Endocrinology, doi:10.1210/en.2006-0022
Endocrinology Vol. 147, No. 7 3598-3605
Copyright © 2006 by The Endocrine Society
Gonadotropin-Releasing Hormone Activation of C-jun, But Not Early Growth Response Factor-1, Stimulates Transcription of a Luteinizing Hormone ß-Subunit Gene
Philippa Melamed,
Yunhua Zhu,
Siew Hoon Tan,
Min Xie and
Mingshi Koh
Department of Biological Sciences, National University of Singapore, Singapore 117542
Address all correspondence and requests for reprints to: Philippa Melamed, Functional Genomics Laboratories, Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117542. E-mail: dbsmp{at}nus.edu.sg.
 |
Abstract
|
|---|
Transcription of mammalian LH ß-subunit genes (LHß) is regulated by GnRH through activation of early growth response factor-1 (Egr-1), which interacts synergistically with steroidogenic factor-1 (Sf-1) and pituitary homeobox-1 (Pitx1) at the promoter; Egr-1 is thought to comprise the major mediator of this effect. However, the proximal promoters of LHß genes in lower vertebrates lack an Egr-1 response element yet are responsive to GnRH; we demonstrate here that the promoter of the Chinook salmon LHß (csLHß) gene is also unresponsive to Egr-1. The homologous LHß promoters in other fish contain a conserved estrogen response element-like sequence, which we recently demonstrated is not required for estrogen receptor (ER)
association with the csLHß gene. Here we show that the estrogen response element-like element is required for the GnRH effect and for a response to c-jun overexpression. Using plasmid immunoprecipitation, we show that after GnRH exposure, c-jun associates with the intact csLHß gene promoter through this element. We further show that the effect of c-jun requires its DNA-binding domain and that c-jun interacts with Sf-1 and ER
and exerts synergistic effects on promoter activity with Sf-1, ER
, and Pitx1. Finally, we demonstrate the role of c-jun in mediating the GnRH effect on this gene through knockdown of c-jun expression or use of a dominant negative. We conclude that c-jun mediation of the GnRH effect on the LHß gene may be common in lower vertebrates and may have preceded an evolutionary divergence in the cis-regulatory elements that led to its function being replaced in mammals by Egr-1.
 |
Introduction
|
|---|
SYNTHESIS AND RELEASE of LH is stimulated by the hypothalamic GnRH. A consensus of research on various mammalian LHß promoters has led to the view that early growth response factor-1 (Egr-1) is the main mediator of this effect, being transcriptionally up-regulated and also phosphorylated within minutes of GnRH exposure (1, 2). Egr-1 interacts at the LHß gene promoter with steroidogenic factor-1 (Sf-1) and pituitary homeobox-1 (Pitx1), and its ability to bind two response elements (REs) on the proximal promoter appears absolutely essential to GnRH-induced transcription of mammalian LHß genes (1, 2, 3, 4, 5). Sf-1 and Pitx1 levels are not increased in response to GnRH, although Sf-1 may be phosphorylated as a result of MAPK activation, which mediates a part of the signal transduction of GnRH in the gonadotrope (2, 6, 7).
The high degree of sequence homology of various mammalian LHß gene proximal promoters further suggests that the role of this tripartite proximal element is highly conserved across mammalian species (2, 4, 8, 9). However, comparison with the LHß gene promoters of several fish reveals a number of differences; notably, the proximal promoters do not contain a consensus RE for Egr-1, yet studies on the Chinook salmon LHß (csLHß) gene promoter have demonstrated that it is highly responsive to GnRH (10). This indicates that the mechanism through which GnRH stimulates LHß gene expression in fish differs from that in mammals. The GnRH effect might be Egr-1 dependent through binding a nonconsensus RE or it may be recruited via protein-protein interactions. Alternatively, the GnRH effect might be Egr-1 independent as a result of other transcription factors being able to transduce the GnRH signal into the nucleus to stimulate LHß gene expression.
Fish LH levels are also tightly controlled by gonadal steroids, particularly estrogen, which is responsible for massive increases in LH levels just before spawning (11, 12). An estrogen RE (ERE)-like element is found on the proximal promoter of the csLHß gene (Fig. 1A
), and this sequence appears quite well conserved in other fish species; the common carp and goldfish contain a similar sequence at 135 or 138 bp upstream from the transcriptional start site, both diverging from the consensus ERE sequence in the first half of the palindrome by just two bases (13, 14), and the putative proximal promoter of the zebrafish LHß gene also contains an identical sequence (Ensembl Gene ID ENSDARG00000035709; Fig. 1A
). The csLHß ERE-like sequence, located 261 bp upstream of the transcriptional start site, was shown previously to bind estrogen receptor (ER) in gel mobility shift assays and also mediates the response of the promoter when transfected into HeLa cells together with an ER expression vector (15, 16). Proximal binding sites for Sf-1 and Pitx1 are also present on the csLHß gene promoter and we have shown that ER
interacts synergistically with Pitx1 and Sf-1 to stimulate promoter activity (10, 17).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1. A conserved region on several fish LHß gene promoters resembles an ERE/AP-1 binding site. A and B, Sequence similarities of the consensus ERE (A) or various AP-1 binding sites (B) (from the references cited) with the ERE-like sequence on the LHß gene promoter of Chinook salmon (csLHß) and of other teleost fish. Common residues are in bold, and in B, comparisons with two of the 5' AP-1 sites are as marked.
|
|
From here, we initially concluded that ER
might be involved in mediating the GnRH effect on the teleost LHß gene in place of Egr-1 (10, 12). However, our subsequent studies revealed that this ERE-like sequence is, in fact, not required for ER
binding to the promoter in the gonadotrope and that ER
is recruited to both the rat and salmon LHß genes through direct protein-protein interactions with Sf-1 and Pitx1 (18). Because of its apparent conservation across several fish species, we hypothesized that in lower vertebrates, a factor other than ER
might bind to this site and act as the crucial mediator of the GnRH effect, thus performing the function of Egr-1 in higher vertebrates. Notably, this element is also similar to various motifs that bind activator protein-1 (AP-1) factors on the c-jun, mTIMP3,
-fetoprotein, and Igf2 gene promoters (Fig. 1B
) (19, 20, 21, 22); moreover, AP-1 proteins are known to be activated rapidly after GnRH treatment (23, 24, 25). In the current study, therefore, we set out to investigate the ability of c-jun to activate the csLHß gene and its role in mediating the GnRH effect.
 |
Materials and Methods
|
|---|
Plasmid constructs
The csLHß and rat LHß promoter-CAT constructs have been previously described (10, 18). Site-directed deletions were carried out using the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) and the LHß-CAT constructs as template, according to the manufacturers instructions. Primers used for deletions comprised 1218 bp of the region flanking the RE on both sides and the complementary sequence. All constructs were sequenced to verify correct mutations.
The expression vector for the wild-type c-jun was created as described previously (26). The DNA-binding dominant-negative mutant (jun
RK), which lacks amino acids 251276 was prepared as in Ransone et al. (27). ER
, Pitx1, Egr-1, and Sf-1 expression vectors were gifts from F. Pakdel (Rennes, France), J. Drouin (Montreal, Canada), J. Milbrandt (St. Louis, MO), and K. Parker (Durham, NC), respectively. All of these encoded for mammalian proteins to ensure sufficient conservation for the protein-protein interactions.
The construct to target c-jun knockdown was prepared in the pSUPER vector as in Luo et al. (18) and comprised the oligo GATCCCCCTGCATAGCCAGAACACGCTTCAAGAGAGCGTGTTCTGGCTATGCAGTTTTTGGAAAA (the 19-nucleotide target is underlined) and its complementary sequence, which were ligated into the pSUPER vector. The construct was transfected into LßT2 cells 52 h before harvest (for Western analysis) or at the time of transfection of reporter gene and expression vectors (i.e. 48 h before harvest for reporter gene assays).
Confirmation of expression of wild-type and mutant c-jun proteins as well as the efficiency of the knockdown were tested by Western analysis using antisera specific to c-jun and to glyceradehyde-3-phosphate dehydrogenase (GAPDH) as the loading control (both from Santa Cruz Biotechnology, Santa Cruz, CA) at 1:1000 dilution (18).
Cell culture and transfections
COS 1 and LßT2 cells were cultured and transfected as described previously (10, 18). LßT2 cells were used for all transfections testing a GnRH response, whereas COS 1 cells were used to test the effects of the proteins that were overexpressed to minimize problems of endogenous expression of these same proteins. For cells exposed to GnRH analog (des-Gly10,[D-Ala6]LHRH; Sigma Chemical Co., St. Louis, MO), this was added to the medium 8 h before harvest, unless otherwise stated. Treated and control cells were rinsed before addition of the GnRH, added at 0.1% of the culture media to a final concentration of 10 nM. In cells in which ER
was overexpressed, estradiol was added to the media (0.1% volume) to a final concentration of 10 nM.
Chloramphenicol acetyltransferase (CAT), ß-galactosidase (ß-gal), and luciferase assays were performed as described previously (17, 18). The CAT/ß-gal or firefly/Renilla luciferase activity was calculated as a ratio to the basal levels of activity of the control (unstimulated and unmutated) construct.
Two-hybrid assays
The Gal4 response element of pG5CAT (CLONTECH, Palo Alto, CA) was subcloned into the pGL3 (Promega, Madison, WI) firefly luciferase plasmid, and the transcription factor cDNAs were cloned into the Gal4DBD-encoding plasmid (pM), and/or the activation domain-encoding plasmid (pVP16; CLONTECH). Cells were plated at 2 x 104 cells per well in 96-well plates before transfection using 2 µl GenePORTER2 per well, 0.15 µg of the pM and pVP16 fusion-constructs, and 0.1 µg of the reporter gene, with 0.01 µg of Renilla luciferase construct (Promega) as internal control. Cells were incubated for 40 h before harvest, with estradiol (Sigma) added to the media (0.1% volume) for the last 24 h. Reporter gene activity was measured using the Dual-Glo system (Promega) and calculated, after normalization, as fold activity over that in cells transfected with the empty pM and pVP constructs.
Plasmid immunoprecipitation
Plasmid immunoprecipitation was carried out in LßT2 cells as described previously (18). Briefly, the empty pBLCAT3 or the csLHß-CAT constructs were transfected at 0.7 µg per 60-mm plate, and formaldehyde was infused 48 h later, after completion of the GnRH treatment (10 nM for 2 or 4 h). Precipitation was carried out using antisera to c-jun (Santa Cruz Biotechnology; sc-45) at 5 µl per sample. PCR was performed using primers targeting the csLHß promoter (which do not recognize the endogenous mouse LHß promoter) or those targeting the CAT3 vector (for promoterless controls); the amplicons were resolved on ethidium bromide-stained gels.
Statistical analysis
One-way ANOVA followed by the Bonferroni t test was used to determine means that were statistically different. Differences were considered significant when P < 0.05. All experiments were repeated at least three times, and representative results are presented.
 |
Results
|
|---|
Egr-1 is not involved in GnRH stimulation of csLHß gene promoter activity
Although an Egr-1 RE is not present on the proximal csLHß gene promoter, a sequence identical to the Egr-1 RE on the mammalian LHß gene proximal promoters (CACCCCCACA) is located at 2509 bp upstream of the start site. Our earlier work has demonstrated a likely role for the upstream region in the GnRH response and a possible role for Pitx1, binding four sites between 1366 and 1506 bp from the start site, in facilitating interactions between distal and proximal regions of the promoter (10). Knowing that Egr-1 interacts physically and functionally with Sf-1 and Pitx1 on mammalian LHß gene promoters, we investigated whether this element has a functional role in activation of the csLHß gene promoter. The full-length 3.3-kb csLHß-CAT gene promoter or the same promoter with this element deleted was thus transfected into LßT2 cells, some of which were treated with GnRH (10 nM for 8 h). Both constructs shared similar basal levels of activity and responded to the GnRH treatment with a 3- to 4-fold increase in promoter activity, indicating that this element does not play a role in the GnRH response (Fig. 2A
).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2. Egr-1 is not involved in GnRH stimulation of csLHß gene promoter activity. A, A near-consensus Egr-1 RE, identical to that found on the mammalian LHß gene proximal promoters found 2.5 kb upstream on the csLHß gene promoter, was deleted, and this or the intact 3.3-kb csLHß-CAT construct (0.8 µg) was transfected into LßT2 cells, some of which were subsequently exposed to GnRH (10 nM, 8 h). After 48 h, cells were harvested and CAT and ß-gal levels assayed. The normalized CAT levels are expressed as fold over those of the untreated intact controls. Also shown is the relative activity of the empty CAT3 vector. Results are shown as mean ± SEM; n = 4. Simple t tests compared means as shown. B, Egr-1 was overexpressed in LßT2 cells at three different concentrations, and the effect on promoter activity of the csLHß-CAT or rat LHß-CAT (0.8 µg) was measured. Normalized CAT/ß-gal values are presented relative to those in the untreated control cells. Statistical analysis (Bonferroni t test) was carried out separately for each promoter, and the same letter is assigned to groups with similar means. Results are shown as mean ± SEM; n = 4.
|
|
The possibility that Egr-1 might have indirect actions through interacting with other DNA-binding factors was subsequently addressed through its overexpression in LßT2 cells in which these other potentially interacting proteins would be present; effects on the csLHß-CAT or rat LHß-CAT constructs were then measured. Egr-1 (0.11 µg of the expression construct) was highly stimulatory to the rat LHß promoter, dramatically increasing its activity in a dose-related manner. The same treatment in parallel experiments had no apparent effects on the activity of the csLHß promoter (Fig. 2B
). Although we chose to use expression vectors for the mammalian proteins, the Egr-1 protein is highly conserved in fish, especially in the DNA-binding domain (DBD) (28). It is unlikely therefore that this is the reason for the lack of Egr-1 effect.
Activation of the csLHß gene promoter by GnRH requires the ERE-like element and the binding site for Sf-1
To verify the role of the ERE-like sequence and the Sf-1 RE in the GnRH response of the csLHß gene promoter, transfections were carried out in LßT2 cells using the intact csLHß-CAT construct or after deletion of the pERE (at 261 bp from the start site) or Sf-1 RE (at 154 bp from the start site). Some of the cells were then exposed to GnRH for 8 h. The intact promoter responded to GnRH exposure with an increase in activity over 5-fold, whereas deletion of the ERE abolished the response to GnRH (Fig. 3A
). Similarly, deletion of the Sf-1 RE reduced basal levels to less than 5% of those of the intact promoter, and the GnRH effect was completely absent (Fig. 3B
).

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3. Activation of the csLHß gene promoter by GnRH requires the proximal ERE-like element and the binding site of Sf-1. A and B, The ERE-like element (at 261 bp) (A) or the Sf-1 binding site (at 154 bp) (B) on the csLHß gene promoter was deleted, and these or the intact 3.3-kb csLHß-CAT constructs (0.8 µg) were transfected into LßT2 cells, some of which were subsequently exposed to GnRH (10 nM, 8 h). Cells were harvested and CAT/ß-gal values calculated and presented as in Fig. 2A , with statistical analysis (Bonferroni t test) comparing all groups; the same letter is assigned to groups with similar means. Results are shown as mean ± SEM; n = 4.
|
|
C-jun activates the csLHß promoter through the ERE-like sequence
To test whether the csLHß promoter is responsive to c-jun overexpression, and a possible role for the ERE-like sequence in this effect, the intact or ERE-deleted mutant csLHß-CAT construct was transfected with or without the c-jun expression vector in COS 1 cells. Notably, the c-jun increased activity of the intact promoter by over 13-fold, whereas the ERE-deleted csLHß did not respond, although in this cell line, basal activity was elevated as a result of the mutation (Fig. 4A
).

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4. C-jun activates the csLHß promoter through the ERE-like sequence. A, The intact csLHß-CAT construct, or that in which the ERE-like sequence had been removed, was transfected (1.9 µg) into COS 1 cells, with or without the c-jun expression vector (0.5 µg). Cells were harvested and CAT/ß-gal values calculated and presented as in Fig. 3 . Results are shown as mean ± SEM; n = 4. B, The empty CAT3 vector or the intact or the mutant csLHß-CAT constructs (0.7 µg) were transfected into LßT2 cells and exposed to 04 h GnRH before plasmid immunoprecipitation with antisera to c-jun and PCR using primers to the plasmid (for empty pBLCAT3) or to the csLHß promoter. All experiments were in duplicate and assayed with and without the antisera. An aliquot was removed from each sample before precipitation to serve as the input that controls for the presence of the plasmid before precipitation.
|
|
To confirm that the ERE is involved in recruitment of the c-jun to this promoter, plasmid immunoprecipitation studies were carried out in LßT2 cells using the same intact or ERE-deleted mutant csLHß construct. For all samples, PCR was carried out in an aliquot before precipitation to confirm that the plasmids had been successfully transfected, and precipitations were performed with and without antisera to confirm the specificity of the reactions. The c-jun antisera failed to precipitate the plasmid in untreated cells but successfully pulled down the intact csLHß promoter plasmid after 2 or 4 h of GnRH treatment. However, in cells transfected with the ERE-deleted construct, the plasmid was not detected after 0, 2, or 4 h GnRH treatment (Fig. 4B
).
The stimulatory effect of c-jun on the csLHß promoter requires the DBD
Given that c-jun can activate transcription by direct binding to the DNA, or through indirect actions via protein-protein interactions with other DNA-binding factors, we sought to test whether the DBD of c-jun is crucial for its effect on the csLHß gene promoter. For this, we overexpressed in COS 1 and LßT2 cells a c-jun mutant in which the DBD is not functional (jun
RK). In both cases, we found that the jun
RK was unable to stimulate promoter activity (P > 0.05), whereas the wild-type c-jun had a significant stimulatory effect (P < 0.05; Fig. 5
, A and B). The expression of the wild-type and the mutant c-jun proteins was confirmed by Western blotting in LßT2 cells, as was the increase in c-jun protein levels after GnRH exposure (Fig. 5C
).
C-jun interacts with other transcription factors that activate the csLHß gene
With the knowledge that the mammalian LHß gene is activated in response to GnRH through a synergistic complex of transcription factors, we tested the ability of c-jun to interact with Sf-1, Pitx1, and ER
, using mammalian two-hybrid assays. The transcription factors in pM- or pVP-fusion expression vectors were transfected in LßT2 cells as pairs, and each was also transfected individually with the second empty vector as a control for background activity. This revealed the interaction of c-jun with Sf-1 or with ER
but not with Pitx1. We also saw the strong pair-wise interactions between Sf-1, ER
, and Pitx1 (Fig. 6A
).
The functional effects of these interactions were also tested by overexpressing the transcription factors in COS 1 cells and measuring the effect on the csLHß promoter activity. Overexpression of c-jun alone was found to induce the basal promoter activity approximately 10-fold, whereas overexpressing Sf-1 and Pitx1 had a similar but slightly less potent effect. Addition of all three factors increased promoter activity to over 40-fold those of the basal unstimulated controls in a clearly synergistic effect. Sf-1 and Pitx1 also interact synergistically with the liganded ER
, and when c-jun was overexpressed together with these three factors, it increased promoter activity further from 30- to over 60-fold that in the control cells (Fig. 6B
).
C-jun is involved in mediating the GnRH stimulatory effect on the csLHß gene promoter activity
To verify a role for c-jun in mediating the GnRH effect on the csLHß gene, we created a small interfering RNA (siRNA) construct to reduce c-jun expression. The efficiency of this construct in reducing c-jun protein levels was shown by Western analysis in LßT2 cells treated with GnRH for 2 h, which showed considerably reduced levels compared with the controls (Fig. 7A
, inset). Transfection of this construct at the same time as the csLHß-CAT reporter gene construct and subsequent treatment with GnRH revealed that the GnRH response was reduced significantly from approximately 5-fold in the controls to 3-fold in the presence of the c-jun knockdown (Fig. 7A
). We also used the dominant negative jun
RK in cells with or without GnRH treatment, and transfection of this construct also reduced the effect of the GnRH from 7-fold in the controls to just under 2-fold (Fig. 7B
).
 |
Discussion
|
|---|
A wealth of information has been published over the years to support a crucial role for Egr-1 in mediating the GnRH effect on mammalian LHß genes; its rapid and dramatic activation by GnRH is thought to trigger a cascade of events involving a stoichiometric change in the proximal promoter resulting in synergistic interactions of proteins in the activating complex and also the recruitment of coactivators, such as p300 (9, 29). Furthermore, Egr-1 knockout in female mice led to infertility as a result of severely reduced LHß gene levels (30). However, in the current study, we present data strongly suggesting that Egr-1 does not mediate the stimulatory effects of GnRH on the LHß gene of a lower vertebrate, but rather another early response gene, c-jun, performs this role. The ability of GnRH to increase c-jun transcription in the pituitary has been reported, and microarray analysis reveals that the kinetics and magnitude of response are paralleled only among other early response genes such as Egr-1, Egr-2, ATF3, and c-fos (24, 31).
AP-1 factors bind as a jun-fos heterodimer or as a jun homodimer to an element that generally includes a TGAGTCA sequence, although much variation in the binding element has been observed (20, 21, 32). This exact sequence is not found on the csLHß proximal promoter, but the responsiveness to c-jun maps to a region previously identified as an ERE-like element that bears similarity to other AP-1 binding sites (Fig. 1B
). We have used plasmid immunoprecipitation to confirm that this element is required for c-jun association with the promoter, which is detectable only after GnRH treatment. The fact that this sequence is also required for the GnRH response clearly points to a role for c-jun in mediating the GnRH effect. This was confirmed by the siRNA knockdown of c-jun, or introduction of a dominant-negative jun mutant, both of which attenuated the GnRH response.
Like Egr-1, c-jun also interacts with the other proteins forming the active complex on the proximal LHß gene promoter. We and others have already demonstrated a role for Sf-1, Pitx1, and ER
in activating the csLHß gene and also the role of the proximal Pitx1 binding site in the GnRH effect (10, 17, 18). Here we show the role of the Sf-1 binding site in both the basal and GnRH-stimulated promoter activity, while also demonstrating interactions between all of these proteins. The one notable exception is that we were not able to see any interaction between c-jun and Pitx1, which contrasts with an earlier study by Jeong et al. (33). That study employed several approaches that indicate that an interaction can occur between the two proteins via the Pitx1 homeodomain. The same group also carried out coimmunoprecipitation revealing that c-jun and Pitx1 are found in the same complexes in vivo in LßT2 cells, and they showed that these factors act together to transactivate the GnRH receptor gene (33). The reason for the discrepancy regarding the direct interaction of these proteins remains unclear, because both fusion constructs were clearly functional in our study, as apparent from their ability to interact with the other fusion proteins.
Functional synergy in activation of the csLHß gene promoter was also apparent between these transcription factors. Our previous studies indicated a central role for Sf-1, whose overexpression stimulates activity of this promoter and likely helps recruit ER
and/or Pitx1, with ER
appearing to enhance the Sf-1-Pitx1 interaction (10, 18, 34). Although deletion of the Sf-1 RE abolishes both Sf-1 and ER
binding, deletion of the ERE does not alter the ability of Sf-1 and Pitx1 with or without ER
to stimulate promoter activity (18). Here we show that the activities of Sf-1 and Pitx1, with or without ER
, are further enhanced by the overexpression of c-jun. We attribute the synergistic effect to the likely cooperative recruitment of coactivators; notably, p300 contains at least four distinct interaction domains enabling it to interact with a large number of transcription factors that include c-jun as well as Egr-1 (29, 35).
Based on our current and previous findings, we propose a model for GnRH activation of transcription of the csLHß gene: in the unstimulated cell, Sf-1 and Pitx1 are likely associated with the promoter and are responsible for low basal levels of activity (Tan, S. H., and P. Melamed, unpublished observation) (Fig. 8A
). After exposure to GnRH, the levels of active c-jun are dramatically increased, allowing its recruitment to the promoter where it binds the cis-element and is stabilized by the neighboring Sf-1, with which it interacts directly. Furthermore, GnRH stimulates ER
ubiquitylation, increasing its interactions with Sf-1 and Pitx1 and thus its association with the promoter (18). The GnRH-stimulated recruitment of ER
to the promoter likely also stabilizes the binding of c-jun through additional protein-protein interactions between these two factors (Fig. 8B
).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 8. A model of the hypothesized actions of GnRH on the csLHß gene promoter. A, In unstimulated conditions, the csLHß gene is transcribed at low levels because of the presence of Sf-1 and Pitx1. B, Upon stimulation by GnRH, levels of c-jun are increased and it binds the promoter through direct interaction with the ERE-like cis-element, while also interacting with Sf-1. In addition, GnRH ubiquitylates the ER , increasing its indirect association with the promoter through protein-protein interactions, and this stabilizes the activating complex through additional interactions with c-jun as well as with Sf-1 and Pitx1. The recruitment of this complex facilitates interaction with coactivators such as p300 that interact with the general transcription machinery and RNA pol II.
|
|
In conclusion, we have provided evidence that Egr-1 is not necessarily the pivotal mediator of LHß gene activation by GnRH. Instead, transcription is stimulated through an alternative transcription factor that forms a complex that is otherwise similar to that activating the mammalian homologous genes. The sequence similarity of this AP-1 binding element across fish species and the apparent lack of an Egr-1 binding site indicate that the role of c-jun in mediating the GnRH effect may be common among fish. Although few genome sequences are available for other lower vertebrates, the putative LHß proximal promoter of Xenopus laevis also lacks an obvious Egr-1 RE, whereas a putative AP-1 site (ATGCTGTCA) is found at 138 bp upstream of the predicted first codon (Ensembl Gene ID ENSXETG00000021249). These findings suggest that the role of c-jun in mediating the GnRH effect on the LHß gene perhaps preceded an evolutionary divergence that led to this function being supplanted by Egr-1 in mammals. The reasons for evolutionary divergence in signaling mechanisms from a common regulator to homologous gene targets in different vertebrate phyla are poorly described and understood, and the reasons for a differential role of these transcription factors in regulating LHß gene expression have yet to be elucidated.
 |
Footnotes
|
|---|
This research was supported by the Academic Research Fund, National University of Singapore. M.K. is a recipient of the Singapore Millennium Fellowship, and P.M. is a recipient of the Young Investigator Award, Office of Life Sciences, National University of Singapore.
Disclosure statement: P.M., Y.Z., S.H.T., M.X., and M.K. have no potential conflicts of interest to declare.
First Published Online April 20, 2006
Abbreviations: AP-1, Activator protein-1; CAT, chloramphenicol acetyltransferase; csLHß, Chinook salmon LHß; DBD, DNA-binding domain; Egr-1, early growth response factor-1; ER, estrogen receptor; ERE, estrogen response element; ß-gal, ß-galactosidase; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Pitx1, pituitary homeobox-1; RE, response element; Sf-1, steroidogenic factor-1; siRNA, small interfering RNA.
Received January 6, 2006.
Accepted for publication April 11, 2006.
 |
References
|
|---|
- Dorn C, Ou Q, Svaren J, Crawford PA, Sadovsky Y 1999 Activation of luteinizing hormone ß gene by gonadotropin-releasing hormone requires the synergy of early growth response-1 and steroidogenic factor-1. J Biol Chem 274:1387013876[Abstract/Free Full Text]
- Tremblay JJ, Drouin J 1999 Egr-1 is a downstream effector of GnRH and synergizes by direct interaction with Ptx1 and SF-1 to enhance luteinizing hormone ß gene transcription. Mol Cell Biol 19:25672576[Abstract/Free Full Text]
- Halvorson LM, Kaiser UB, Chin WW 1999 The protein kinase C system acts through the early growth response protein 1 to increase LHß gene expression in synergy with steroidogenic factor-1. Mol Endocrinol 13:106116[Abstract/Free Full Text]
- Wolfe MW, Call GB 1999 Early growth response protein 1 binds to the luteinizing hormone-ß promoter and mediates gonadotropin-releasing hormone-stimulated gene expression. Mol Endocrinol 13:752763[Abstract/Free Full Text]
- Quirk CC, Lozada KL, Keri RA, Nilson J 2001 A single Pitx1 binding site is essential for activity of the LHß promoter in transgenic mice. Mol Endocrinol 15:734746[Abstract/Free Full Text]
- Hammer GD, Krylova I, Zhang Y, Darimont BD, Simpson K, Weigel NL, Ingraham HA 1999 Phosphorylation of the nuclear receptor SF-1 modulates cofactor recruitment: integration of hormone signaling in reproduction and stress. Mol Cell 3:521526[CrossRef][Medline]
- Naor Z, Benard O, Seger R 2000 Activation of MAPK cascades by G-protein-coupled receptors: the case of gonadotropin-releasing hormone receptor. Trends Endocrinol Metab 11:9199[CrossRef][Medline]
- Weck J, Anderson AC, Jenkins S, Fallest PC, Shupnik MA 2000 Divergent and composite gonadotropin-releasing hormone-responsive elements in the rat luteinizing hormone subunit genes. Mol Endocrinol 14:472485[Abstract/Free Full Text]
- Jorgensen JS, Quirk CC, Nilson JH 2004 Multiple and overlapping combinatorial codes orchestrate hormonal responsiveness and dictate cell-specific expression of the genes encoding luteinizing hormone. Endocr Rev 25:521542[Abstract/Free Full Text]
- Melamed P, Koh M, Preklathan P, Bei L, Hew C 2002 Multiple mechanisms for Pitx-1 transactivation of a luteinizing hormone ß subunit gene. J Biol Chem 277:2620026207[Abstract/Free Full Text]
- Melamed P, Gur G, Rosenfeld H, Elizur A, Schulz RW, Yaron Z 2000 Reproductive development of male and female tilapia hybrids (Oreochromis niloticusx O. aureus) and changes in mRNA levels of gonadotropin (GH) Iß and IIß subunits. J Exp Zool 286:6475[CrossRef][Medline]
- Yaron Z, Gur G, Melamed P, Rosenfeld H, Elizur A, Levavi-Sivan B 2003 Regulation of fish gonadotropins. Int Rev Cytol 225:131185[Medline]
- Chang Y-S, Huang F-L, Lo T-B 1992 Isolation and sequence analysis of carp gonadotropin ß-subunit gene. Mol Mar Biol Biotechnol 1:97105[Medline]
- Sohn YC, Yoshiura Y, Suetake H, Kobayashi M, Aida K 1999 Nucleotide sequence of gonadotropin IIß subunit gene in goldfish. Fisheries Sci 65:800801
- Xiong F, Liu D, Le Dréan Y, Elsholtz HP, Hew CL 1994 Differential recruitment of steroid hormone response elements may dictate the expression of the pituitary gonadotropin IIß subunit gene during salmon maturation. Mol Endocrinol 8:782793[Abstract/Free Full Text]
- Liu D, Xiong F, Hew CL 1995 Functional analysis of estrogen-responsive elements in Chinook salmon (Oncorhynchus tschawytscha) gonadotropin IIß subunit gene. Mol Endocrinol 136:34863493
- Le Dréan Y, Liu D, Wong AOL, Xiong F, Hew CL 1996 Steroidogenic factor 1 and estradiol receptor act in synergism to regulate the expression of the salmon gonadotropin IIß subunit gene. Mol Endocrinol 10:217229[Abstract/Free Full Text]
- Luo M, Koh M, Feng J, Wu Q, Melamed P 2005 Cross talk in hormonally regulated gene transcription through induction of estrogen receptor ubiquitylation. Mol Cell Biol 25:73867398[Abstract/Free Full Text]
- Angel P, Hattori K, Smeal T, Karin M 1988 The jun proto-oncogene is positively autoregulated by its product, jun/AP-1. Cell 55:875885[CrossRef][Medline]
- Caricasole A, Ward A 1993 Transactivation of mouse insulin-like growth factor II (IGF-II) gene promoters by the AP-1 complex. Nucleic Acids Res 21:18731879[Abstract/Free Full Text]
- Kim H, Pennie WD, Sun Y, Colburn NH 1997 Differential functional significance of AP-1 binding sites in the promoter of the gene encoding mouse tissue inhibitor of metalloproteinases-3. Biochem J 324:547553
- Zhang XK, Dong JM, Chiu JF 1991 Regulation of
-fetoprotein gene expression by antagonism between AP-1 and the glucocorticoid receptor at their overlapping binding site. J Biol Chem 266:82488254[Abstract/Free Full Text] - Cesnjaj M, Catt KJ, Stojilkovic SS 1994 Coordinate actions of calcium and protein kinase-C in the expression of primary response genes in pituitary gonadotrophs. Endocrinology 135:692701[Abstract]
- Wurmbach E, Yuen T, Ebersole BJ, Sealfon SC 2001 Gonadotropin-releasing hormone receptor-coupled gene network. J Biol Chem 276:4719547201[Abstract/Free Full Text]
- Yuen T, Wurmbach E, Ebersole BJ, Ruf F, Pfeffer RL, Sealfon SC 2002 Coupling of GnRH concentration and the GnRH receptor-activated gene program. Mol Endocrinol 16:11451153[Abstract/Free Full Text]
- Chong KL, Wang S, Melamed P 2004 Isolation and characterization of the follicle-stimulating hormone ß subunit gene and 5' flanking region of the Chinook salmon. Neuroendocrinology 80:158170[Medline]
- Ransone LJ, Visvader J, Wamsley P, Verma IM 1990 Trans-dominant negatives of Fos and Jun. Proc Natl Acad Sci USA 87:38063810[Abstract/Free Full Text]
- Drummond IA, Rohwer-Nutter P, Sukhatme VP 1994 The zebrafish egr1 gene encodes a highly conserved, zinc-finger transcriptional regulator. DNA Cell Biol 13:10471055[Medline]
- Mouillet JF, Sonnenberg-Hirche C, Yan X, Sadovsky Y 2004 p300 regulates the synergy of steroidogenic factor-1 and early growth response-1 in activating luteinizing hormone-ß subunit gene. J Biol Chem 279:78327839[Abstract/Free Full Text]
- Lee SL, Sadovsky Y, Swirnoff AH, Polish JA, Goda P, Gavrilina G, Milbrandt J 1996 Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGF1-A (Egr-1). Science 273:12191221[Abstract]
- Kakar SS, Winters SJ, Zacharias W, Miller DM, Flynn S 2003 Identification of distinct gene expression profiles associated with treatment of LßT2 cells with gonadotropin-releasing hormone agonist using microarray analysis. Gene 308:6777[CrossRef][Medline]
- Norwitz ER, Xu S, Xu J, Spiryda LB, Park S, Jeong KH, McGee EA, Kaiser UB 2002 Direct binding of AP-1 (fos/jun) proteins in SMAD binding element facilitates both gonadotropin-releasing hormone (GnRH)-and activin-mediated transcriptional activation of the mouse GnRH receptor gene. J Biol Chem 277:3746937478[Abstract/Free Full Text]
- Jeong KH, Chin WW, Kaiser UB 2004 Essential role of the homeodomain for pituitary homeobox 1 activation of mouse gonadotropin-releasing hormone receptor gene expression through interactions with c-Jun and DNA. Mol Cell Biol 24:61276139[Abstract/Free Full Text]
- Melamed P, Abdul Kadir MN, Wijeweera A, Seah S Transcription of gonadotropin ß subunit genes involves cross-talk between the transcription factors and co-regulators that mediate actions of the regulatory hormones. Mol Cell Endocrinol, in press
- Sterner DE, Berger SL 2000 Acetylation of histones and transcription-related factors. Microbiol Mol Biol Rev 64:435459[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
J. Feng, M. A. Lawson, and P. Melamed
A Proteomic Comparison of Immature and Mature Mouse Gonadotrophs Reveals Novel Differentially Expressed Nuclear Proteins that Regulate Gonadotropin Gene Transcription and RNA Splicing
Biol Reprod,
September 1, 2008;
79(3):
546 - 561.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H Brown, I. R Schultz, and J. J Nagler
Reduced embryonic survival in rainbow trout resulting from paternal exposure to the environmental estrogen 17{alpha}-ethynylestradiol during late sexual maturation
Reproduction,
November 1, 2007;
134(5):
659 - 666.
[Abstract]
[Full Text]
[PDF]
|
 |
|