help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2005-1559
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/6/2902    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luque, R. M.
Right arrow Articles by Castaño, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luque, R. M.
Right arrow Articles by Castaño, J. P.
Endocrinology Vol. 147, No. 6 2902-2908
Copyright © 2006 by The Endocrine Society

Identification of the Somatostatin Receptor Subtypes (sst) Mediating the Divergent, Stimulatory/Inhibitory Actions of Somatostatin on Growth Hormone Secretion

Raúl M. Luque, Mario Durán-Prado, Socorro García-Navarro, Francisco Gracia-Navarro, Rhonda D. Kineman, María M. Malagón and Justo P. Castaño

Department of Cell Biology, Physiology, and Immunology (R.M.L., M.D.-P., S.G.-N., F.G.-N., M.M.M., J.P.C.), University of Córdoba, E-14014 Córdoba, Spain; and Department of Medicine (R.M.L., R.D.K.), Jesse Brown Veterans Affairs Medical Center, University of Illinois at Chicago, Chicago, Illinois 60612

Address all correspondence and requests for reprints to: Dr. Justo P. Castaño, Department of Cell Biology, Physiology, and Immunology, Campus de Rabanales. Edificio Severo Ochoa. Planta 3, University of Córdoba, E-14014 Córdoba, Spain. E-mail: justo{at}uco.es.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
It is well established that somatostatin acts through G protein-coupled receptors, termed sst, to inhibit GH release. However in pigs somatostatin can stimulate or inhibit in vitro GH secretion in a dose- and somatotrope subpopulation-dependent manner. We report herein that somatostatin-stimulated GH release is blocked by pretreatment with GTP{gamma}-S, suggesting an involvement of G protein-coupled receptors. Consistent with this, an sst5 selective agonist stimulated spontaneous GH secretion at doses ranging 10–13 to 10–9 M, without influencing GHRH-induced GH release. Conversely, sst1-, sst2-, sst3-, and sst4-specific agonists inhibited GHRH-evoked GH release but not basal GH secretion. Examination of the effects of sst-specific agonists on two subpopulations of somatotrope cells separated by density gradient centrifugation [low- (LD) and high-density (HD) cells] showed that only a low dose of the sst5 agonist stimulated GH release in LD somatotropes, whereas both low and high doses of this agonist stimulated GH release in HD cells. In marked contrast, sst1 and sst2 agonists blocked GHRH-stimulated GH release in LD cells at all doses tested, whereas only a high dose of the sst2 agonist inhibited GHRH-induced GH release in HD somatotropes. Interestingly, sst expression pattern in these subpopulations correlates with the distinct actions of sst-selective agonists; specifically, sst5 is more abundant in HD somatotropes, whereas sst1 and sst2 mRNA predominate in LD cells. These results indicate that in the pig, sst1 and sst2 are the primary mediators of the inhibitory effects of somatostatin, whereas sst5 or an sst5-related mechanism mediates the stimulatory action of somatostatin on GH release.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
IN PORCINE SOMATOTROPES, somatostatin can either inhibit or stimulate GH secretion, depending on the dose used (1, 2, 3, 4 , and reviewed in Ref.5). Specifically, low doses of somatostatin (<10–10 M) stimulate GH release from primary pig pituitary cells, whereas high doses of somatostatin (>10–8 M) inhibit GHRH-stimulated GH release, without altering basal GH production (3). This paradoxical effect of somatostatin is closely related to the differential sensitivity exhibited by somatotrope subpopulations previously identified as low density (LD) and high density (HD), according to sedimentation after Percoll gradient centrifugation (1, 2, 4, 5). LD somatotropes represent 60% of the total somatotropes population and release GH at a high rate, with little storage of GH in cytoplasmic secretory vesicles. In this somatotrope subpopulation, somatostatin at high doses blunts GHRH-stimulated GH release (1, 2). In contrast, HD somatotropes represent 40% of the total somatotrope population and, despite their high basal secretory rate, store large amounts of GH within secretory vesicles (1, 2). Interestingly, HD cells respond to both low and high doses of somatostatin by releasing GH (1, 2).

To date, five different mammalian somatostatin receptor (sst) genes that encode at least six different receptor isoforms (sst1, 2a, 2b, 3, 4, and 5) have been identified. Multiple sst subtypes can be expressed in the same cell type, in which the pattern of expression is tissue specific (6). The pituitary gland of rat, mouse, pig, and human express all five receptor subtypes (6, 7, 8, 9), and the level of expression of each sst is dependent on age and physiologic status (6, 7, 10, 11). Studies using sst subtype-selective somatostatin analogs have shown that sst1, sst2, and sst5 contribute to somatostatin-mediated suppression of GH secretion in humans (12), rats (13, 14), mice (15), sheep (16), and chickens (17, 18). In the present study, we used synthetic nonpeptidyl selective sst agonists to determine whether different sst subtypes mediate the inhibitory and stimulatory actions of somatostatin on GH release from porcine pituitary cell cultures. In addition, we measured the level of sst1, sst2, and sst5 mRNA in LD and HD somatotrope populations to determine whether their differential responsiveness to somatostatin is related to differential expression of sst subtypes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Reagents
Unless otherwise indicated, chemical products and tissue culture reagents were purchased from Sigma Chemical Co. (London, UK). Porcine GH (pGH; USDA-B-1, AFP-11716C) was supplied by Dr. A. F. Parlow (Pituitary Hormones and Antisera Center, Harbor-University of California-Los Angeles Medical Center, Los Angeles, CA). Subtype-selective nonpeptidyl agonists for sst1, sst2, sst3, sst4, and sst5 (L-797,591; L-779,976; L-796,778; L-803,087, and L-817,818; respectively) (13) were generously provided by Dr. Susan P. Rohrer (Merck Research Laboratories, Rahway, NJ). Fetal bovine serum was obtained from Sera-Lab Ltd. (Crawley Down, UK). Somatostatin (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14) was purchased from Biogenesis (Poole, UK) and GHRH (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29) from UCB Bioproducts (Brain L’Alleud, Belgium). Tissue culture plasticware was from Costar (Cambridge, MA).

Animals and pituitary cell dispersion
Pituitary glands from prepuberal (4–6 months old) female Large-White/Landrace pigs were obtained from a local abattoir. According to European Regulations for Animal Care, animals were killed by exsanguination after electrical stunning and immediately decapitated. After the animals were killed, pituitaries were excised and stored in sterile ice-cold (4 C) culture medium (D-Val-modified MEM) containing 0.3% BSA, 0.58% of HEPES, 0.22% of NaHCO3 and 1% antibiotic-antimycotic solution (100 UI/ml penicillin, 100 µg/ml streptomycin, 0.25 µg/ml amphotericin B). At the laboratory, posterior lobes were removed and the anterior pituitaries were dispersed using an enzymatic and mechanical dispersion protocol described in detail previously (1, 4, 19).

For each experiment, three to four anterior pituitary glands were dispersed into single cells and filtered through a nylon filter (100 µm mesh) to obtain an initial cell suspension (ICS). The cell number was assessed by hemocytometer and cell viability was determined by the trypan blue exclusion test (>85%).

Cell culture and separation of subpopulations
After dispersion, 30–40 x 106 cells from the ICS were centrifuged (3000 x g, 25 min) in a hyperbolic, continuous Percoll density gradient (Amersham International, Buckinghamshire, UK) between 25 and 80% (1.033–1.121 g/cm3) to separate the two subpopulations of porcine somatotropes of low (LD; 1.051–1.064 g/cm3) and high (HD; 1076–1098 g/cm3) density, as characterized previously in our laboratory (1, 2, 19). ICS, LD, and HD cells were then plated onto 24-well tissue culture plates at a density of 3 x 105 cells/well in 1 ml MEM supplemented with 10% fetal bovine serum and gentamicin sulfate (50 µg/ml) and cultured for 3 d at 37 C in a humidified atmosphere (95% air-5% CO2).

Experimental design
After 3 d of culture, the medium was removed and cells were preincubated in 1 ml serum-free MEM for 4 h to stabilize basal GH secretion before adding test substances.

Experiment 1.
Cells were pretreated with GTP{gamma}-S (10 µM) or vehicle for 90 min, and culture media were then replaced with media containing GTP{gamma}-S alone and in combination with GHRH (10–8 M) or somatostatin (10–15 and 10–7 M).

Experiment 2.
Cultures were treated with nonpeptidyl sst selective agonists at doses ranging from 10–19 to 10–6 M.

Experiment 3.
Cultures were treated with agonists alone (10–7 and 10–15/10–11 M) or in combination with GHRH (10–8 M).

Experiment 4.
Cultures were treated with sst1, sst2, and sst5 agonists alone (10–7 and 10–15/10–11 M) or in combination with somatostatin (10–7 and 10–15 M). In all experiments medium was collected after 30 min of incubation with the test substance, centrifuged (2000 x g for 5 min) and stored at –20 C until analysis for pGH. The concentration of pGH in the culture media was determined by a homologous enzyme immunoassay as previously described (1).

RNA extraction and quantification by real-time PCR of pituitary sst1, sst2, and sst5
To determine the expression patterns of sst1, sst2, and sst5, total pituitary RNA was extracted from ICS, LD, and HD cultured cells and DNase treated and reversed transcribed, and receptor mRNA levels were determined by applying a real-time PCR assay as described below. In brief, highly specific primer pairs were used to selectively amplify sst1 (sst1_s: CAGCGTGCCCTTCTTGGTCACCTCC/sst1_AS: CAGTAAGACAGTAGATGCTGGTGAACATGTTGACTGC; GenBank no. AY138806); sst2 (sst2_S: GTCCACCCCATCAAGTCGGCCAAG/sst2_AS: TGCTTCTCCCCCACTGGTTGCTTCG; GenBank no. D21338); sst5 (sst5_S: GGGCCTTCTCGCTGGTCATGTCG/sst5_AS: GAGGTTGCAGGTGTTCCAGCCCTCCT; GenBank no. AY156052); and 18s gene (18s_S: CCCATTCGAACGTCTGCCCTATC/18s_AS: TGCTGCCTTCCTTGGATGTGGTA) used as internal control. These primer pairs yielded PCR products of 122, 142, 77, and 137 bp, respectively. Real-time PCR analysis was performed on an iCycler IQ (Bio-Rad Laboratories, Barcelona, Spain) using the SYBR green chemistry. The PCRs were carried out, per triplicate, in a final volume of 25 µl containing up to 50 ng of template, 0.5 µl of 10 µM of each primer, and 12.5 µl of 2 x IQ SYBR Green supermix (Bio-Rad). To amplify the p-sst5, the mix was supplemented with 5 µl of 1.5 M of betaine. The thermal cycling conditions comprises an initial denaturation and enzyme activation at 94 C for 5 min, 40 cycles at 94 C for 15 sec, 67 C for 15 sec, and 72 C for 15 sec, followed by a final melting curve to ensure the specificity of the amplicons. All the reactions were previously optimized to ensure efficiency of at least 85% using serial dilutions of each PCR product (5 orders of magnitude). Calculation of the relative expression levels was performed using the cycle threshold (Ct) values given by the thermal cycler software using the ICS samples as control. The data were analyzed according the equation 2–{Delta}{Delta}Ct, in which {Delta}Ct was determined by subtracting the corresponding 18s Ct value (internal control) from the specific Ct of each target, and {Delta}{Delta}Ct is obtained by subtracting the {Delta}Ct of each LD or HD sample from that of the ICS sample (used as reference, 100%).

Statistical analysis
Samples from each experiment were analyzed in the same assay and expressed as a percentage of the corresponding control value. Results are presented as mean ± SEM of three to six experiments (three to four replicate wells/treatment) performed on different pituitary cell preparations. Statistical analysis was carried out using a one-way ANOVA, followed by a statistical test for multiple comparisons (Duncan’s multiple range test and critical ranges) by use of the software package Statistica (StatSoft Inc., Tulsa, OK) or, for nonparametric data, a Friedman test followed by a Dunn’s multiple comparison test, using GraphPad Prism (GraphPad Software, San Diego, CA). Differences were considered significant at P < 0.05.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effect of GTP{gamma}-S on GHRH and somatostatin-regulated GH release
To determine whether the stimulatory effect of somatostatin on GH release involves G protein-coupled receptors, we evaluated the effect of pretreatment with GTP{gamma}-S, a nonhydrolyzable analog of GTP. Pretreatment with GTP{gamma}-S alone did not modify subsequent basal pGH secretion from ICS, LD, and HD cells in vitro. However, GTP{gamma}-S completely abolished the stimulatory response induced by somatostatin in all pituitary cell populations (Fig. 1Go). Consistent with the well-characterized actions of GHRH via G protein-coupled receptors, GTP{gamma}-S also blocked GHRH-stimulated pGH release in ICS cells (Fig. 1Go).


Figure 1
View larger version (18K):
[in this window]
[in a new window]
  		FIG. 1. In vitro secretory response of porcine somatotropes from ICS, LD, and HD to GHRH (10–8 M) and somatostatin (SRIF; 10–7 and 10–15 M) with or without GTP{gamma}-S (10 µM) for 30 min. To ensure that GTP{gamma}-S exerted its effect correctly at the beginning of the treatments, this activator was added to the incubation medium 90 min before addition of GHRH and somatostatin. Data are expressed as a percentage of basal control values (100%) and are the mean ± SEM of five separate experiments. P < 0.05 vs. control (100%) (a) and vs. same treatment without GTP{gamma}-S (b).

 
Effect of subtype-selective nonpeptidyl agonists on basal pGH secretion
To compare the effects of ligand-specific activation of sst1–5, total pituitary cell cultures (ICS) were treated with nonpeptidyl somatostatin agonists selective for sst1, sst2, sst3, sst4, or sst5 (10–19 to 10–6 M; Fig. 2Go). None of the agonists inhibited basal GH secretion at any of the doses tested. However, the sst5 agonist increased GH release at doses ranging from 10–13 to 10–9 M.


Figure 2
View larger version (22K):
[in this window]
[in a new window]
  		FIG. 2. Dose-response effects of sst agonists on porcine GH release from ICS cell cultures. Cultures were incubated with MEM (control) or 10–19 to 10–6 M agonists for 30 min. Data are expressed as percent of basal values (100%) in control experiments and are the mean ± SEM of six separate experiments. P < 0.05 vs. control (100%) (a).

 
Interaction of sst agonists with GHRH and somatostatin
Based on the above results and previous data on the effects of low and high doses of somatostatin (1, 2, 3, 4, 5), we selected low doses of sst1–4 (10–15 M) and sst5 (10–11 M) and high doses of sst1–5 (10–7 M) to test their effect in the presence of GHRH or somatostatin. As shown in Fig. 3Go, the sst1 agonist inhibited GHRH-evoked GH release from ICS cultures at both doses tested, 10–7 and 10–15 M, whereas the agonists selective for sst2, sst3, and sst4 inhibited GHRH-induced secretion only at 10–7 M. The sst5 selective analog did not alter GHRH-induced GH secretion at any dose tested.


Figure 3
View larger version (39K):
[in this window]
[in a new window]
  		FIG. 3. Secretory response of ICS porcine pituitary cell cultures to high and low doses of sst agonists (10–7 and 10–15 or 10–11 M) in the absence or presence of GHRH (10–8 M). Data are expressed as percent of basal control values (100%) and are the mean ± SEM of six separate experiments. P < 0.05 vs. control (100%) (a), vs. GHRH alone (b), and vs. agonists (10–15 M) alone (c).

 
We next investigated the possible interaction of somatostatin with sst1, sst2, and sst5 agonists because these three receptor subtypes are the main sst involved in the regulation of somatotropes in other species (6, 7, 10, 11, 12, 13, 14, 15, 16, 17, 18). As illustrated in Fig. 4Go, sst1 and sst2 agonists at high doses (10–7 M) blocked the stimulation caused by a low dose of somatostatin (10–15 M) in ICS cultures. The reciprocal was also true, i.e. the stimulatory response evoked by a low dose of the sst5 agonist (10–11 M) was blocked by high dose somatostatin (10–7 M). In addition, low doses (10–15 M) of sst1 and sst2 agonists blunted the stimulatory effect of a low dose of somatostatin (10–15 M), whereas a low dose of somatostatin combined with a low dose of sst5 agonist (10–11 M) evoked a similar stimulatory response to that observed using each compound separately.


Figure 4
View larger version (14K):
[in this window]
[in a new window]
  		FIG. 4. Secretory response of ICS porcine pituitary cell cultures to high (10–7 M) and low (10–15 M) doses of somatostatin in the absence or presence of specific sst agonists. A, Effect of a low dose of somatostatin (SRIF; 10–15 M) compared with the high doses (10–7 M) of sst1, sst2, and sst5 alone or in combination with the low dose of SRIF. B, Effect of a high dose of SRIF (10–7 M), compared with low doses of sst1 (10–15 M), sst2 (10–15 M), and sst5 (10–11 M) alone or in combination with the high dose of SRIF. C, Effect of a low dose of SRIF (10–15 M), compared with low doses of sst1 (10–15 M), sst2 (10–15 M), and sst5 (10–11 M) alone or in combination with the low dose of SRIF. Data are expressed as percent of basal control values (100%) and are the mean ± SEM of four separate experiments. In each experiment, all treatment groups were performed at the same time; however, to aid in visualization and interpretation of the data, the results are separated into three graphs (A–C). It should be noted that some values in C (shaded bars) are replicated from A and B to assist the reader in group comparisons. P < 0.05 vs. control (100%) (a), vs. somatostatin (10–15 M) alone (b), and vs. sst5 agonist (10–11 M alone) (c).

 
Effect of sst agonists on porcine somatotrope subpopulations
To further clarify the relative contribution of each single sst on the complex secretory response of porcine somatotropes, we studied the effect of sst1, sst2, and sst5 agonists alone or in combination with GHRH in the two subpopulations of somatotropes. Using this approach, we found that the sst1 and sst2 agonists blocked the stimulatory response of GHRH in the LD subpopulation at both doses tested (Fig. 5Go). In contrast, sst1 agonist failed to alter GHRH-induced GH release in HD cells (Fig. 5Go). On the other hand, only a high dose of sst2 agonist inhibited GHRH-induced GH release in HD somatotropes (Fig. 5Go).


Figure 5
View larger version (27K):
[in this window]
[in a new window]
  		FIG. 5. Secretory response of the two subpopulations of porcine somatotropes (LD and HD) to GHRH (G, 10–8 M) in the absence or presence of sst1, sst2, or sst5 agonists (A7, 10–7 M, and A15, 10–15 M, or A11, 10–11 M). Data are expressed as percent of basal control values (100%) and are the mean ± SEM of five separate experiments. Please note that the scales differ to best visualize the differences between treatment groups. P < 0.05 vs. control (100%) (a), vs. A7 alone (b), vs. A15 or A11 alone (c), and vs. GHRH alone (d). Con, Control.

 
In marked contrast with the other agonists, a low dose of the sst5 (10–11 M) agonist stimulated GH release alone and showed an additive effect with GHRH on GH secretion from both subpopulations of somatotropes, this response being of higher magnitude in HD cells, compared with LD cells (Fig. 5Go). Similar to the subpopulation-specific effects of somatostatin (1, 2), a high dose (10–7 M) of sst5 agonist stimulated GH release only in HD somatotropes.

Quantification of mRNA levels of sst1, sst2, and sst5
To determine whether the differential response of LD and HD cells to sst agonists is associated with a differential expression of somatostatin receptor subtypes (sst1, sst2, and sst5), we compared their relative mRNA levels in ICS, LD, and HD cells. As shown in Fig. 6Go, sst1 and sst2 were more abundantly expressed in LD cells (those sensitive to the inhibitory effect of somatostatin), whereas HD cells (those sensitive to the stimulatory effect of somatostatin) expressed more sst5 relative to LD cells.


Figure 6
View larger version (15K):
[in this window]
[in a new window]
  		FIG. 6. Expression levels of pig pituitary sst1, sst2, and sst5 in ICS, LD, and HD cells as measured by real-time RT-PCR using 18S as internal reference standard. Similar results were obtained using hypoxanthine-guanine phosphoribosyl transferase as standard or by applying a multiplex RT-PCR. Data are expressed as percent of ICS cell expression levels (100%) and are the mean ± SEM of six separate experiments. P < 0.05 vs. LD cells (a).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
It is commonly accepted that somatostatin acts as the primary physiologic inhibitor of somatotrope function by blocking basal and GHRH-stimulated GH secretion (6, 7, 10, 11). However, our group has demonstrated that somatostatin can function as a true GH-releasing factor in porcine pituitary cells cultures (1, 2, 3 , reviewed in Ref.5). Specifically, somatostatin can exert a stimulatory or inhibitory effect on GH release, depending on the concentration of the peptide delivered and somatotrope subpopulation tested (1, 2, 3). The present study was designed to identify which somatostatin receptor subtypes are responsible for the divergent effects of somatostatin on pig somatotrope function by using selective somatostatin receptor agonists. Our results strongly suggest that the inhibitory effect of somatostatin on porcine somatotropes is mediated through sst1 and sst2, with a potential role of sst3 and sst4, whereas the stimulatory effect of somatostatin is exerted via ligand activation of sst5 or an sst5-related mechanism.

Of the five somatostatin receptors, sst2 has been shown to mediate the inhibitory actions of somatostatin on both basal and GHRH-stimulated GH release from somatotropes in a variety of species studied, including humans (12, 20), rats (13, 14, 21), mice (15), sheep (16), and chickens (17). The current results, using pig pituitary cultures, also demonstrate that sst2 ligand activation can evoke an inhibitory effect on GHRH-induced GH secretion. In fact, the sst2 agonist was the only sst selective agonist that was able to inhibit GHRH-stimulated GH secretion in both LD and HD somatotrope subpopulations. However, inconsistent with other species, sst2 agonist failed to block basal GH release in pig primary pituitary cultures. These in vitro findings support in vitro and in vivo reports showing somatostatin does not block basal GH release but is effective in inhibiting the actions of GHRH in prepuberal pigs (the same age as the donors for the pituitary cultures used in the current study) (3, 22, 23, 24).

Although sst2 was shown to be an effective inhibitor of GH release in both subpopulations of pig somatotropes, sst1 proved to be a more potent inhibitor in whole-pituitary cultures. An inhibitory role for sst1 has also been documented in rodent species in which a sst1 agonist blocked basal GH release in mouse primary pituitary cultures (15) and somatostatin effectively inhibited GH secretion through activation of sst1 in a rat pituitary tumor cell line (GC cells) (25). The same sst1 agonist used in the present study was also effective in inhibiting GH release from cultures of human GH- and prolactin-secreting pituitary adenomas (26). However, the functional link between sst1 activation and GH inhibition does not extend to all species, in that primary chicken pituitary cultures were found to be insensitive to the inhibitory actions of the sst1 agonist (17).

Limited data are available regarding the pituitary-specific effects of sst3 and sst4 across species. However, it is clear that ligand activation of these receptors evokes species-specific responses. As shown in this report, sst3 and sst4 agonists delivered at a high dose inhibited GHRH-stimulated GH release. However, the same sst3 and sst4 agonists had no effect on GH release from human and rat somatotropes at comparable doses (13). Interestingly, in the chicken, the sst4 agonist actually induced GH secretion (17). These divergent results demonstrate that selective activation of somatostatin receptor subtypes can have species-dependent and sometimes opposing actions on GH release.

In the current report, we demonstrate that agonist activation of sst5 stimulates GH release in porcine pituitary cell cultures, whereas this same agonist was shown to inhibit GH release in pituitary cell cultures from rats and humans (12, 13, 14). These divergent effects also demonstrate that the ultimate effect of ligand activation of sst signaling on GH release is species and sst subtype dependent. The fact that the stimulatory actions of the sst5 agonist for the most part mimicked the dose-dependent and somatotrope subpopulation-specific stimulatory actions of somatostatin in pig pituitary cell cultures (1, 2, 3, 4, 5) strongly supports the hypothesis that somatostatin signals via sst5 or an sst5-related mechanism to enhance GH release in the pig. However, it should be noted that the sst5 agonist displayed an additive effect with GHRH on GH release, whereas GH released in response to low dose somatostatin is not augmented by addition of a maximal dose of GHRH and also that somatostatin exhibits a broader range of stimulatory concentrations than that of the sst5 agonist (2, 3).

These differences likely reflect the fact that somatostatin (even at low doses) can interact with other sst subtypes besides sst5 and activate additional signaling components, and this in turn may influence its stimulatory capacity or its interaction with GHRH. Also, and despite the markedly distinct actions of sst1 and sst5 agonists on GH release observed here, we should also introduce the caveat that the sst5 agonist shows nanomolar affinity for human sst1 (13). Nevertheless, although it remains to be determined how somatostatin-specific activation of sst5 would augment GH release, data generated by our laboratory and others suggest that this action is transduced via the G{alpha}s/adenylate cyclase/cAMP intracellular signaling pathway. We previously reported that somatostatin (low dose)-initiated GH release was associated with a rise in intracellular cAMP accumulation (4) and that pharmacologic inhibition of adenylate cyclase effectively blocked somatostatin-stimulated GH release from pig pituitary cell cultures (4). In addition, Carruthers et al. (27) observed that high doses of somatostatin can enhance intracellular cAMP accumulation in CHO-K1 cells stably transfected with the human sst5 receptor. In that they also observed that somatostatin could stimulate cAMP formation in membrane preparations of these cells and a dominant-negative G{alpha}s (G{alpha}s acetyl 354–372) inhibited somatostatin-stimulated cAMP production, it was concluded that ligand-activated human sst5 is capable of coupling to G{alpha}s and stimulating adenylate cyclase activity. However, functional studies demonstrated that activation of human sst5 in the context of the pituitary somatotrope inhibits GH release (12, 20), indicating there are clear species differences in human and pig sst5 structure and/or function.

Our laboratory recently cloned the pig sst5 receptor (8, 9, 28), revealing high homology to sst5 of other species, with the exception that pig sst5 contains a unique 8 Gly motif at its extracellular N-terminal domain, which may alter ligand-initiated changes in receptor conformation and/or subsequent coupling to intracellular signaling pathways (28). Finally, regardless of the precise molecular mechanisms involved, our present findings reinforce the notion that low concentrations of somatostatin, which are in the range of those measured in porcine portal plasma during trough periods (29), stimulate pig GH release, and thus that this peptide could contribute, in concert with GHRH, to enhance GH release in a physiological setting. However, in vivo experiments would be required to test this possibility.

The question arises: do the sst selective agonists used in this study, which were originally designed to target human receptor subtypes, activate the appropriate receptors in pig pituitary? Several key observations support the agonist specificity in the pig model. First, the same agonists have also been used to study the role of sst subtype-mediated regulation of GH release in rats (13, 14) in which there is a 95% sequence homology between species for sst1, sst2, sst3, and sst4 (6, 11) and an 80% homology for sst5 (6, 11). Second, the amino acid sequences of porcine sst1–5 (predicted from cDNA clones) show highest homology to those of their human counterparts, compared with other species (9, 28). Finally, in preliminary studies we observed that CHO-K1 cells (which are devoid of endogenous sst expression) stably transfected with porcine sst2 display high affinity for the sst2 agonist, whereas minimal binding was observed for sst1, sst3, sst4, and sst5 agonists (30). Studies are currently underway to confirm the porcine sst subtypes specificity of other sst selective agonists.

We previously reported that porcine somatotropes are made up of two functionally distinct subpopulations: LD somatotropes in which somatostatin at high doses blocks GHRH-stimulated GH release, and HD somatotropes in which both low and high doses of somatostatin stimulate GH release (1, 2). Data generated in this report suggest that the differential sensitivity of LD and HD somatotropes to somatostatin might be due to their differential expression of sst receptor subtypes. In LD cells, mRNA levels of sst1 and sst2 were significantly higher, compared with HD somatotropes. This elevated expression may explain the observation that both low and high doses of sst1 and sst2 agonists inhibit GHRH-induced GH release in LD cells, but only a high dose of sst2 agonist was effective in HD cultures. Following this same logic, sst5 mRNA was enriched in HD somatotropes, a population in which GH was released in response to both high and low doses of sst5 agonist, whereas only low doses of sst5 were effective in promoting GH release in ICS and LD cells. These observations present the exciting possibility that the absolute levels of the various sst receptor subtypes can dramatically alter the ultimate response to somatostatin activation. However, we cannot exclude the possibility that receptor-receptor interaction may also contribute to the differential effects of somatostatin on porcine GH release. sst5 has been reported to form homodimers as well as heterodimers with other sst subtypes in response to ligand activation, in which the particular receptor-receptor associations can modify critical receptor functions, including ligand binding properties, intracellular signaling activation, and receptor endocytosis and recycling (31, 32, 33, 34). We might speculate that sst receptor interaction plays a role in the differential response of porcine pituitary cells to somatostatin based on our current observation that the sst2 agonist blocked the stimulatory action of low-dose somatostatin in LD and HD cells, whereas the sst1 agonist inhibited somatostatin-stimulated GH release only in LD cells. Because human sst1 has been shown to form heterodimers with sst5 (31, 32), it might be possible that porcine sst1 and sst5 show similar interactions, in which formation of these heterodimers in HD cells would be favored by the high expression of sst5 and could thereby alter the response to sst1 agonist activation.

In summary, examination of the effects of sst subtype-specific agonists on GH release from pig pituitary cell cultures demonstrates that selective activation of sst1 and sst2 suppresses GHRH-induced GH release, whereas activation of sst5 stimulates GH release. These observations, taken together with our previous reports showing somatostatin can inhibit or stimulate GH release, depending on the dose used and the pituitary cell population tested, strongly suggests that somatostatin decreases GH release via sst1 and sst2 and stimulates GH release via sst5 or an sst5-related mechanism. Inasmuch as somatostatin can interact with all of these receptors and ssts are differentially expressed in somatotrope subpopulations, future studies will aim to elucidate how these receptors work in concert to mediate the ultimate effect (negative or positive) of somatostatin on GH release.


   Acknowledgments
 
We thank Dr. A. F. Parlow (the Pituitary Hormones and Antisera Center, Harbor-University of California-Los Angeles Medical Center, Los Angeles, CA) for the generous gift of pGH. We also thank Dr. Susan P. Rohrer (Merck Research Laboratories, Rahway, NJ) for kindly providing the nonpeptidyl sst agonists.


   Footnotes
 
This work was supported by CVI-0139 (Plan Andaluz de Investigación, Junta de Andalucía, Spain) and BFI-2001-2007, BFU2004-03883 (Ministerio de Educación y Ciencia, Spain/FEDER) (to M.M.M. and J.P.C.) and National Institutes of Health Grant DK30667 (to R.D.K.).

The authors (R.M.L., M.D.-P., S.G.-N., F.G.-N., R.D.K., M.M.M., and J.P.C. have nothing to declare.

First Published Online March 16, 2006

Abbreviations: Ct, Cycle threshold; HD, high density; ICS, initial cell suspension; LD, low density; pGH, porcine GH; sst, somatostatin receptor.

Received December 8, 2005.

Accepted for publication March 6, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Castaño JP, Torronteras R, Ramírez JL, Gribouval A, Sánchez-Hormigo A, Ruiz-Navarro A, Gracia-Navarro F 1996 Somatostatin increases growth hormone (GH) secretion in a subpopulation of porcine somatotropes: evidence for functional and morphological heterogeneity among porcine GH-producing cells. Endocrinology 137:129–136[Abstract]
  2. Ramírez JL, Torronteras T, Castaño JP, Sánchez-Hormigo A, Garrido JC, García-Navarro S, Gracia-Navarro F 1997 Somatostatin plays a dual, stimulatory/inhibitory role in the control of growth hormone secretion by two somatotrope subpopulations from porcine pituitary. J Neuroendocrinol 9:841–848[CrossRef][Medline]
  3. Ramírez JL, Castaño JP, Gracia-Navarro F 1998 Somatostatin at low doses stimulates growth hormone release from intact cultures of porcine pituitary cells. Horm Metab Res 30:175–177[Medline]
  4. Ramírez JL, Gracia-Navarro F, García-Navarro S, Torronteras R, Malagón MM, Castaño JP 2002 Somatostatin stimulates GH secretion in two porcine somatotrope subpopulations through a cAMP-dependent pathway. Endocrinology 143:889–897[Abstract/Free Full Text]
  5. Castaño JP, Delgado-Niebla E, Durán-Prado M, Luque RM, Sánchez-Hormigo A, Gracia-Navarro F, García-Navarro S, Kineman RD, Malagón MM 2005 New insights in the mechanism by which SRIF influences GH secretion. J Endocrinol Invest 28:10–13[Medline]
  6. Møller LN, Stidsen CE, Hartmann B, Holst JJ 2003 Somatostatin receptors. Biochim Biophys Acta 1616:1–84[Medline]
  7. Tannenbaum GS, Epelbaum J 1999 Somatostatin. In: Kostyo JL, Goodman HM, eds. Handbook of physiology. Sect 7. Vol 5. New York: Oxford University Press; 221–265
  8. Luque RM, Park S, Peng XD, Delgado E, Gracia-Navarro F, Kineman RD, Malagón MM, Castaño JP 2004 Homologous and heterologous in vitro regulation of pig pituitary somatostatin receptor subtypes, sst1, sst2 and sst5 mRNA. J Mol Endocrinol 32:437–448[Abstract]
  9. Delgado E, Castaño JP, Sánchez-Hormigo A, Luque RM, Peinado JR, Garrido JJ, Gracia-Navarro F, Malagón MM, Molecular characterization of pig somatostatin receptors. Proc 21st Conference of European Comparative Endocrinologists, Bonn, Germany, 2002, p 92 (Abstract)
  10. Patel YC 1999 Somatostatin and its receptor family. Front Neuroendocrinol 20:157–198[CrossRef][Medline]
  11. Csaba Z, Dournaud P 2001 Cellular biology of somatostatin receptors. Neuropeptides 35:1–23[CrossRef][Medline]
  12. Shimon I, Taylor JE, Dong JZ, Bitonte RA, Kim S, Morgan B, Coy DH, Culler MD, Melmed S 1997 Somatostatin receptor subtype specificity in human fetal pituitary cultures. Differential role of SSTR2 and SSTR5 for growth hormone, thyroid-stimulating hormone, and prolactin regulation. J Clin Invest 99:789–798[Medline]
  13. Rohrer SP, Birzin ET, Mosley RT, Berk SC, Hutchins SM, Shen DM, Xiong Y, Hayes EC, Parmar RM, Foor F, Mitra SW, Degrado SJ, Shu M, Klopp JM, Cai SJ, Blake A, Chan WW, Pasternak A, Yang L, Patchett AA, Smith RG, Chapman KT, Schaeffer JM 1998 Rapid identification of subtype-selective agonists of the somatostatin receptor through combinatorial chemistry. Science 282:737–740[Abstract/Free Full Text]
  14. Parmar RM, Chan WW, Dashkevicz M, Hayes EC, Rohrer SP, Smith RG, Schaeffer JM, Blake AD 1999 Nonpeptidyl somatostatin agonists demonstrate that sst2 and sst5 inhibit stimulated growth hormone secretion from rat anterior pituitary cells. Biochem Biophys Res Commun 263:276–280[CrossRef][Medline]
  15. Kreienkamp HJ, Akgun E, Baumeister H, Meyerhof W, Richter D 1999 Somatostatin receptor subtype 1 modulates basal inhibition of growth hormone release in somatotrophs. FEBS Lett 462:464–466[CrossRef][Medline]
  16. Briard N, Dutour A, Epelbaum J, Sauze N, Slama A, Oliver C 1997 Species differences between male rat and ram pituitary somatostatin receptors involved in the inhibition of growth hormone secretion. Eur J Endocrinol 137:545–555[Abstract]
  17. Bossis I, Porter TE 2001 Identification of the somatostatin receptor subtypes involved in regulation of growth hormone secretion in chickens. Mol Cell Endocrinol 182:203–213[CrossRef][Medline]
  18. Geris KL, de Groef B, Rohrer SP, Geelissen S, Kuhn ER, Darras VM 2003 Identification of somatostatin receptors controlling growth hormone and thyrotropin secretion in the chicken using receptor subtype-specific agonists. J Endocrinol 177:279–286[Abstract]
  19. Torronteras R, Castaño JP, Ruiz-Navarro A, Gracia-Navarro F 1993 Application of a Percoll density gradient to separate and enrich porcine pituitary cell types. J Neuroendocrinol 5:257–266[CrossRef][Medline]
  20. Shimon I, Yan X, Taylor JE, Weiss MH, Culler MD, Melmed S 1997 Somatostatin receptor (SSTR) subtype-selective analogues differentially suppress in vitro growth hormone and prolactin in human pituitary adenomas. Novel potential therapy for functional pituitary tumors. J Clin Invest 100:2386–2392[Medline]
  21. Yang L, Berk SC, Rohrer SP, Mosley RT, Guo L, Underwood DJ, Arison BH, Birzin ET, Hayes EC, Mitra SW, Parmar RM, Cheng K, Wu TJ, Butler BS, Foor F, Pasternak A, Pan Y, Silva M, Freidinger RM, Smith RG, Chapman K, Schaeffer JM, Patchett AA 1998 Synthesis and biological activities of potent peptidomimetics selective for somatostatin receptor subtype 2. Proc Natl Acad Sci USA 95:10836–10841[Abstract/Free Full Text]
  22. Glenn KC 1986 Regulation of release of somatotropin from in vitro cultures of bovine and porcine pituitary cells. Endocrinology 118:2450–2457[Abstract]
  23. Anderson LL, Ford JJ, Klindt J, Molina JR, Vale WW, Rivier J 1991 Growth hormone and prolactin secretion in hypophysial stalk-transected pigs as affected by growth hormone and prolactin-releasing and inhibiting factors. Proc Soc Exp Biol Med 196:194–202[Abstract]
  24. Farmer C, Pommier SA, Brazeau P 1993 Validation of a culture system for porcine pituitary cells: effects of growth hormone-releasing factor and(or) somatostatin on growth hormone secretion. J Anim Sci 71:923–929[Abstract]
  25. Cervia D, Petrucci C, Bluet-Pajot MT, Epelbaum J, Bagnoli P 2002 Inhibitory control of growth hormone secretion by somatostatin in rat pituitary GC cells: sst(2) but not sst(1) receptors are coupled to inhibition of single-cell intracellular free calcium concentrations. Neuroendocrinology 76:99–110[CrossRef][Medline]
  26. Zatelli MC, Piccin D, Tagliati F, Ambrosio MR, Margutti A, Padovani R, Scanarini M, Culler MD, degli Uberti EC 2003 Somatostatin receptor subtype 1 selective activation in human growth hormone (GH)- and prolactin (PRL)-secreting pituitary adenomas: effects on cell viability, GH, and PRL secretion. J Clin Endocrinol Metab 88:2797–2802[Abstract/Free Full Text]
  27. Carruthers AM, Warner AJ, Michel AD, Feniuk W, Humphrey PPA 1999 Activation of adenylate cyclase by human recombinant sst5 receptor expressed in CHO-K1 cells and involvement of G{alpha}s proteins. Br J Pharmacol 126:1221–1229[CrossRef]
  28. Castaño JP, Durán-Prado M, Delgado-Niebla E, Luque RM, García-Navarro S, Rhodes SJ, Vaudry H, Malagón MM, Unveiling the role of sst1, sst2, and sst5 in the dual stimulatory/inhibitory actions of somatostatin (SRIF) on growth hormone (GH) release. Program of the 87th Annual Meeting of The Endocrine Society, San Diego, CA, 2005, p 557 (Abstract P3-62)
  29. Drisko JE, Faidley TD, Chang CH, Zhang D, Nicolich S, Hora Jr DF, McNamara L, Rickes E, Abribat T, Smith RG, Hickey GJ 1998 Hypophyseal-portal concentrations of growth hormone-releasing factor and somatostatin in conscious pigs: relationship to production of spontaneous growth hormone pulses. Proc Soc Exp Biol Med 217:188–196[Abstract]
  30. Durán-Prado M, Bucharles C, González BJ, Delgado E, Luque RM, García-Navarro S, Vaudry H, Malagón MM, Castaño JP, Pharmacological characterization of porcine somatostatin receptor subtype 2a stable expressed in CHO-K1 cell line. Proc Midwest Regional Molecular Endocrinology Conference, Indianapolis, IN, 2004, p 47 (Poster 13)
  31. Rocheville M, Lange DC, Kumar U, Sasi R, Patel RC, Patel YC 2000 Subtypes of the somatostatin receptor assemble as functional homo- and heterodimers. J Biol Chem 275:7862–7869[Abstract/Free Full Text]
  32. Patel RC, Kumar U, Lamb DC, Eid JS, Rocheville M, Grant M, Rani A, Hazlett T, Patel SC, Gratton E, Patel YC 2002 Ligand binding to somatostatin receptors induces receptor-specific oligomer formation in live cells. Proc Natl Acad Sci USA 99:3294–3299[Abstract/Free Full Text]
  33. Ren SG, Taylor J, Dong J, Yu R, Culler MD, Melmed S 2003 Functional association of somatostatin receptor subtypes 2 and 5 in inhibiting human growth hormone secretion. J Clin Endocrinol Metab 88:4239–4245[Abstract/Free Full Text]
  34. Grant M, Patel RC, Kumar U 2004 The role of subtype-specific ligand binding and the C-tail domain in dimer formation of human somatostatin receptors. J Biol Chem 279:38636–38643[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
L. S. Farhy, C. Y. Bowers, and J. D. Veldhuis
Model-projected mechanistic bases for sex differences in growth hormone regulation in humans
Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2007; 292(4): R1577 - R1593.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
M. Duran-Prado, C. Bucharles, B. J. Gonzalez, R. Vazquez-Martinez, A. J. Martinez-Fuentes, S. Garcia-Navarro, S. J. Rhodes, H. Vaudry, M. M. Malagon, and J. P. Castano
Porcine Somatostatin Receptor 2 Displays Typical Pharmacological sst2 Features but Unique Dynamics of Homodimerization and Internalization
Endocrinology, January 1, 2007; 148(1): 411 - 421.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/6/2902    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Luque, R. M.
Right arrow Articles by Castaño, J. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Luque, R. M.
Right arrow Articles by Castaño, J. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals