and mRNA tissue distribution of human PPAR{gamma} coactivator-1. Int J Obes Relat Metab Disord 23:1327–1332[CrossRef][Medline]
  9. Tiraby C, Tavernier G, Lefort C, Larrouy D, Bouillaud F, Ricquier D, Langin D 2003 Acquirement of brown fat cell features by human white adipocytes. J Biol Chem 278:33370–33376[Abstract/Free Full Text]
  10. Kakuma T, Wang ZW, Pan W, Unger RH, Zhou YT 2000 Role of leptin in peroxisome proliferator-activated receptor {gamma} coactivator-1 expression. Endocrinology 141:4576–4582[Abstract/Free Full Text]
  11. Mootha VK, Lindgren CM, Eriksson KF, Subramanian A, Sihag S, Lehar J, Puigserver P, Carlsson E, Ridderstrale M, Laurila E, Houstis N, Daly MJ, Patterson N, Mesirov JP, Golub TR, Tamayo P, Spiegelman B, Lander ES, Hirschhorn JN, Altshuler D, Groop LC 2003 PGC-1{alpha}-responsive genes involved in oxidative phosphorylation are coordinately downregulated in human diabetes. Nat Genet 34:267–273[CrossRef][Medline]
  12. Patti ME, Butte AJ, Crunkhorn S, Cusi K, Berria R, Kashyap S, Miyazaki Y, Kohane I, Costello M, Saccone R, Landaker EJ, Goldfine AB, Mun E, DeFronzo R, Finlayson J, Kahn CR, Mandarino LJ 2003 Coordinated reduction of genes of oxidative metabolism in humans with insulin resistance and diabetes: potential role of PGC1 and NRF1. Proc Natl Acad Sci USA 100:8466–8471[Abstract/Free Full Text]
  13. Ling C, Poulsen P, Carlsson E, Ridderstrale M, Almgren P, Wojtaszewski J, Beck-Nielsen H, Groop L, Vaag A 2004 Multiple environmental and genetic factors influence skeletal muscle PGC-1{alpha} and PGC-1ß gene expression in twins. J Clin Invest 114:1518–1526[CrossRef][Medline]
  14. Wilson-Fritch L, Nicoloro S, Chouinard M, Lazar MA, Chui PC, Leszyk J, Straubhaar J, Czech MP, Corvera S 2004 Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone. J Clin Invest 114:1281–1289[CrossRef][Medline]
  15. Wilson-Fritch L, Burkart A, Bell G, Mendelson K, Leszyk J, Nicoloro S, Czech M, Corvera S 2003 Mitochondrial biogenesis and remodeling during adipogenesis and in response to the insulin sensitizer rosiglitazone. Mol Cell Biol 23:1085–1094[Abstract/Free Full Text]
  16. Yang X, Enerback S, Smith U 2003 Reduced expression of FOXC2 and brown adipogenic genes in human subjects with insulin resistance. Obes Res 11:1182–1191[Medline]
  17. McCarty MF 2005 Up-regulation of PPAR{gamma} coactivator-1{alpha} as a strategy for preventing and reversing insulin resistance and obesity. Med Hypotheses 64:399–407[CrossRef][Medline]
  18. Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman BM, Collins S 2004 p38 mitogen-activated protein kinase is the central regulator of cyclic AMP-dependent transcription of the brown fat uncoupling protein 1 gene. Mol Cell Biol 24:3057–3067[Abstract/Free Full Text]
  19. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C, Puigserver P, Spiegelman B, Montminy M 2001 CREB regulates hepatic gluconeogenesis through the coactivator PGC-1. Nature 413:179–183[CrossRef][Medline]
  20. Handschin C, Rhee J, Lin J, Tarr PT, Spiegelman BM 2003 An autoregulatory loop controls peroxisome proliferator-activated receptor {gamma} coactivator 1{alpha} expression in muscle. Proc Natl Acad Sci USA 100:7111–7116[Abstract/Free Full Text]
  21. Alvarez R, de Andres J, Yubero P, Vinas O, Mampel T, Iglesias R, Giralt M, Villarroya F 1995 A novel regulatory pathway of brown fat thermogenesis. Retinoic acid is a transcriptional activator of the mitochondrial uncoupling protein gene. J Biol Chem 270:5666–5673[Abstract/Free Full Text]
  22. Ross SR, Choy L, Graves RA, Fox N, Solevjeva V, Klaus S, Ricquier D, Spiegelman BM 1992 Hibernoma formation in transgenic mice and isolation of a brown adipocyte cell line expressing the uncoupling protein gene. Proc Natl Acad Sci USA 89:7561–7565[Abstract/Free Full Text]
  23. Knight DM, Chapman AB, Navre M, Drinkwater L, Bruno JJ, Ringold GM 1987 Requirements for triggering of adipocyte differentiation by glucocorticoids and indomethacin. Mol Endocrinol 1:36–43[Abstract/Free Full Text]
  24. Yubero P, Hondares E, Carmona MC, Rossell M, Gonzalez FJ, Iglesias R, Giralt M, Villarroya F 2004 The developmental regulation of peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} expression in the liver is partially dissociated from the control of gluconeogenesis and lipid catabolism. Endocrinology 145:4268–4277[Abstract/Free Full Text]
  25. Bouillaud F, Ricquier D, Thibault J, Weissenbach J 1985 Molecular approach to thermogenesis in brown adipose tissue: cDNA cloning of the mitochondrial uncoupling protein. Proc Natl Acad Sci USA 82:445–448[Abstract/Free Full Text]
  26. Hunt CR, Ro JH, Dobson DE, Min HY, Spiegelman BM 1986 Adipocyte P2 gene: developmental expression and homology of 5'-flanking sequences among fat cell-specific genes. Proc Natl Acad Sci USA 83:3786–3790[Abstract/Free Full Text]
  27. Glaichenhaus N, Leopold P, Cuzin F 1986 Increased levels of mitochondrial gene expression in rat fibroblast cells immortalized or transformed by viral and cellular oncogenes. EMBO J 5:1261–1265[Medline]
  28. Nudel U, Zakut R, Shani M, Neuman S, Levy Z, Yaffe D 1983 The nucleotide sequence of the rat cytoplasmic ß-actin gene. Nucleic Acids Res 11:1759–1771[Abstract/Free Full Text]
  29. Kliewer SA, Forman BM, Blumberg B, Ong ES, Borgmeyer U, Mangelsdorf DJ, Umesono K, Evans RM 1994 Differential expression and activation of a family of murine peroxisome proliferator-activated receptors. Proc Natl Acad Sci USA 19:7355–7359
  30. Mangelsdorf DJ, Ong ES, Dyck JA, Evans RM 1990 Nuclear receptor that identifies a novel retinoic acid response pathway. Nature 345:224–229[CrossRef][Medline]
  31. Muramatsu M, Kaibuchi K, Arai K 1989 A protein kinase C cDNA without the regulatory domain is active after transfection in vivo in the absence of phorbol ester. Mol Cell Biol 9:831–836[Abstract/Free Full Text]
  32. Yubero P, Barbera MJ, Alvarez R, Vinas O, Mampel T, Iglesias R, Villarroya F, Giralt M 1998 Dominant-negative regulation by c-Jun of transcription of the uncoupling protein-1 gene through a proximal cAMP-regulatory element: a mechanism for repressing basal and norepinephrine-induced expression of the gene before brown adipocyte differentiation. Mol Endocrinol 12:1023–1037[Abstract/Free Full Text]
  33. Barbera MJ, Schluter A, Pedraza N, Iglesias R, Villarroya F, Giralt M 2001 Peroxisome proliferator-activated receptor {alpha} activates transcription of the brown fat uncoupling protein-1 gene. A link between regulation of the thermogenic and lipid oxidation pathways in the brown fat cell. J Biol Chem 276:1486–1493[Abstract/Free Full Text]
  34. Guan HP, Ishizuka T, Chui PC, Lehrke M, Lazar MA 2005 Corepressors selectively control the transcriptional activity of PPAR{gamma} in adipocytes. Genes Dev 19:453–461[Abstract/Free Full Text]
  35. Sell H, Berger JP, Samson P, Castriota G, Lalonde J, Deshaies Y, Richard D 2004 Peroxisome proliferator-activated receptor {gamma} agonism increases the capacity for sympathetically mediated thermogenesis in lean and ob/ob mice. Endocrinology 145:3925–3934[Abstract/Free Full Text]
  36. Mukherjee R, Davies PJ, Crombie DL, Bischoff ED, Cesario RM, Jow L, Hamann LG, Boehm MF, Mondon CE, Nadzan AM, Paterniti Jr JR, Heyman RA 1997 Sensitization of diabetic and obese mice to insulin by retinoid X receptor agonists. Nature 386:407–410[CrossRef][Medline]
  37. Villarroya F, Iglesias R, Giralt M 2005 Retinoids and retinoid receptors in the control of energy balance: novel pharmacological strategies in obesity and diabetes. Curr Med Chem 11:795–805
  38. Schoonjans K, Peinado-Onsurbe J, Lefebvre AM, Heyman RA, Briggs M, Deeb S, Staels B, Auwerx J 1996 PPAR{alpha} and PPAR{gamma} activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene. EMBO J 15:5336–5348[Medline]
  39. Tanaka T, Yamamoto J, Iwasaki S, Asaba H, Hamura H, Ikeda Y, Watanabe M, Magoori K, Ioka RX, Tachibana K, Watanabe Y, Uchiyama Y, Sumi K, Iguchi H, Ito S, Doi T, Hamakubo T, Naito M, Auwerx J, Yanagisawa M, Kodama T, Sakai J 2003 Activation of peroxisome proliferator-activated receptor {Delta} induces fatty acid ß-oxidation in skeletal muscle and attenuates metabolic syndrome. Proc Natl Acad Sci USA 100:15924–15929[Abstract/Free Full Text]
  40. Bogacka I, Xie H, Bray GA, Smith SR 2005 Pioglitazone induces mitochondrial biogenesis in human subcutaneous adipose tissue in vivo. Diabetes 54:1392–1399[Abstract/Free Full Text]
  41. Kopecky J, Rossmeisl M, Hodny Z, Syrovy I, Horakova M, Kolarova P 1996 Reduction of dietary obesity in aP2-Ucp transgenic mice: mechanism and adipose tissue morphology. Am J Physiol 270:E776–E786



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
W. Chowanadisai, K. A. Bauerly, E. Tchaparian, A. Wong, G. A. Cortopassi, and R. B. Rucker
Pyrroloquinoline Quinone Stimulates Mitochondrial Biogenesis through cAMP Response Element-binding Protein Phosphorylation and Increased PGC-1{alpha} Expression
J. Biol. Chem., January 1, 2010; 285(1): 142 - 152.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
J. Shin, B. Li, M. E. Davis, Y. Suh, and K. Lee
Comparative analysis of fatty acid-binding protein 4 promoters: Conservation of peroxisome proliferator-activated receptor binding sites
J Anim Sci, December 1, 2009; 87(12): 3923 - 3934.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Amat, A. Planavila, S. L. Chen, R. Iglesias, M. Giralt, and F. Villarroya
SIRT1 Controls the Transcription of the Peroxisome Proliferator-activated Receptor-{gamma} Co-activator-1{alpha} (PGC-1{alpha}) Gene in Skeletal Muscle through the PGC-1{alpha} Autoregulatory Loop and Interaction with MyoD
J. Biol. Chem., August 14, 2009; 284(33): 21872 - 21880.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
J. L. Estall, M. Kahn, M. P. Cooper, f. M. Fisher, M. K. Wu, D. Laznik, L. Qu, D. E. Cohen, G. I. Shulman, and B. M. Spiegelman
Sensitivity of Lipid Metabolism and Insulin Signaling to Genetic Alterations in Hepatic Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator-1{alpha} Expression
Diabetes, July 1, 2009; 58(7): 1499 - 1508.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
P. Seale, S. Kajimura, and B. M. Spiegelman
Transcriptional control of brown adipocyte development and physiological function--of mice and men
Genes & Dev., April 1, 2009; 23(7): 788 - 797.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Pagel-Langenickel, J. Bao, J. J. Joseph, D. R. Schwartz, B. S. Mantell, X. Xu, N. Raghavachari, and M. N. Sack
PGC-1{alpha} Integrates Insulin Signaling, Mitochondrial Regulation, and Bioenergetic Function in Skeletal Muscle
J. Biol. Chem., August 15, 2008; 283(33): 22464 - 22472.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
N. Petrovic, I. G. Shabalina, J. A. Timmons, B. Cannon, and J. Nedergaard
Thermogenically competent nonadrenergic recruitment in brown preadipocytes by a PPAR{gamma} agonist
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E287 - E296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Coll, E. Eyre, R. Rodriguez-Calvo, X. Palomer, R. M. Sanchez, M. Merlos, J. C. Laguna, and M. Vazquez-Carrera
Oleate Reverses Palmitate-induced Insulin Resistance and Inflammation in Skeletal Muscle Cells
J. Biol. Chem., April 25, 2008; 283(17): 11107 - 11116.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
G. J. Hausman, S. P. Poulos, T. D. Pringle, and M. J. Azain
The influence of thiazolidinediones on adipogenesis in vitro and in vivo: Potential modifiers of intramuscular adipose tissue deposition in meat animals
J Anim Sci, April 1, 2008; 86(14_suppl): E236 - E243.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Brodbeck, M. E. Balestra, A. M. Saunders, A. D. Roses, R. W. Mahley, and Y. Huang
Rosiglitazone increases dendritic spine density and rescues spine loss caused by apolipoprotein E4 in primary cortical neurons
PNAS, January 29, 2008; 105(4): 1343 - 1346.
[Abstract] [Full Text] [PDF]


Home page
Diabetes CareHome page
I. Bogacka, T. W. Gettys, L. de Jonge, T. Nguyen, J. M. Smith, H. Xie, F. Greenway, and S. R. Smith
The Effect of {beta}-Adrenergic and Peroxisome Proliferator-Activated Receptor-{gamma} Stimulation on Target Genes Related to Lipid Metabolism in Human Subcutaneous Adipose Tissue
Diabetes Care, May 1, 2007; 30(5): 1179 - 1186.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Schupp, J. C. Curtin, R. J. Kim, A. N. Billin, and M. A. Lazar
A Widely Used Retinoic Acid Receptor Antagonist Induces Peroxisome Proliferator-Activated Receptor-{gamma} Activity
Mol. Pharmacol., May 1, 2007; 71(5): 1251 - 1257.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
E. Chevillotte, M. Giralt, B. Miroux, D. Ricquier, and F. Villarroya
Uncoupling Protein-2 Controls Adiponectin Gene Expression in Adipose Tissue Through the Modulation of Reactive Oxygen Species Production
Diabetes, April 1, 2007; 56(4): 1042 - 1050.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
J. G. Duncan, J. L. Fong, D. M. Medeiros, B. N. Finck, and D. P. Kelly
Insulin-Resistant Heart Exhibits a Mitochondrial Biogenic Response Driven by the Peroxisome Proliferator-Activated Receptor-{alpha}/PGC-1{alpha} Gene Regulatory Pathway
Circulation, February 20, 2007; 115(7): 909 - 917.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
C. Handschin and B. M. Spiegelman
Peroxisome Proliferator-Activated Receptor {gamma} Coactivator 1 Coactivators, Energy Homeostasis, and Metabolism
Endocr. Rev., December 1, 2006; 27(7): 728 - 735.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
T. Coll, M. Jove, R. Rodriguez-Calvo, E. Eyre, X. Palomer, R. M. Sanchez, M. Merlos, J. C. Laguna, and M. Vazquez-Carrera
Palmitate-Mediated Downregulation of Peroxisome Proliferator-Activated Receptor-{gamma} Coactivator 1{alpha} in Skeletal Muscle Cells Involves MEK1/2 and Nuclear Factor-{kappa}B Activation.
Diabetes, October 1, 2006; 55(10): 2779 - 2787.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hondares, E.
Right arrow Articles by Villarroya, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hondares, E.
Right arrow Articles by Villarroya, F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals