Endocrinology, doi:10.1210/en.2005-1561
Endocrinology Vol. 147, No. 7 3211-3218
Copyright © 2006 by The Endocrine Society
The Thyroid Hormone Receptor-ß Agonist GC-1 Induces Cell Proliferation in Rat Liver and Pancreas
Amedeo Columbano,
Monica Pibiri,
Manuela Deidda,
Costanza Cossu,
Thomas S. Scanlan,
Grazia Chiellini,
Sandro Muntoni and
Giovanna M. Ledda-Columbano
Department of Toxicology, Oncology and Molecular Pathology Unit (A.C., M.P., M.D., C.C., S.M., G.M.L.-C.), University of Cagliari, 09124 Cagliari, Italy; Department of Pharmaceutical Chemistry (T.S.S.), University of California-San Francisco, San Francisco, California 94143; and Dipartimento di Scienze dellUomo e dellAmbiente (G.C.), University of Pisa, Pisa 56126, Italy
Address all correspondence and requests for reprints to: Dr. A. Columbano, Dipartimento di Tossicologia, Sezione di Oncologia e Patologia Molecolare, Via Porcell 4, 09124 Cagliari, Italy. E-mail: columbano{at}unica.it.
 |
Abstract
|
|---|
Thyroid hormones regulate cell growth, cell differentiation, and metabolic functions via interaction with the thyroid hormone nuclear receptors (TRs). Recently, a small class of halogen-free high-affinity thyroid hormone agonists has been developed that are highly selective for the TRß subtype. Because of the selective hyperthyroidism generated by one of these agonists, GC-1, this compound has the potential to be developed as a new therapeutic agent for the treatment of a variety of metabolic disturbances, including lipid disorders and obesity; thus, it becomes important to determine whether GC-1 has other unknown effects on potential target organs. The purpose of this study was to investigate the effect of GC-1 on cell proliferation in rat liver and pancreas. Rats treated with GC-1 (50 or 100 µg/100 g body weight) were killed at different time points. Hepatic and pancreatic cell proliferation was monitored by immunohistochemical determination of bromodeoxyuridine incorporation. The expression of cell cycle-related genes was analyzed by Northern and Western analysis. The results show that GC-1 strongly stimulates rat hepatocyte proliferation in the absence of tissue injury. Although GC-1-induced hepatocyte proliferation was associated with a rapid increase in cyclin D1 mRNA levels, no change in the expression of c-jun and c-fos was observed. GC-1 also induced massive pancreatic cell proliferation. The results indicate that the TRß-selective agonist GC-1 is a strong mitogen for hepatocytes and pancreatic acinar cells. Furthermore, they suggest that the TRß receptor is the mediator for the mitogenic activity of thyroid hormone and other thyromimetics.
 |
Introduction
|
|---|
THE THYROID HORMONES, T3 and T4, influence a variety of physiological processes, including cell growth and metabolism in mammals, metamorphosis in amphibians, and development of the vertebrate nervous system (1, 2, 3). Most of the effects of T3 are mediated by thyroid hormone nuclear receptors (TRs), which act as transcription factors (4, 5). TRs are members of the steroid/thyroid receptor superfamily of nuclear hormone receptors, which includes the two retinoid acid receptors (retinoic acid receptor and retinoid X receptor), the vitamin D receptor, the peroxisome proliferator-activated receptor, the constitutive androstane receptor, and some orphan receptors (6). Two different TR subtypes, TR-
and TR-ß, have been identified that are the products of distinct genes (7). The TR-
1 and the TR-ß1 isoforms bind thyroid hormone with near-equal affinity and are ubiquitously expressed, although TR-
1 predominates in heart (5070% of TRs), whereas TR-ß1 predominates in the liver (80% of TRs) (8). Data collected from various TR knockout mice suggest that TR-
1 mediates the effects of thyroid hormones on heart rate, whereas TR-ß1 is important in mediating the cholesterol-lowering and TSH-suppressant effects of T3 (7). Discriminating the different effects of thyroid hormones has both theoretical and practical importance. Indeed, thyroid hormones are used in therapy for the treatment of hypothyroidism and to induce TSH suppression in certain thyroid cancers. These therapies can bring about undesired side effects, particularly cardiac dysfunction, i.e. tachycardia, arrhythmias, and precipitation of ischemic episodes or heart failure (9). The availability of isoform selective thyromimetics might significantly reduce the occurrence of side effects while retaining the desired actions, such as TSH inhibition or reduction of cholesterol synthesis. It might also expand the therapeutic indications of thyromimetics to include conditions for which the therapeutic ratio is presently unacceptable, such as the treatment of obesity (10) and dyslipidemia (11, 12). Thus, new thyroid hormone analogs devoid of the cardiac effects of thyroid hormones would be extremely useful for inducing selective hyperthyroidism in tissues that would respond favorably and beneficially to an increase in thyroid hormone activity (13).
Recently, a new class of halogen-free thyroid hormone agonists, which are both highly selective for binding and activation functions of TR-ß1 over the TR-
1 receptors was developed. The first molecule synthesized in this group, GC-1 (14), contains several structural changes with respect to the natural hormone T3, including replacement of the three iodines with methyl and isopropyl groups, replacement of the biaryl ether linkage with methylene linkage, and replacement of the amino acid side chain with an oxyacetic acid side chain.
Notably, animal studies (15) revealed that treatment with GC-1 induces a reduction of cholesterol levels similar to that obtained with equimolar doses of T3 and even higher than that achieved with the most common drugs currently available on the market for the treatment of hypercholesterolemia, such as the inhibitors of hydroxymethyl glutaryl coenzyme A reductase. In the same studies, GC-1 caused an even higher reduction of triglyceride (TG) levels than that produced by equimolar doses of T3. Even more significant was the finding that GC-1 can elicit these effects at doses that have no significant side effects on heart rate do not cause muscle loss or an increase in the overall catabolic state (15). Because of the selective hyperthyroidism generated by GC-1, this compound has the potential to be developed as a new therapeutic agent for the treatment of a variety of thyroid hormone-related metabolic disorders, like lipid disorders and obesity (16). Thus, it becomes important to determine whether GC-1 may have other unknown effects on potential target organs such as the liver. In the present study, experiments were carried out to investigate the effect of GC-1 on hepatocyte and pancreatic cells proliferation.
 |
Materials and Methods
|
|---|
Animals
Male Wistar (150175 g) and F-344 (175200 g) rats purchased from Charles River (Milano, Italy) were maintained on a standard laboratory diet (Ditta Mucedola, Milano, Italy). The animals were given food and water ad libitum with a 12-h light, 12-h dark daily cycle and were acclimated for 1 wk before the start of the experiment. Guidelines for the Care and Use of Laboratory Animals were followed during the investigation. GC-1, synthesized as described by Chiellini et al. (14), was administered intragastrically as a single dose of 50 or 100 µg/100 g body weight (b.wt.) and dissolved in DMSO and oil daily for 7 d. An additional group fed a T3-supplemented diet (4 mg/kg diet; Sigma Chemical Co., St. Louis, MO) for 7 d was also included as a positive control for the proliferative response of the hepatocytes. In some experiments, two thirds partial hepatectomy (PH) was performed according to Higgins and Anderson (17). Immediately after rats were killed, sections of the liver were fixed in 10% buffered formalin and processed for staining with hematoxylin-eosin or immunohistochemistry. The remaining liver was snap-frozen in liquid nitrogen and kept at 80 C until use.
Northern blot analysis
Ten micrograms of polyadenylated mRNA obtained from livers of GC-1, PH, and control rats using the oligoTex mRNA Maxi Kit (Qiagen, Cologne, Germany) were loaded on a 1% agarose/formaldehyde gel containing ethidium bromide for RNA detection at a UV lamp and blotted on Hybond-XL membrane (Amersham-Pharmacia, Buckinghamshire, UK). RNA concentration was determined spectrophotometrically at 260 nm. DNA probes for c-jun and c-fos were kindly donated by A. Weisz (II Universita, Naples, Italy); for cyclin D1, a pcBZ054 plasmid containing a 1.3-kbp EcoRI fragment was used; probe for ß-actin was prepared from total RNA using SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, San Giuliano Milanese, Italy). PCR primers for ß-actin were AAGGGTGTAAAACGCAGCTC (forward) and AGCCATGTACGTAGCCATCC (reverse). DNA probes were labeled with [
-32P]dCTP by random priming (Random Priming DNA labeling kit, Boehringer Mannheim, Mannheim, Germany). Membranes were exposed to autoradiographic film (Eastman Kodak, Rochester, NY).
Western blot analysis
Total cell extracts were prepared from frozen livers powdered in liquid nitrogen-cold mortar. Equal amounts of powder (about 100 mg) per each sample point were resuspended in 1 ml Triton lysis buffer [1% Triton X-100, 50 mM Tris-HCl (pH 7.4), 140 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM phenylmethylsulfonylfluoride, 5 mM iodoacetic acid, 10 µg/ml each of aprotinin, pepstatin, leupeptin]. Several protease inhibitors were added to the isolation buffer to minimize protein degradation during the isolation protocol. After vortexing, extracts were incubated for 30 min on ice, centrifugated at 12,000 rpm at 4 C, and the supernatants were recovered. All inhibitors used were purchased from Boehringer Mannheim with the following exceptions: phenylmethylsulfonylfluoride, NaF, and DTT were purchased from Sigma Chemical Co., and iodoacetic acid was purchased from ICN Biomedicals (Irvine, CA). For E2F, p107, cyclin A, proliferating cell nuclear antigen (PCNA), and p27, nuclear extracts were prepared according to Timchenko et al. (18). The protein concentration of the resulting total extracts were determined according to the method of Bradford (19) using BSA as standard (DC Protein Assay, Bio-Rad, Hercules, CA). For immunoblot analysis, equal amounts (from 100150 µg/lane) of proteins were electrophoresed on SDS or polyacrylamide gels (12 or 8%). Acrylamide and bis-acrylamide were purchased from ICN Biomedicals. After gel electrotransfer onto nitrocellulose membranes at 300 mA overnight or 800 mA for 4 h to ensure equivalent protein loading and transfer in all lanes, the membranes and the gels were stained with 0.5% (wt/vol) Ponceau S red (ICN Biomedicals) in 1% acetic acid for 5 min and with Coomassie blue (ICN Biomedicals) in 10% acetic acid for 30 min, respectively. Before staining, gels were fixed in 25% (vol/vol) isopropanol and 10% (vol/vol) acetic acid (Sigma Chemical Co.). After blocking in Tris-buffered saline containing 0.5% Tween 20 (Sigma Chemical Co.) and 5% nonfat dry milk, and for 1 h at room temperature or overnight at 4 C, membranes were washed in TBS-T and then incubated with appropriate primary antibodies diluted in blocking buffer. Whenever possible, the same membrane was used for detection of the expression of different proteins. Depending on the origin of primary antibody, filters were incubated with antimouse or antirabbit or antigoat horseradish-peroxidase conjugated IgG (Santa Cruz Biotechnology, Inc., Santa Cruz, CA). Immunoreactive bands were identified with chemiluminescence detection system, as described by the manufacturer (Supersignal Substrate, Pierce Chemical, Rockford, IL). When necessary, antibodies were removed from filters by 30-min incubation at 60 C in stripping buffer [100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl (pH 7.6)], and the membranes were reblotted as above.
Antibodies
For immunoblotting experiments, we used mouse monoclonal antibodies directed against cyclin D1 (7213 G) and PCNA (PC-10) (Santa Cruz Biotechnology, Inc.) and p27kip (PharMingen, Erembodeyem, Belgium). Goat monoclonal antibody-directed anti-p107 (C-18) and albumin were from Santa Cruz Biotechnology, Inc. and Bethyl Laboratories (Montgomery, TX), respectively. Rabbit polyclonal antibodies directed against cyclin A (C-19) and E2F (C-20) were from Santa Cruz Biotechnology, Inc.
Immunohistochemistry
Rats treated with a single intragastrical dose of GC-1 (50 or 100 µg/100 g b.wt.) received a single ip dose of 5-bromo-2'-deoxyuridine (BrdU) (50 mg/kg, dissolved in distilled water) and were killed 2 h after BrdU administration at 12, 18, 24, and 30 h. In other experiments where GC-1 was given daily at the doses of 50 or 100 µg/100 g b.wt. for 7 d or at a single dose, and animals were killed 48 h later, BrdU, dissolved in drinking water (1 mg/ml), was given throughout the experimental period. Mouse monoclonal anti-BrdU antibody was obtained from Becton Dickinson (San Jose, CA), and the peroxidase method was used to stain BrdU-positive hepatocytes. Peroxidase goat antimouse immunoglobulin was obtained from Dako Corp. (Dako EnVision+ Peroxidase Mouse, Carpinteria, CA). Four-micrometer-thick sections were deparaffinized, treated with 2 N HCl for 20 min, then with 0.1% trypsin type II (crude from porcine pancreas; Sigma Chemical Co.) for 20 min, and treated sequentially with normal goat serum 1:10 (Dako), mouse anti-BrdU 1:200 for 1 h and 30 min and Dako EnVision+ Peroxidase Mouse ready-to-use. The sites of peroxidase binding were detected by 3,3'-diaminobenzidine. Labeling index (LI) was expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei. Mitotic activity was determined as the number of mitoses/1000 hepatocytes. Results are expressed as means ± SE of four to five rats per group. At least 5000 hepatocyte nuclei per liver were scored.
Serum TG, glutamate pyruvate transaminase (GPT), lactate dehydrogenase (LDH), free T3 (fT3), TSH, lipase, and
-amylase analysis
Immediately after rats were killed, blood samples were collected from the inferior vena cava and analyzed for blood chemistries. Briefly, the blood samples were centrifuged at 1500 rpm for 20 min, and the serum was tested for TGs, GPT, LDH, fT3, TSH, lipase, and
-amylase using a commercially available kit from Boehringer Mannheim.
Statistical analysis
All data represent at least two independent experiments and are expressed as the mean ± SE unless otherwise indicated. Differences between groups were compared using ANOVA.
 |
Results
|
|---|
Experiments were undertaken to determine the effect of treatment with daily doses of 50 and 100 µg/100 g b.wt. GC-1 or T3 feeding for 7 d on b.wt., plasma levels of fT3 and of TSH. Rats treated with T3 or GC-1 for 7 d showed an approximately 1520% reduction in b.wt. compared with their untreated counterpart. As expected, plasma levels of fT3 in T3-fed rats showed a striking increase (149.6 pg/ml in T3-treated rats vs. 4.7 ± 0.98 pg/ml controls, P < 0.001), whereas TSH levels were strongly reduced (0.003 ± 0.008 µg/ml in T3-fed rats vs. 0.094 ± 0.007 of controls, P < 0.001). No significant change of serum levels of fT3 was observed with 50 and 100 µg/100 g b.wt. GC-1 (4.3 ± 0.32 and 4.5 ± 0.68 pg/ml, respectively). On the other hand, as previously observed (15, 20), TSH levels were found significantly reduced in GC-1-treated rats (0.056 ± 0.007 and 0.046 ± 0.014 vs. 0.094 ± 0.007 of controls, P < 0.004).
Next, we examined whether daily treatment with GC-1 for 7 d could enhance the basal rate of hepatocyte proliferation. As shown in Fig. 1
, the LI determined in control rat liver after 1 wk of continuous BrdU administration in drinking water was 3.88%; on the other hand, daily treatment with 100 or 50 µg/100 g b.wt. GC-1 strongly enhanced the proliferative activity of the liver (LI was 15.6 and 20.2%, respectively). In agreement with previous studies, the LI of rats fed a T3-supplemented diet (4 mg/kg diet) was approximately 25% (21). In all the groups, proliferation was almost exclusively limited to hepatocytes, with the labeled hepatocytes being randomly distributed throughout the parenchyma.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 1. LI of F-344 rat hepatocytes after treatment with GC-1 or T3. Rats were treated with a daily dose of GC-1 (50 or 100 µg/100 g b.wt. intragastrically) or fed a T3-supplemented diet (4 mg/kg diet) for 7 d. To label the hepatocytes, BrdU dissolved in drinking water (1 mg/ml) was given throughout the experimental period. At least 5000 hepatocyte nuclei per liver were scored. The LI was expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei. Results are expressed as means ± SE of four to five rats per group. All groups were statistically different from control; P < 0.001.
|
|
Histological observation and determination of the serum levels of GPT and LDH did not show any change compared with control values (GPT, 52.2 U/liter in rats treated with 50 or 100 µg GC-1 vs. 44.8 U/liter controls; LDH, 2284 and 2136 mU/ml vs. 2312 mU/ml controls) (Table 1
). In agreement with previous studies (21), GC-1, at both doses, was very effective in reducing the serum TG content; indeed, as shown in Table 1
, a significant reduction in serum TG was observed (52 vs. 118 mg/dl controls). These values were essentially similar to those observed in T3-fed rats.
A great proliferative response of hepatocytes to GC-1 was observed also in Wistar rats. Indeed, 2 d after treatment with a single dose of GC-1 (100 µg/100 g b.wt.), rats exhibited a LI of 48% compared with a LI of 9.8% of untreated rats (Figs. 2A
and 3
, A and B). The increased DNA synthesis caused by GC-1 was accompanied by an enhancement in the number of hepatocytes entering mitosis compared with controls (Fig. 3
, C and D); mitotic index was of 5.1 of 1000 hepatocyte nuclei in GC-1-treated rats vs. 1.2 of 1000 of controls (Fig. 2B
).

View larger version (8K):
[in this window]
[in a new window]
|
FIG. 2. LI (A) and mitotic index (B) of Wistar rat hepatocytes after a single dose of GC-1. Rats treated with GC-1 (100 µg/100 g b.wt. intragastrically) were killed 48 h after treatment. To label the hepatocytes, BrdU dissolved in drinking water (1 mg/ml) was given immediately after treatment until the time the rats were killed. At least 5000 hepatocyte nuclei per liver were scored. The LI was expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei. The mitotic index was expressed as number of hepatocytes entering mitosis/1000 hepatocyte nuclei. Results are expressed as means ± SE of four rats per group. Statistically different from control; *, P = 0.001; , P = 0.02.
|
|

View larger version (123K):
[in this window]
[in a new window]
|
FIG. 3. Representative microphotography which illustrates the presence of BrdU-positive hepatocytes (x200, section counterstained with hematoxylin) (B), and mitotic figures (see arrows) (H&E, x400) (D) in the liver of Wistar rats killed 48 h after a single dose of GC-1 (100 µg/100 g b.wt. intragastrically). BrdU was given as indicated in legend to Fig. 2 . A and C, Controls.
|
|
Pancreas of adult organisms is, like liver, a quiescent organ that, similar to the adult hepatic tissue, has the potential for regeneration after partial pancreatectomy (22, 23, 24) and acinar cell necrosis (25). Recently, we found that thyroid hormone, among the several ligands of nuclear receptors, is unique in its capacity to induce proliferation of acinar pancreatic cells (26). Therefore, to investigate whether the proliferation of acinar pancreatic cells might be a TR isoform-specific effect, we examined the proliferative response of pancreas in Wistar rats 48 h after a single treatment with 100 µg/100 g b.wt. of the TR-ß-selective thyromimetic GC-1.
Our results showed that although pancreatic cells from control rats had very few BrdU-positive nuclei (Fig. 4A
), GC-1 treatment resulted in a marked increase of pancreatic cell proliferation (Fig. 4B
). At this time point, most of the labeled cells were acinar cells, with islet cells and ductular cells being almost completely unaffected. The LI was dramatically increased over the control values (L.I. was 32.7% in GC-1-treated rats vs. 6.8% of controls) (Fig. 4C
). The increased DNA synthesis of acinar cells was associated with the presence of mitotic figures (not shown). To establish whether the proliferative effect could be the consequence of GC-1-induced pancreatic cell damage and compensatory regeneration or, rather, a direct mitogenic effect, the serum values of
-amylase and lipase, two secretory enzymes known to be released in the serum during pancreatitis, were determined. The results showed no increase in the activity of both the enzymes in GC-1-treated rats, the values being 1742 and 12.0 U/liter for
-amylase and lipase, respectively, vs. 2324 and 10.8 U/liter in controls. Furthermore, no histological signs of cell toxicity were observed.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4. Representative microphotographs demonstrating immunohistochemical staining for BrdU in the pancreas of untreated (A) or GC-1-treated (B) Wistar rats. Rats administered a single dose of GC-1 (100 µg/100 g b.wt.) were killed 48 h later. Immediately after the administration of GC-1, rats were given BrdU (1 mg/ml) in drinking water for 2 d. Several BrdU-positive acinar cells are observed in the pancreas of GC-1-treated rats. A BrdU-negative pancreatic islet is evident (x200, sections counterstained with hematoxylin). C, LI of rat pancreatic acinar cells. LI was expressed as number of BrdU-positive acinar cell nuclei/100 nuclei. At least 2000 acinar cells per pancreas were scored. Results are expressed as means ± SE of four rats per group. Statistically significant from control; P < 0.001.
|
|
Next, experiments were performed to determine the kinetics of GC-1-induced hepatocyte proliferation and the changes in the expression of cell cycle-related genes after administration of a single dose of 50 or 100 µg/100 g b.wt. The results in Fig. 5
, A and B, show that although very few hepatocytes are in S phase in untreated rats (LI of 0.21%), an approximately 15-fold increase in the number of BrdU-positive hepatocytes was found 18 h after 100 or 50 µg/100 g b.wt. of GC-1 (LI was 3.8 and 3.5%, respectively). The number of BrdU-positive hepatocytes decreased at 24 h (2.1 and 0.9%), with a second peak at 30 h (3.4 and 1.7%, respectively). The entry of hepatocytes into DNA synthesis was confirmed by a strong increase of the protein levels of cyclin A, a marker of S phase, and PCNA, 18 h after treatment with GC-1 (Fig. 6
).

View larger version (9K):
[in this window]
[in a new window]
|
FIG. 5. LI of F-344 rat hepatocytes after a single intragastric dose of 100 (A) or 50 (B) µg/100 g b.wt. GC-1. Rats treated with GC-1 or controls were given a single injection of BrdU (50 mg/kg ip) 2 h before death at 10, 16, 22, and 28 h after treatment. At least 5000 hepatocyte nuclei per liver were scored. The LI was expressed as number of BrdU-positive hepatocyte nuclei/100 nuclei. Results are expressed as means ± SE of three to five rats per group. *, Statistically significant from control; P < 0.001. , Statistically significant from control; P < 0.05.
|
|

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 6. Expression of cell cycle-related proteins in the liver of F-344 rats treated with a single dose of GC-1 (50 µg/100 g b.wt.). Nuclear protein extracts (100 µg/lane) were prepared from the livers, and Western analysis was performed as described in Materials and Methods. Appropriate loading was confirmed by staining the gel with Coomassie blue, and efficiency of transfer was monitored by staining the blots with Ponceau S red. Each lane represents an individual sample; CO, control.
|
|
Several studies have shown that after surgical PH, the transition from G0 to G1 phase of the cell cycle (priming of hepatocytes) is associated with an increased expression of immediate early genes such as c-fos, c-jun, and c-myc (27, 28, 29). On the other hand, no significant change in the expression of such genes was observed after treatment with primary mitogens, including thyroid hormone (30, 31). Therefore, the expression of immediate early genes was determined soon after PH or treatment with a single dose of GC-1. The results showed that although a strong induction of c-fos and c-jun was observed 30 min after two thirds PH, no changes were observed after GC-1 (Fig. 7
).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 7. Northern blot analysis of changes in c-fos and c-jun mRNA levels in the liver from F-344 rats after a single dose of GC-1 (50 µg/100 g b.wt.) or PH. Lanes represent a pool of three samples. Northern blot analysis was done as outlined in Materials and Methods. CO, Control.
|
|
On the other hand, GC-1 induced an increase in mRNA hepatic levels of cyclin D1 as early as 2 h after treatment (Fig. 8A
), supporting previous data that suggest that cyclin D1 gene is an early target of ligands of nuclear receptors (32). The increased levels of cyclin D1 mRNA were followed by enhanced protein content that was evident as early as 12 h after treatment (Fig. 8B
).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 8. Expression of cyclin D1 in the liver of F-344 rat after a single dose of GC-1 (50 µg/100 g). A, Northern blot analysis of changes in cyclin D1 mRNA levels in rat liver 2 h after treatment with GC-1. Lanes represent the pool of three samples; CO, control. Northern blot analysis was done as outlined in Materials and Methods. B, Western blot analysis of cyclin D1 in rat liver after treatment with a single dose of GC-1. Protein extracts (100 µg/lane) were prepared from the livers, and Western blot analysis was performed as described in Materials and Methods. Each lane represents an individual sample; CO, control.
|
|
Together with its partners CDK4 and CDK6, cyclin D1 is thought to stimulate entry into S phase by phosphorylating pRb family members, causing the release of E2F transcription factors, which then transcriptionally activate target genes (33, 34). Because it is known that the cell cycle-dependent up-regulation of p107 and E2F1 is controlled at the transcriptional level by E2F activities (35), expression of E2F1 and p107 was measured by Western blot analysis in liver nuclear extracts from GC-1-treated rats. The results show that GC-1 treatment caused a strong enhancement of the nuclear levels of E2F1 and p107, which was maximal at 18 h after treatment (Fig. 6
). Finally, to determine whether the entry into S phase of the cell cycle could depend entirely on enhanced cyclin-associated cdk activities or could also be due to inhibition by GC-1 of the cdk inhibitor p27, we measured the level of this protein in GC-1-treated animals and control liver. As shown in Fig. 6
, no reduction of the expression of p27 could be observed in the liver from GC-1-treated rats, suggesting that GC-1-induced modification of E2F and p107 is most likely due to an increase in cyclin D1-associated kinase activity and not to a decrease in the protein level of the cdk inhibitor p27.
 |
Discussion
|
|---|
The present study shows that the potent TRß-selective agonist GC-1 is a powerful inducer of cell proliferation in rat liver and pancreas. It is noteworthy to underline that the hepatocyte proliferation induced by GC-1 is not associated with liver cell death but rather appears to be the result of a direct effect induced by this new halogen-free thyroid hormone analog.
The results of the present study also support the notion that nuclear receptors mediate hepatocyte proliferation and that this type of proliferation occurs through signaling pathways different from those associated with liver regeneration induced by the loss/death of hepatocytes (32). Indeed, we observed that, similarly to T3 and other ligands of nuclear receptors, such as peroxisome proliferators and the mouse hepatomitogen 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene (31, 36, 37), GC-1 did not induce the expression of immediate early genes believed to be critical for liver regeneration after hepatic damage; on the other hand, it induced a very rapid increase of cyclin D1. GC-1 has been used extensively as a selective thyromimetic in many different physiological settings, and the selective responses seen with GC-1 generally correlate with selective TRß activation. For example, GC-1 reduces serum low-density lipoprotein levels in hypothyroid mice, hypercholesterolemic rats, and euthyroid lean cynomolgus monkeys without stimulating significant increases in cardiac drive (15, 20). GC-1 has also been used to probe the respective roles of the different TR isoforms in brain development (38, 39), bone maintenance (40), target brain gene transactivation (41), and adaptive thermogenesis (42).
Perhaps the most striking demonstration of the TRß-selective activation property of GC-1 is observed in tadpole metamorphosis studies (43). In this process, TR
is known to drive limb development, whereas TRß is mainly involved in regulating the resorption of tail and gills. GC-1-treated tadpoles show premature resorption of tail and gills and greatly reduced leg growth. Although other factors such as preferential tissue uptake and metabolism cannot be categorically ruled out as playing a role in these GC-1-selective responses, it is becoming increasingly clear that selective TRß activation likely plays some role in the observed selectivity relative to that seen with the nonselective natural hormone T3.
These observations, together with our present finding that the total extent of hepatocytes entering S phase, in GC-1-treated rats, is similar to that obtained after treatment with the natural hormone, T3 (Fig. 1
), strongly suggests that the TRß subtype mediates hepatocyte proliferation.
Recently, it was shown that GC-1 reduces TGs and cholesterol in rodents at levels similar to those obtained with equimolar doses of T3 and even higher than those achieved with the most common drugs currently available on the market for the treatment of hypercholesterolemia, such as the inhibitors of hydroxymethyl glutaryl coenzyme A reductase (15, 20).
On the basis of the selective hyperthyroidism generated by GC-1, this compound has been proposed as a novel therapeutic agent for the treatment of thyroid hormone-related metabolic disturbances, including lipid disorders and obesity (16). In view of the potential relevance of GC-1 in human therapy, our findings of hepatic and pancreatic cell proliferative activity, an activity that is also seen with thyroid hormone, add potentially important information on the biological effects of this compound. Although proliferation is often associated with increased risk of cancer, hepatocyte proliferation induced by T3 accelerates the regression of nodules and adenomas induced by genotoxic carcinogens and inhibits the incidence of hepatocellular carcinoma and lung metastases (21, 44, 45). In agreement with the latter findings, a recent study reported that short-term treatment with KAT-681, a liver-selective thyromimetic, also inhibits the carcinogenic process in the liver (46). Further studies are needed to establish the effect of GC-1 in the carcinogenic process.
As to the pancreas, there are three main points rising from this study. 1) The finding that GC-1, a potent TRß-selective agonist, similarly to T3, is mitogenic for rodent pancreas, strongly suggests that the TRß subtype is, among several other biological effects, strongly involved in activating signal transducing pathways leading to cell cycle entry in organs other than liver. Indeed, while in the liver, the ß-subtype accounts for 80% of the TRs (8), immunohistochemical studies have demonstrated the presence of TR
in islet cells, but not in acinar cells (47); thus, our present observation that the TR-ß-selective agonist GC-1 selectively induces acinar cell proliferation without producing any effect on islet cells strongly suggests that the TRß subtype is the key mediator of pancreas acinar cell proliferation. 2) The finding that the mitogenic effect of GC-1 in extrahepatic tissues such as the pancreas is shared by T3, but not other nuclear receptor ligands (26), suggests that thyroid hormone and thyromimetics are unique in their capacity to stimulate pancreatic acinar cell proliferation. 3) The finding that GC-1 possesses mitogenic activity in pancreatic acinar cells may be potentially useful for allowing repopulation of acinar cells in damaged pancreas.
 |
Footnotes
|
|---|
This work was supported by the Ministero dellIstruzione, dellUniversità e della Ricerca (PRIN ex-40% and 60%) and by the Associazione Italiana Ricerca sul Cancro, Ministero della Sanità, Fondazione Banco di Sardegna, Italy.
A.C., M.P., M.D., C.C., T.S.S., G.C., S.M., and A.C. have nothing to declare.
First Published Online March 30, 2006
Abbreviations: BrdU, 5-Bromo-2'-deoxyuridine; b.wt., Body weight; fT3, free T3; GPT, glutamate pyruvate transaminase; LDH, lactate dehydrogenase; LI, labeling index; PCNA, proliferating cell nuclear antigen; PH, partial hepatectomy; TG, triglyceride; TR, thyroid hormone nuclear receptor.
Received December 8, 2005.
Accepted for publication March 22, 2006.
 |
References
|
|---|
- Oppenheimer JH, Schwartz HL, Strait KA 1996 The molecular basis of thyroid hormone action. In: Braverman LE, Utiger RD, eds. The thyroid: a fundamental and clinical text. New York: Lippincott-Raven; 162184
- Greenspan FS 1997 The thyroid gland. Basic, clinical endocrinology. 5th ed. Stamford, CT: Appleton, Lange; 192262
- Yen PM 2001 Physiological and molecular basis of thyroid hormone action. Physiol Rev 81:10971142[Abstract/Free Full Text]
- Brent GA 1994 The molecular basis of thyroid hormone action. New Engl J Med 331:847853[Free Full Text]
- Lazar MA 1993 Thyroid hormone receptors: multiple forms, multiple possibilities. Endocr Rev 14:184193[Abstract/Free Full Text]
- Mangelsdorf DJ, Umesono K, Evans RM 1984 The retinoid receptors. In: Sporn MB, Goodman DS, eds. The retinoids: biology, chemistry and medicine. New York: Raven Press; 319349
- Forrest D, Vennstrom B 2000 Functions of thyroid hormone receptors in mice. Thyroid 10:4551
- Schwartz HL, Strait KA, Ling NC, Oppenheimer JH 1992 Quantitation of rat tissue thyroid hormone binding receptor isoforms by immunoprecipitation of nuclear triiodothyronine binding capacity. J Biol Chem 267:1179411799[Abstract/Free Full Text]
- Klein I, Ojamaa K 2001 Thyroid hormone and the cardiovascular system. N Engl J Med 344:501509[Free Full Text]
- Loireau A, Autissier N, Dumas P, Michel O, Jorgenesen EC, Michel R 1986 Comparative effects of 3,5-dimethyl-3'-isopropyl-L-thyronine (DIMIT) and 3,5-diiodio-3-isopropylthyroacetic acid (IpTA2) on body weight gain and lipid metabolism in genetically obese Zucker rats. Biochem Pharmacol 35:16911696[Medline]
- Engelken SF, Eaton RP 1981 The effects of altered thyroid status on lipid metabolism in the genetic hyperlipemic Zucker rat. Atherosclerosis 38:177188[Medline]
- Hansson P, Valdermasson S, Nilsson-Ehle P 1983 Experimental hyperthyroidism in man: effects on plasma lipoproteins, lipoprotein lipase and hepatic lipase. Horm Metab Res 15:449452[Medline]
- Taylor AH, Stephan ZF, Steele RE, Wong NCW 1997 Beneficial effects of a novel thyromimetic on lipoprotein metabolism. Mol Pharmacol 52:542547[Abstract/Free Full Text]
- Chiellini G, Apriletti JW, Yoshihara HA, Baxter JD, Ribeiro RCJ, Scanlan TS 1998 A high affinity subtype-selective agonist ligand for the thyroid hormone receptor. Chem Biol 5:299306[CrossRef][Medline]
- Trost SU, Swanson E, Gloss B, Wang-Iverson DB, Zhang H, Volodarsky T, Grover GJ, Baxter JD, Chiellini G, Scanlan TS, Dillmann WH 2000 The thyroid hormone receptor ß-selective agonist GC-1 differentially affects plasma lipids and cardiac activity. Endocrinology 141:30573064[Abstract/Free Full Text]
- Baxter JD, Webb P, Grover G, Scanlan TS 2004 Selective activation of thyroid hormone signaling pathways by GC-1: a new approach to controlling cholesterol and body weight. Trends Endocrinol Metab 15:154157[CrossRef][Medline]
- Higgins GM, Anderson RM 1931 Experimental pathology of the liver. I. Restoration of the liver of the white rat following partial surgical removal. Arch Pathol 12:186202
- Timchenko NA, Wilde M, Nakanishi M, Smith JR, Darlington GJ 1996 CCAAT/enhancer-binding protein a (C/EBPa) inhibits cell proliferation through the p21 (WAF-1/Cip-1/SDI-1) protein. Genes Dev 10:804815[Abstract/Free Full Text]
- Bradford M 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248254[CrossRef][Medline]
- Grover GJ, Egan DM, Sleph PG, Beehler BC, Chiellini G, Nguyen N-H, Baxter J, Scanlan TS 2004 Effects of the thyroid hormone receptor agonist GC-1 on metabolic rate and cholesterol in rats and primates: selective actions relative to 3,5,3'-triiodo-L-thyronine. Endocrinology 145:16561661[Abstract/Free Full Text]
- Ledda-Columbano GM, Perra A, Piga R, Pibiri M, Loi R, Shinozuka H, Columbano A 1999 Cell proliferation induced by 3,3',5-triiodo-L-thyronine is associated with a reduction in the number of preneoplastic hepatic lesions. Carcinogenesis 20:22992304[Abstract/Free Full Text]
- Bonner-Weir S, Baxter LA, Chuppin GT, Smith FE 1993 A second pathway for regeneration of adult exocrine and endocrine pancreas. A possible recapitulation of embryonic development. Diabetes 42:17151720[Abstract]
- Brochenbrough JC, Weir GC, Bonner-Weir S 1988 Discordance of exocrine and endocrine growth after 90% pancreatectomy in rats. Diabetes 37:232236[Abstract]
- Pap A, Boros L, Hajnal F 1991 Essential role of cholecystokinin in pancreatic regeneration after 60% distal resection in rats. Pancreas 6:412418[Medline]
- Slater SD, Williamson RCN, Foster CS 1998 Proliferation of parenchymal epithelial cells is enhanced in chronic pancreatitis. J Pathol 186:104108[Medline]
- Ledda-Columbano GM, Perra A, Pibiri M, Molotzu F, Columbano A 2005 Induction of acinar cell proliferation by thyroid hormone. J Endocrinol 185:393399[Abstract/Free Full Text]
- Michalopoulos GK, DeFrances MC 1997 Liver regeneration. Science 276:6066[Abstract/Free Full Text]
- Fausto N, Laird AD, Webber EM 1995 Role of growth factors and cytokines in hepatic regeneration. FASEB J 9:15271536[Abstract]
- Taub R 1996 Transcriptional control of liver regeneration. FASEB J 10:413427[Abstract]
- Columbano A, Shinozuka H 1996 Liver regeneration versus direct hyperplasia. FASEB J 10:11181128[Abstract]
- Pibiri M, Ledda-Columbano GM, Cossu C, Simbula G, Menegazzi M, Shinozuka H, Columbano A 2001 Cyclin D1 is an early target in hepatocyte proliferation induced by thyroid hormone (T3). FASEB J 15:10061013[Abstract/Free Full Text]
- Ledda-Columbano GM, Columbano A 2003 Mitogenesis by ligands of nuclear receptors: an attractive model for the study of the molecular mechanisms implicated in liver growth. Cell Death Differ 10:S19S21
- Herwig S, Strauss M 1997 The retinoblastoma protein: a master regulator of cell cycle, differentiation and apoptosis. Eur J Biochem 15:581601[CrossRef]
- Sherr CJ 1996 Cancer cell cycles. Science 274:16721677[Abstract/Free Full Text]
- Calbò J, Parreno M, Sotillo E, Yong T, Mazo A, Garriga J, Grana X 2002 G1 cyclin/cyclin-dependent kinase-coordinated phosphorylation of endogenous pocket proteins differentially regulates their interactions with E2F4 and E2F1 and gene expression. J Biol Chem 52:5026350274
- Columbano A, Ledda-Columbano GM, Pibiri M, Piga R, Shinozuka H, DeLuca V, Cerignoli F, Tripodi M 1997 Increased expression of c-fos, c-jun and c-myc is not required for in vivo priming of hepatocytes by the mitogen TCPOBOP. Oncogene 14:857863[CrossRef][Medline]
- Ledda-Columbano GM, Pibiri M, Loi R, Perra A, Shinozuka H, Columbano A 2000 Early increase in cyclin D1 expression and accelerated entry of mouse hepatocytes into S phase after administration of the mitogen 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene. Am J Pathol 56:9197
- Morte B, Manzano J, Scanlan TS, Vennstrom B, Bernal J 2002 Deletion of the thyroid hormone receptor
1 prevents the structural alterations of the cerebellum induced by hypothyroidism. Proc Natl Acad Sci USA 99:39853989[Abstract/Free Full Text] - Morte B, Manzano J, Scanlan TS, Vennstrom B, Bernal J 2004 Aberrant maturation of astrocytes in the thyroid hormone receptor
1 knock out mice reveals an interplay between thyroid hormone receptor isoforms. Endocrinology 145:13861391[Abstract/Free Full Text] - Freitas FRS., Moriscot AS, Jorgetti V, Soares AG, Passarelli M, Scanlan TS, Brent GA, Bianco AC, Gouveia CHA 2003 Spared bone mass in rats treated with thyroid hormone receptor TRß-selective compound GC-1. Am J Physiol Endocrinol Metab 285:E1135E1141
- Manzano J, Morte B, Scanlan TS, Bernal J 2003 Differential effects of triiodothyronine and the thyroid hormone receptor ß-specific agonist GC-1 on thyroid hormone target genes in the brain. Endocrinology 144:54805487[Abstract/Free Full Text]
- Ribeiro MO, Carvalho SD, Schultz JJ, Chiellini G, Scanlan TS, Bianco AC, Brent GA 2001 Thyroid hormone-sympathetic interaction and adaptive thermogenesis are thyroid hormone receptor isoform-specific. J Clin Invest 108:97105[CrossRef][Medline]
- Furlow JD, Yang HY, Hsu M, Lim W, Ermio DJ, Chiellini G, Scanlan TS 2004 Induction of larval tissue resorption in Xenopus laevis tadpoles by the thyroid hormone receptor agonist GC-1. J Biol Chem 279:2655526562[Abstract/Free Full Text]
- Ledda-Columbano GM, Perra A, Loi R, Shinozuka H, Columbano A 2000 Cell proliferation induced by triiodothyronine in rat liver is associated with nodule regression and reduction of hepatocellular carcinoma. Cancer Res 60:603609[Abstract/Free Full Text]
- Ledda-Columbano GM, Perra A, Concas D, Cossu C, Molotzu F, Sartori C, Shinozuka H, Columbano A 2003 Different effects of the liver mitogens triiodo-thyronine and ciprofibrate on the development of rat hepatocellular carcinoma. Toxicol Pathol 31:113120[CrossRef][Medline]
- Hayashi M, Tamura T, Kuroda J, Ohnota H, Shibata N, Akahane M, Kashida Y, Mitsumori K 2005 Effects in the early and late phase of treatment with KAT-681, a liver selective thyromimetic, on rat hepatocarcinogenesis induced by 2-acetylaminofluorene and partial hepatectomy after diethylnitrosamine initiation. Toxicol Sci 84:2228[Abstract/Free Full Text]
- Zinke A, Schmoll D, Zachmann M, Schmoll J, Junker H, Grempler R, Kirsch G, Walther R 2003 Expression of thyroid hormone receptor isoform
1 in pancreatic islets. Exp Clin Endocrinol Diabetes 111:198202[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
E. Kress, A. Rezza, J. Nadjar, J. Samarut, and M. Plateroti
The Frizzled-related sFRP2 Gene Is a Target of Thyroid Hormone Receptor {alpha}1 and Activates {beta}-Catenin Signaling in Mouse Intestine
J. Biol. Chem.,
January 9, 2009;
284(2):
1234 - 1241.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Perra, M. Pibiri, P. Sulas, G. Simbula, G. M. Ledda-Columbano, and A. Columbano
{alpha}-lipoic acid promotes the growth of rat hepatic pre-neoplastic lesions in the choline-deficient model
Carcinogenesis,
January 1, 2008;
29(1):
161 - 168.
[Abstract]
[Full Text]
[PDF]
|
 |
|