help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2006-0237
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dun, S. L.
Right arrow Articles by Dun, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dun, S. L.
Right arrow Articles by Dun, N. J.
Endocrinology Vol. 147, No. 7 3243-3248
Copyright © 2006 by The Endocrine Society

Insulin-Like Peptide 5: Expression in the Mouse Brain and Mobilization of Calcium

Siok L. Dun, Eugen Brailoiu, Yulin Wang, G. Cristina Brailoiu, Lee-Yuan Liu-Chen, Jun Yang, Jaw Kang Chang and Nae J. Dun

Department of Pharmacology (S.L.D., E.B., Y.W., G.C.B., L.-Y.L.-C., N.J.D.), Temple University School of Medicine, Philadelphia, Pennsylvania 19140; and Phoenix Pharmaceuticals Inc. (J.Y., J.K.C.), Belmont, California 94002

Address all correspondence and requests for reprints to: Nae J. Dun, Department of Pharmacology, Temple University School of Medicine, 3420 North Broad Street, Philadelphia, Pennsylvania 19140. E-mail: ndun{at}temple.edu.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Insulin-like peptide 5 (INSL5) mRNA was detected in the mouse hypothalamus by RT-PCR. Immunohistochemical studies using an antiserum against the mouse INSL5 peptide revealed INSL5-immunoreactive (irINSL5) neurons in the paraventricular, supraoptic, accessory secretory, and supraoptic retrochiasmatic nuclei and immunoreactive cell processes in the internal layer of the median eminence. In the pituitary, irINSL5 was detected in terminal-like elements of the posterior lobe and in cells of the anterior lobe. Double-labeling experiments showed that irINSL5 is expressed in vasopressin-, but not oxytocin-containing neurons. INSL5 (100 nM) administered to dissociated and cultured mouse hypothalamic neurons elevated cytosolic calcium concentrations [Ca2+]i, as assessed by the microfluorimetric fura-2 method. In a Ca2+-free medium, INSL5 induced in dissociated neurons an increase of [Ca2+]i, which was sensitive to the endoplasmic reticulum calcium pump inhibitor thapsigargin (1 µM) and the IP3 receptor blocker 2-aminoethoxydiphenyl borate (100 µM) or xestospongin C (5 µM). Our result provides the first evidence that INSL5 is expressed in a population of cells in the mouse hypothalamus and pituitary and that it elevates [Ca2+]i by a mechanism involving both Ca2+ influx and Ca2+ release from intracellular stores. The concentration of irINSL5 in the hypothalamic-pituitary axis suggests a neuroendocrine function of this insulin superfamily member.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
INSULIN-LIKE PEPTIDE 5 (INSL5), a member of the insulin superfamily, was first identified in human peripheral tissues including rectum, colon, and uterus and in murine thymus (1). INSL5, a polypeptide of 135 amino acids, which are identical in the human and mouse, is characterized by a signal peptide, a B chain, an A chain, and a connecting C chain (1), which is a signature motif of insulin-like molecules. In the initial report, INSL5 mRNA is reportedly absent in the mouse brain tissue or pituitary using the Northern blot (1). More recently, quantitative RT-PCR study reveals the presence of INSL5 mRNA in a variety of human tissues including the brain, albeit in low levels, and the pituitary, which expresses a higher level of mRNA (2). In the same study, INSL5 is identified as a specific ligand for the G protein-coupled receptor (GPCR) 142 to which it binds with a high affinity; INSL5 (up to 1 µM) does not bind to several other GPCRs including LGR7, LGR8, and GPCR135 (2). In functional assays, INSL5 mobilizes Ca2+ in HEK293 cells transfected with GPCR142 and G{alpha}16 expression constructs (2). GPCR142 mRNA is expressed in several human tissues including colon, placenta, testis, thymus, prostate, kidney, and brain (2, 3).

Here we report the detection of INSL5 mRNA and INSL5 immunoreactive neurons in the mouse brain as well as calcium mobilizing activity of INSL5 in dissociated and cultured mouse hypothalamic neurons.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Experimental animals
Adult male ICR mice (Ace Animal Inc., Boyertown, PA) were used, except in the series of experiments in which Ca2+ measurements were made from dissociated and cultured mouse hypothalamic neurons harvested from 1- to 3-d postnatal mice. Experimental protocols were reviewed and approved by the Institutional Animal Care and Use Committee.

RT-PCR
Mice anesthetized with urethane (1.2 g/kg, ip) were decapitated with guillotine and the hypothalamus was dissected out. mRNA was purified using QuickPrep micro-mRNA purification kit (Amersham BioSciences, Piscataway, NJ) according to the manufacturer’s instructions. First-strand cDNA was synthesized using SuperScript III first-strand synthesis system for RT-PCR (Invitrogen, Carlsbad, CA). PCR was performed with a 5' primer (CCACTCTTGCTCTGTTTCTCCT) and a 3' primer (CTAACAGAGGGTGCTGAGTTCC) for INSL5, and a 5' primer (TCATGAAGTGTGACGTTGACATCCGT) and a 3' primer (CCTAGAAGCATTTGCGGTGCACGATG) for ß-actin under the following conditions: 94 C for 2 min; 32 cycles at 94 C for 30 sec, 55 C for 30 sec, and 72 C for 60 sec, and finally 72 C for 10 min. The amplified products were subjected to electrophoresis in a 1% agarose gel and stained with ethidium bromide. The DNA around 400 bp was purified using Qiaquick gel extraction kit (QIAGEN Inc., Valencia, CA) according to the manufacturer’s instructions, and the DNA sequence was determined (DNA Sequencing Facility, University of Pennsylvania, Philadelphia, PA).

Synthesis of mouse INSL5 (mINSL5) and production of antiserum
The predicted mINSL5 from the prohormone was synthesized by linkage of the A chain, Cys A6–11, Cys(S-pyridyl)-A7, Cys (Acm)-A20-DLQALCCREQCSMKELSTLC, with the B chain, Cys(Acm)-B20-SRQTVKLCGLDYVRTVIYICASSRW. Formation of the final S-S bond (A-20 and B-20) was carried out by treatment with iodine in acetic acid. Both protected A and B chains were synthesized by the solid-phase method. The crude mINSL5 was purified by preparative HPLC using 0.1% trifluoroacetic acid and CH3CN in 0.1% trifluoroacetic acid as the initial and final buffer. The pure mINSL5 showed a single peak on HLPC with a molecular ion at 5114.2 (molecular weight 5114.04). A polyclonal antiserum directed against the conjugated thioglobulin with the synthetic peptide was obtained in rabbits. The antiserum does not cross-react with INSL3, INSL4, INSL6, insulin, relaxin 2, or relaxin 3/INSL7 (Phoenix Pharmaceuticals Inc.).

Immunohistochemistry
Mice were anesthetized with urethane (1.2 g/kg, ip) and intracardially perfused with 0.1 M PBS followed by freshly prepared 4% paraformaldehyde/0.2% picric acid in PBS. In single staining, tissues were processed for INSL5-immunoreactivity (irINSL5) by the avidin-biotin complex procedure (4). Tissues were first treated with 3% H2O2 to quench endogenous peroxidase, washed several times, and blocked with 10% normal goat serum, as described previously (4). Tissues were then incubated in INSL5 antiserum for 48 h at 4 C with gentle agitation. The antiserum was used at a dilution of 1:1000 with 0.4% Triton X-100 and 1% BSA in PBS. After thorough rinsing, sections were incubated in biotinylated antirabbit IgG (1:150 dilution, Vector Laboratories, Burlingame, CA) for 2 h. Sections were rinsed with PBS and incubated in avidin-biotin complex solution for 1 h (1:100 dilution; Vector Laboratories). After several washes in Tris-buffered saline, sections were incubated in 0.05% diaminobenzidine/0.001% H2O2 solution and washed for at least 2 h with Tris-buffered saline. Sections were mounted on slides with 0.25% gel alcohol, air dried, dehydrated with absolute alcohol followed by xylene, and coverslipped with Permount. To establish the specificity of INSL5 antiserum, hypothalamic sections were processed with INSL5 antiserum preabsorbed with the mINSL5 peptide (1 µg/ml) overnight.

In the case of double labeling, the sequential labeling method with the primary antiserum from different hosts was used (4). Tissue sections were first labeled with INSL5 antiserum (1:750 dilution) and then with vasopressin-antiserum (1:1000 dilution, a guinea pig polyclonal from Bachem BioSciences Inc., King of Prussia, PA) or oxytocin-antiserum (1:1500 dilution, a mouse monoclonal from Chemicon, Temecula, CA). Sections were examined under a confocal scanning laser microscope (Leica TCS SL, Exton, PA) with excitation/emission wavelengths set to 488/520 nm for fluorescein isothiocyanate and 543/620 nm for Texas Red in the sequential mode.

Neuronal cell culture
Cells were isolated from the hypothalamus of postnatal 1- to 3-d-old ICR mice by enzymatic digestion with 0.5 mg papain per 100 mg tissue (5). Cells were plated at a density of 103/mm2 in a Neurobasal-A medium, supplemented with 10% fetal calf serum, 20 mM glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin (all from Invitrogen) and maintained at 37 C in a humidified atmosphere with 5% CO2. Glial cell growth was inhibited by the mitotic inhibitor cytosine ß-arabino furanoside (1 µM) (Sigma, St. Louis, MO). Neurons were cultured for 5 d. Cells were transferred to a medium without fetal serum 12 h before Ca2+ measurements.

Measurement of cytosolic Ca2+concentrations
Cytosolic Ca2+concentrations [Ca2+]i were measured by the microfluorimetric technique, as previously described (5). Dissociated cells on coverslips were loaded with the fluorescent Ca2+ indicator fura-2AM (3 µM) by incubation of the cells in Hanks’ balanced salt solution (HBSS) plus fura-2AM for 45 min and HBSS alone for an additional 15–60 min to allow deesterification of the dye. Coverslips were placed in a custom-designed bath and transferred to the stage of an inverted epifluorescence microscope (Nikon, Optical Apparatus Co. Inc., Ardmore, PA) equipped with a fluorometer system (C & L Instruments, Harrisburg, PA) (5). Cells were perfused with HBSS at a flow rate of 2.5 ml/min fura-2 fluorescence (excitation wavelength 340 and 380 nm, emission wavelength 520 nm) of single cells was acquired at a frequency of 1 Hz. The ratio of the fluorescence signals (340/380 nm) was converted to Ca2+ concentrations (6). For Ca2+-free experiments, HBSS without Ca2+ supplemented with 1.5 mM EGTA was used. Neurons responding to INSL5 in a Ca2+-free medium were washed with regular HBSS for 1 h. Thereafter neurons were returned to a Ca2+-free medium and retested to a second administration of INSL5 in the absence or presence of thapsigargin, 2-aminoethoxydiphenyl borate (2-APB) or xestospongin C (XeC). During the washout period, cells were not subject to UV exposure.

Statistics
In calcium measurement experiments, statistical significance between groups was tested using one-way ANOVA followed by Bonferroni test, P < 0.05 being considered significantly different.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
RT-PCR
The primers for INSL5 flanked the sequence from the 11th to 408th nucleotide of INSL5 mRNA (NM_011831). The PCR product of INSL5 was 398 bp. INSL5 mRNA was present in the hypothalamus, albeit at a low level; ß-actin mRNA was abundantly expressed in this region (Fig. 1Go). DNA sequence result showed that there were two nucleotide differences, one a silent mutation and the other resulting in Gln45 instead of Arg45 reported in the protein sequence in NCBI protein database (AAD29687).


Figure 1
View larger version (32K):
[in this window]
[in a new window]
  		FIG. 1. Expression of INSL5 mRNA in mouse hypothalamus. First-strand cDNA was synthesized using mRNA extracted from the mouse hypothalamus with (+) or without (–) reverse transcriptase. PCR was performed with primers of INSL5 (398 bp) (upper panel) or mouse ß-actin (fragment, 283 bp) (lower panel). ß-Actin transcript is abundantly expressed in the hypothalamus, which expresses a low level of INSL5 mRNA.

 
irINSL5 in the hypothalamus
Microscopic examination of tissue sections prepared from the brains and pituitary glands of six mice revealed irINSL5 cells in the hypothalamus (Fig. 2Go) and pituitary (Fig. 3Go). The nomenclature of subdivisions of the hypothalamus follows that of Paxinos and Franklin (7). Numerous irINSL5 cells were observed in the paraventricular, supraoptic, supraoptic retrochiasmatic, and accessory secretory nuclei throughout the rostrocaudal axis of the hypothalamus (Fig. 2Go). Few irINSL5 cells were detected in the periventricular nucleus and lateral hypothalamic area (Fig. 2Go). Within subdivisions of the hypothalamus, the majority of irINSL5 cells were noted in the lateral magnocellular part of the paraventricular nucleus and the supraoptic nucleus (Fig. 2Go, B and C); other subdivisions such as the posterior part of the paraventricular nucleus and the supraoptic retrochiasmatic nucleus expressed fewer irINSL5 cells (Fig. 2Go, E and F). Numerous irINSL5 cell processes were seen emanating from the supraoptic (Fig. 2BGo) and paraventricular (Fig. 2CGo) nucleus and projecting to the posterior pituitary via the median eminence. In this connection, a fairly dense layer of irINSL5 cell processes was detected in the internal layer of the median eminence (Fig. 2DGo).


Figure 2
View larger version (149K):
[in this window]
[in a new window]
  		FIG. 2. Photomicrographs of hypothalamic sections labeled with INSL5 antiserum. A, A low magnification showing irINSL5 neurons in the paraventricular and supraoptic nucleus. B, An enlarged area boxed in the lower corner of A; irINSL5 neurons with their cell processes are seen in the supraoptic nucleus. C, An enlarged area boxed in A; irINSL5 neurons are concentrated in the lateral magnocellular part of the paraventricular nucleus (PaLM). D, A low magnification illustrating irINSL5 neurons in the posterior part of the paraventricular nucleus (PaPo) and supraoptic retrochiasmatic nucleus (SOR); a layer of immunoreactive fibers is indicated in the median eminence by an arrow. E, A higher magnification of the PaPo area in which a cluster of irINSL5 neurons are located; labeled neurons are also seen in the lateral hypothalamic area (LH). F, A higher magnification of the SOR area in which several irINSL5 neurons are detected; many immunoreactive fibers running toward the median eminence are also seen at this level. 3V, Third ventricle; Arc, arcuate nucleus; opt, optic tract; f, fornix. Scale bar, A and D, 500 µm; B, C, and F, 50 µm; E, 100 µm.

 

Figure 3
View larger version (118K):
[in this window]
[in a new window]
  		FIG. 3. Confocal scanning images of mouse pituitary gland labeled with INSL5 antiserum. A, Immunoreactivity is detected in varicosities and nerve terminal-like structures (arrows) in the posterior pituitary. B, Immunoreactivity is present in a subpopulation of cells (arrows) in the anterior pituitary. Scale bar, A, 30 µm; B, 40 µm.

 
In control experiments, hypothalamic sections processed with INSL5 antiserum preabsorbed with the peptide (1 µg/ml) overnight showed no immunoreactivity.

INSL5 in the pituitary
INSL5 mRNA is highly expressed in the human pituitary (2). In the mouse posterior pituitary, irINSL5 was detected in varicosities and nerve terminal-like structures (Fig. 3AGo). In the anterior pituitary, irINSL5 was present in a population of cells (Fig. 3BGo).

Double labeling with INSL5 and vasopressin or oxytocin antiserum
Magnocellular neurons in the hypothalamus are either vasopressin- or oxytocin-containing neurons (8). Double-labeling experiments in which hypothalamic sections were labeled with INSL5 and vasopressin antiserum or INSL5 and oxytocin antiserum showed that nearly all irINSL5 cells were vasopressin-immunoreactive in the paraventricular hypothalamic nucleus (Fig. 4Go, A–C); not all vasopressin-immunoreactive neurons were irINSL5 in the supraoptic nucleus (Fig. 4Go, D–F). Oxytocin-immunoreactive neurons were not irINSL5 in any of the sections examined and vice versa (Fig. 4Go, G–I).


Figure 4
View larger version (152K):
[in this window]
[in a new window]
  		FIG. 4. Confocal scanning images of hypothalamic sections double-labeled with INSL5 antiserum and vasopressin or oxytocin antiserum. A and B, A section of hypothalamic paraventricular nucleus in which cells labeled with INSL5 antiserum appear green, and cells labeled with vasopressin (VP) antiserum appear red. C, A merged image of A and B showing all irINSL5 neurons are vasopressin positive (greenish yellow/yellowish red). D and E, A section of supraoptic nucleus in which cells labeled with INSL5 antiserum appear green, and cells labeled with vasopressin antiserum appear red. F, A merged image of D and E showing one of the vasopressin-positive cells (arrow) is not irINSL5. G and H, A section of paraventricular nucleus labeled with INSL5 or oxytocin (OT) antiserum. I, A merged image of G and H showing irINSL5 cells are distinct from oxytocin-expressing cells. irVP, Vasopressin-immunoreactive; irOT, oxytocin-immunoreactive. Scale bar, 20 µm.

 
Mobilization of calcium in cultured hypothalamic neurons
The biological activity of INSL5 was evaluated by monitoring changes of [Ca2+]i in cultured hypothalamic neurons. The basal [Ca2+]i value of mouse dissociated hypothalamic neurons varied from 90 to 170 nM, which is in agreement with the concentration (30–200 nM) reported in mammalian central neurons (9).

In Ca2+-containing saline, INSL5 (100 nM), which is 10 times less than the concentration that produced maximal Ca2+ mobilization in HEK293 cells (2), induced two types of Ca2+ responses in dissociated hypothalamic neurons. In seven of 96 cells tested, INSL5 induced a fast and transitory increase in [Ca2+]i of 293 ± 5.8 nM; a representative recording is shown in Fig. 5AGo. In another four cells, INSL5 induced a biphasic increase: a fast and transitory elevation of 237 ± 4.7 nM followed by a slow and sustained increase of 249 ± 6.1 nM (Fig. 5BGo).


Figure 5
View larger version (14K):
[in this window]
[in a new window]
  		FIG. 5. Effects of INSL5 on cytosolic Ca2+ concentrations in dissociated and cultured mouse hypothalamic neurons. In Ca2+-containing media, application of 100 nM INSL5 induced two types of Ca2+ responses. A and B, Actual traces of [Ca2+]i measurement in two different populations of single cells. In seven cells INSL5 induced a fast and transitory increase in [Ca2+]i by 293 ± 5.8 nM (A). In four cells INSL5 induced a fast and transitory [Ca2+]i elevation by 237 ± 4.7 nM followed by a slow but sustained increase of 249 ± 6.1 nM (B).

 
In the next series of experiments, the effects of INSL5 on dissociated hypothalamic neurons were studied in a Ca2+-free solution. In cells perfused with a Ca2+-free medium, INSL5 induced a transitory elevation of [Ca2+]i of 179 ± 3.5 nM (n = 6). The mean [Ca2+]i increase in Ca2+-free media was significantly (P < 0.05) smaller than that obtained in Ca2+-containing media. After 1 h wash in HBSS, cells were again perfused with a Ca2+-free saline. Under this condition, a second application of INSL5 induced an increase in [Ca2+]i of 162 ± 4.6 nM (n = 6), which was not significantly different from the first response elicited in Ca2+-free media (Fig. 6Go, A1 and A2). Pretreatment of the cells with 1 µM thapsigargin (n = 4) (Fig. 6Go, B2), 100 µM 2-APB (n = 4) (Fig. 6Go, C2), or 5 µM XeC (n = 4) (Fig. 6Go, D2) abolished the second Ca2+ response to INSL5.


Figure 6
View larger version (24K):
[in this window]
[in a new window]
  		FIG. 6. Characterization of INSL5-induced cytosolic Ca2+ concentrations in cultured mouse hypothalamic neurons incubated in Ca2+-free solution. Treatment with INSL5 (100 nM) of hypothalamic neurons perfused with Ca2+-free saline induced a transitory [Ca2+]i elevation by 179 ± 3.5 nM (A1). After 1 h of wash in regular HBSS, INSL5 induced in Ca2+-free media an increase in [Ca2+]i of 162 ± 4.6 nM (n = 6) (A2), which is not significantly different from the first response. Neurons responding to INSL5 in Ca2+-free saline (B1, C1, and D1) were perfused for 1 h with Ca2+-containing media followed by Ca2+-free media. Pretreatment (15 min) with thapsigargin (n = 4) (B2), 2-APB (n = 4) (C2), or XeC (n = 4) (D2) blocked the second response induced by INSL5 in Ca2+-free saline.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The insulin superfamily currently consists of several peptides of high structural but low sequence similarity. The family is composed of several relaxin/insulin-like peptides: relaxin-1, relaxin-2, relaxin-3/INSL7, INSL3, INSL4, INSL5, and INSL6 (2, 3, 10).

In the present study, INSL5 mRNA was detected by RT-PCR in the mouse hypothalamus. Contrary to an abundance of ß-actin mRNA, a low level of INSL5 transcript was detected in the hypothalamus of ICR mice. Determination of the cDNA sequence of ICR mice revealed two nucleotides that differ from the submitted murine cDNA sequence. The functional significance of this sequence variability is not clear. The difference may be the result of polymorphism of two nucleotides between the house mouse (Mus musculus) and the ICR mouse used in our study.

Immunohistochemical studies using a polyclonal antiserum directed against the mINSL5 peptide revealed that irINSL5 is present in a discrete population of neurons in the mouse hypothalamus, corroborating the expression of INSL5 gene in the hypothalamus. The antiserum appears to be specific because preabsorption of the antiserum with the synthetic INSL5 peptide resulted in no positive labeling. Cell bodies immunoreactive to INSL5 are mainly confined to the hypothalamus including the supraoptic, paraventricular, and supraoptic retrochiasmatic nucleus; labeled somata are not observed in other areas of the mouse brain. Vasopressin and oxytocin synthesized in magnocellular neurons of the paraventricular and supraoptic nucleus are transported to the nerve endings and secreted into the blood capillary within the posterior pituitary gland. In this respect, irINSL5 is noted in cell processes emanating from neurons in the paraventricular and supraoptic nucleus, cell processes of the internal layer of the median eminence, and terminal-like endings of the posterior pituitary. Thus, INSL5 may be secreted into the blood capillary in a manner similar to that of vasopressin and oxytocin. Moreover, irINSL5 cells are noted in the anterior pituitary. At present, the type(s) of anterior pituitary cells expressing irINSL5 is not known.

Magnocellular neurons in the paraventricular, supraoptic, and accessory secretory nucleus are either vasopressin- or oxytocin-containing neurons (8). Double labeling the sections with INSL5 antiserum and vasopressin or oxytocin antiserum showed that irINSL5 cells are vasopressin but not oxytocin containing and that nearly all irINSL5 are vasopressin immunoreactive but not vice versa. The topographic distribution of irINSL5 in the hypothalamus and pituitary and its coexpression with vasopressin is similar to that of apelin, a 36-amino acid peptide proposed to be the endogenous ligand for the human orphan GPCR APJ (11, 12). The biological activity of apelin has yet to be fully characterized. Several recent studies suggest that the peptide acting on APJ receptors may regulate diverse functions including fluid homeostasis, vascular reactivity, feeding behavior, and HIV infection (13).

At the present time, information relative to the biological function of INSL5 is limited. A recent study has identified INSL5 as the endogenous ligand for the GPCR142 (2). Using fura-2 fluorescence as a functional assay, INSL5 increases [Ca2+]i in dissociated mouse hypothalamic neurons. Approximately 10% of neurons sampled here responded to 100 nM INSL5. The relatively small number of responsive neurons appears to be in line with a low level of GPCR142 mRNA detected in the human brain (2). Dissociated and cultured mouse hypothalamic neurons responded to INSL5 (100 nM) with two types of calcium responses. The fast and transitory response may be caused by activation of GPCR142, to which the peptide binds with a high affinity (2). The second type of response, which consists of a fast and transitory elevation followed by a prolonged increase, may correspond, respectively, to the activation of GPCR142 and possibly of another receptor(s) by a bioactive substance(s) released secondarily from adjacent neurons.

Transient increases in intracellular calcium result from an influx of calcium through plasmalemmal voltage- or ligand-gated calcium channels and/or release from internal stores (14). In the case of INSL5, the increase of [Ca2+]i in hypothalamic neurons was still observed in a Ca2+-free medium, suggesting the participation of Ca2+ influx through plasmalemmal Ca2+ channels as well as Ca2+ release from internal stores. Intracellular calcium stores include endoplasmic reticulum (ER), Golgi apparatus, mitochondria, and lysosomes. Inositol 1,4,5-trispohosphate (IP3) receptors are intracellular calcium channels present in ER and other organelles (15). The IP3-sensitive calcium pool can be depleted by thapsigargin, an inhibitor of the ER calcium pump (16). The INSL5-induced [Ca2+]i increase in Ca2+-free solution was abolished by pretreating the neurons with thapsigargin, indicating that INSL5 releases Ca2+ from thapsigargin-sensitive stores but not from acidic lysosome-like calcium stores (5). Furthermore, the INSL5-induced [Ca2+]i increase in Ca2+-free solution was abolished by the IP3 receptor inhibitor 2-APB (17) or XeC (18), suggesting the involvement of IP3-sensitive calcium stores in the neuronal response to INSL5. Our finding is consistent with an earlier report that the peptide mobilizes Ca2+ in HEK293 cells cotransfected with GPCR142 and G{alpha}16 expression constructs (2). Many neuronal processes, including differentiation, neurite outgrowth, and apoptosis, are Ca2+ mediated. In mammalian central neurons, the Ca2+ set point that switches between neurite outgrowth and growth cone collapse, is approximately 1000 nM (9). Viewed in this context, INSL5 induces a moderate increase in [Ca2+]i, which is in the range that may induce neurite outgrowth and/or axonal branching in targeted neurons (19). Moreover, it is well documented that synaptic transmission is critically dependent on [Ca2+]i (20). The elevation of [Ca2+]i produced by INSL5 may lead to changes in membrane excitability and/or enhancement in neurosecretion of target neurons.

In summary, our results demonstrate for the first time the presence of INSL5 in mouse hypothalamic neurons, principally in vasopressin-containing neurons and the pituitary gland, and the peptide stimulates Ca2+ influx and Ca2+ release from IP3-sensitive stores in mouse cultured hypothalamic neurons.


   Acknowledgments
 
We thank Dr. Patrick Piggot for access to the confocal microscope.


   Footnotes
 
This work was supported by National Institutes of Health Grants NS18710 and HL51314 (to N.J.D.) and DA17304 and DA04745 (to L.-Y.L.-C.).

First Published Online April 6, 2006

Abbreviations: 2-APB, 2-Aminoethoxydiphenyl borate; [Ca2+]i, intracellular calcium concentration; ER, endoplasmic reticulum; GPCR, G protein-coupled receptor; HBSS, Hanks’ balanced salt solution; INSL5, insulin-like peptide 5; IP3, inositol 1,4,5-trispohosphate; irINSL5, INSL5-immunoreactive; mINSL5, mouse INSL5; XeC, xestospongin C.

Received February 22, 2006.

Accepted for publication March 30, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Conklin D, Lofton-Day CE, Halderman BA, Ching A, Whitmore TE, Lok S, Jaspers S 1999 Identification of INSL5, a new member of the insulin superfamily. Genomics 60:50–56[CrossRef][Medline]
  2. Liu C, Kuei C, Sutton S, Chen J, Bonaventure P, Wu J, Nepomuceno D, Kamme F, Tran D-T, Zhu J, Wilkinson T, Bathgate R, Eriste E, Sillard R, Lovenberg TW 2005 INSL5 is a high affinity specific agonist for GPCR142 (GPR100). J Biol Chem 280:292–300[Abstract/Free Full Text]
  3. Liu C, Chen J, Sutton S, Roland B, Kuei C, Farmer N, Sillard R, Lovenberg TW 2003 Identification of relaxin-3/INSL7 as a ligand for GPCR142. J Biol Chem 278:50765–50770[Abstract/Free Full Text]
  4. Brailoiu GC, Dun SL, Ohsawa M, Yin D, Yang J, Chang JK, Brailoiu E, Dun NJ 2005 KiSS-1 expression and metastin-like immunoreactivity in the rat brain. J Comp Neurol 481:314–329[CrossRef][Medline]
  5. Brailoiu E, Hoard JL, Filipeanu CM, Brailoiu GC, Dun SL, Patel S, Dun NJ 2005 Nicotinic acid adenine dinucleotide phosphate potentiates neurite outgrowth. J Biol Chem 280:5646–5650[Abstract/Free Full Text]
  6. Grynkiewicz G, Poenie M, Tsien RY 1985 A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260:3440–3450[Abstract/Free Full Text]
  7. Paxinos G, Franklin KBJ 2001The mouse brain in stereotaxic coordinates. 2nd ed. San Diego: Academic Press
  8. Rhodes CH, Morrell JI, Pfaff DW 1981 Immunohistochemical analysis of magnocellular elements in rat hypothalamus: distribution and numbers of cells containing neurophysin, oxytocin, and vasopressin. J Comp Neurol 198:45–64[CrossRef][Medline]
  9. Connor JA 1986 Digital imaging of free calcium changes and of spatial gradients in growing processes in single, mammalian central nervous system cells. Proc Natl Acad Sci USA 83:6179–6183[Abstract/Free Full Text]
  10. Wilkinson TN, Speed TP, Tregear GW, Bathgate RA 2005 Coevolution of the relaxin-like peptides and their receptors. Ann NY Acad Sci 1041:534–539[CrossRef][Medline]
  11. Brailoiu GC, Dun SL, Yang J, Ohsawa M, Chang JK, Dun NJ 2002 Apelin-immunoreactivity in the rat hypothalamus and pituitary. Neurosci Lett 3327:193–197
  12. Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, Osmond DH, George SR, O’Dowd BF 2000 Characterization of apelin, the ligand for the APJ receptor. J Neurochem 74:34–41[CrossRef][Medline]
  13. Kleinz MJ, Davenport AP 2005 Emerging roles of apelin in biology and medicine. Pharmacol Ther 107:198–211[CrossRef][Medline]
  14. Berridge MJ 1998 Neuronal calcium signaling. Neuron 21:13–26[Medline]
  15. Verkhratsky A 2002 The endoplasmic reticulum and neuronal calcium signalling. Cell Calcium 32:393–404[CrossRef][Medline]
  16. Treiman M, Caspersen C, Christensen SB 1998 A tool coming of age: thapsigargin as an inhibitor of sarco-endoplasmic reticulum Ca2+-ATPases. Trends Pharmacol Sci 19:131–135[CrossRef][Medline]
  17. Maruyama T, Kanaji T, Nakade S, Kanno T, Mikoshiba K 1997 2APB, 2-aminoethoxy diphenyl borate, a membrane-penetrable modulator of Ins(1,4,5)P3-induced Ca2+ release. J Biochem (Tokyo) 122:498–505[Abstract/Free Full Text]
  18. Gafni J, Munsch JA, Lam TH, Catlin MC, Costa LG, Molinski TF, Pessah IN 1997 Xestospongins: potent membrane permeable blockers of the inositol 1,4,5-trisphosphate receptor. Neuron 19:723–733[CrossRef][Medline]
  19. Tang F, Kalil K 2005 Netrin-1 induces axon branching in developing cortical neurons by frequency-dependent calcium signaling pathways. J Neurosci 25:6702–6715[Abstract/Free Full Text]
  20. Augustine GJ, Santamaria F, Tanaka K 2003 Local calcium signaling in neurons. Neuron 40:331–346[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dun, S. L.
Right arrow Articles by Dun, N. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dun, S. L.
Right arrow Articles by Dun, N. J.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals