help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0028
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/8/3797    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Silvertown, J. D.
Right arrow Articles by Medin, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Silvertown, J. D.
Right arrow Articles by Medin, J. A.
Endocrinology Vol. 147, No. 8 3797-3808
Copyright © 2006 by The Endocrine Society

Functional Expression of Mouse Relaxin and Mouse Relaxin-3 in the Lung from an Ebola Virus Glycoprotein-Pseudotyped Lentivirus via Tracheal Delivery

Josh D. Silvertown, Jagdeep S. Walia, Alastair J. Summerlee and Jeffrey A. Medin

Division of Stem Cell and Developmental Biology (J.D.S., J.S.W., J.A.M.), Ontario Cancer Institute, University Health Network, Toronto, Canada M5G 2M1; Department of Biomedical Sciences (A.J.S.), Ontario Veterinary College, University of Guelph, Guelph, Canada N1G 2W1; and Department of Medical Biophysics and the Institute of Medical Sciences (J.A.M.), University of Toronto, Toronto, Canada M5G 2M9

Address all correspondence and requests for reprints to: Jeffrey A. Medin, Ph.D., University Health Network, Canadian Blood Services Building, 67 College Street, Room 406, Toronto, Ontario, Canada M5G 2M1. E-mail: jmedin{at}uhnres.utoronto.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The peptide hormone relaxin is a known modulator of connective tissue and the extracellular matrix by virtue of its ability to regulate matrix metalloproteinases (MMPs). Relaxin knockout mice exhibit age-related pulmonary fibrosis, and delivery of recombinant human H2 relaxin ameliorates fibrotic-like conditions in the mouse lung. We investigated whether lentiviral vectors (LVs) engineering the expression of murine relaxins could induce MMP activity in the mouse lung. Mouse relaxin and mouse relaxin-3 peptides engineered by recombinant LVs were biologically active as shown by stimulation of cAMP from both THP-1 and 293T cells stably expressing relaxin receptor LGR7 and by up-regulation of MMP-2 activity from primary C57BL/6 lung cell cultures. To provide the virions with enhanced tropism for the lung, LVs were pseudotyped with the Zaire strain of the Ebola virus glycoprotein (EboZ GP) and delivered by endotracheal intubation. LVs engineering luciferase pseudotyped with EboZ GP, but not with vesicular stomatitis virus glycoprotein resulted in successful LV transduction and transgene expression in C57BL/6 mouse lung by as early as d 4. Mice treated via tracheal delivery with EboZ GP pseudotyped LVs that engineered expression of mouse relaxins exhibited increased MMP-2 and MMP-9 activity in lung tissue up until the end of our study at d 21. Taken together, this study provides proof-of- principle that relaxin gene expression targeted to the mouse lungs can result in enhanced MMP activity offering potential for alleviating disease conditions characterized by dysregulation of extracellular matrix protein accumulation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
MICE POSSESS TWO relaxin genes termed mouse RLN1 and mouse RLN3 encoding the hormones mouse relaxin and mouse relaxin-3, respectively. Humans possess three relaxin genes termed RLN1 (H1, unique to humans and great ape species), RLN2 (H2, equivalent to mouse relaxin), and RLN3 (H3, equivalent to mouse relaxin-3) (1, 2). Although relaxin genes possess low amino acid homology between different genes, alignments of relaxin-3 sequences from different species show high conservation (2). For example, the A- and B-chain sequences of mouse relaxin-3 and rat relaxin-3 are identical (3). All hormones of the relaxin family exhibit a conserved structure encoding a signal peptide, a B-chain, a connecting C-chain, and an A-chain that when processed conforms to a heterodimeric mature peptide, similar in structure to insulin-like hormones (2).

The relaxin polypeptide is a pleiotropic hormone with a spectrum of physiological functions in the mammal (2). One of the hallmarks of relaxin’s biological effects is its ability to remodel connective tissue by stimulating the modulation of collagen and other extracellular matrix (ECM) proteins (4). It is through these actions that relaxin is thought to assist in the loosening of pelvic ligaments, widening of the pubic symphysis, and softening of tissues in the birth canal to ease passage of the fetus during birth (2). The significance of relaxin in connective tissue remodeling was further confirmed by studying the phenotypes of the mouse RLN1-deficient (RLX–/–) and Lgr7-deficient mice (5, 6). An initial observation from the RLX–/– mouse was that these animals had poor mammary gland and nipple development during pregnancy, resulting in the inability of offspring to suckle from their RLX–/– mothers (5). Studies examining the age-related phenotypes of these knockout mice showed that tissues of the kidney, heart, and lung exhibit an apparent fibrotic phenotype (reviewed in Ref. 4). Importantly, treatment of these relaxin knockout mice with exogenous recombinant human H2 relaxin (rhH2) resulted in the reversal of cardiac and pulmonary fibrosis, particularly when rhH2 was administered to mice with early symptoms of the disease (7). The understanding of relaxin as a collagen-modulating agent led to the investigation of potential relaxin therapies delivered by sc osmotic pumps for the amelioration of pulmonary fibrosis in animal studies (8, 9). Recently, histological analyses of lung tissues derived from Lgr7-deficient mice demonstrated increased collagen accumulation and fibrosis surrounding the bronchioles and the vascular bundles, which are absent in wild-type animals (6).

Strategies of gene transfer to the lung for the treatment of pulmonary fibrosis have been described, most notably using adenoviral vectors (10, 11) because of the natural tropism of this virus for epithelial cells of the lung (12). However, pseudotyping, the process of replacing the native viral envelope protein with the glycoprotein of another enveloped virus, can expand the set of potential target cells for a viral vector or target entry to specific cells (13). The Ebola virus, a negative-sense RNA, enveloped, nonsegmented virus, also has a high tropism for pulmonary epithelium (14). Considering its evolutionary origins and the route of viral entry, pseudotyping lentiviral vectors (LVs) with the Zaire strain of the Ebola virus glycoprotein (EboZ GP) has enhanced transduction of airway epithelia in mice compared with LVs pseudotyped with vesicular stomatitis virus glycoprotein (VSVg) (15, 16, 17).

In the current paper, studies were performed to investigate whether EboZ GP-pseudotyped LVs encoding species-specific relaxins can be delivered by endotracheal intubation (ETI) to the murine lung and successfully engineer bioactive hormones. We found that EboZ GP-pseudotyped LVs engineering expression of mouse relaxin or mouse relaxin-3 can efficiently infect the murine lung and engender bioactivity by increasing matrix metalloproteinase (MMP) enzyme activity over a 21-d study period. This study provides proof-of-principle that relaxin gene expression targeted to the mouse lungs can result in enhanced MMP activity offering potential for alleviating disease conditions characterized by dysregulation of ECM protein accumulation, for example.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell lines, primary cell cultures, and their culture conditions
The human embryonic kidney cell line 293T (American Type Culture Collection, Rockville, MD) was cultured in DMEM (Sigma, Oakville, Ontario, Canada) supplemented with 10% fetal bovine serum (FBS) (Gemini Bio-Products, Woodland, CA). The human monocytic cell line, THP-1, was grown in RPMI 1640 medium with 2 mM l-glutamine, adjusted to contain 1.5 g/liter sodium bicarbonate, 4.5 g/liter glucose, 10 mM HEPES, and 1.0 mM sodium pyruvate and supplemented with 0.05 mM 2-mercaptoethanol (American Type Culture Collection). Primary C57BL/6 and NOD/SCID lung cells were isolated as previously described (18). Briefly, lungs were removed, washed twice by vortexing in Hanks’ buffered salt solution, without Ca2+ and Mg2+ (HBSS) (Life Technologies, Inc., Burlington, Ontario, Canada) to remove blood. Lung tissue was then minced using a sterile blade and washed again in HBSS. Small tissue pieces were placed in a 75-cm2 cell culture flask and allowed to adhere to the surface for 15 min at room temperature, followed by the addition of {alpha}-MEM (Life Technologies), supplemented with 15% FBS and 50 µg/ml gentamicin (Life Technologies). After 48 h, cultures were maintained and expanded in DMEM supplemented with 10% FBS, 100 U/ml penicillin, and 10 µg/ml streptomycin (Sigma). Cells were cultured at 37 C in a humidified atmosphere with 5% CO2.

Cloning of mouse relaxin and mouse relaxin-3
Ovary and brain tissues were extracted from pregnant, female NOD/SCID mice, minced with sterile scalpels, and homogenized in PBS. RNA was extracted using Trizol reagent (Invitrogen, Burlington, Ontario, Canada). RT-PCRs for mouse relaxin (ovary RNA) and mouse relaxin-3 (brain RNA) were performed using oligo-d(T) or random hexamer primers (Superscript First-Strand Synthesis System for RT-PCR; Invitrogen) to amplify template from 500 ng total RNA, respectively. Primers to amplify mouse relaxin were created based on the published mRNA sequence (accession number NM_011272): forward primer, 5'-atgtccagcagatttttgctc-3'; reverse primer, 5'-gcatgtgaacactggactgg-3'. The expected mouse relaxin amplicons of 599 bp were obtained after amplification for 30 cycles (denaturing at 94 C for 30 sec, annealing at 53 C for 30 sec, and elongation at 68 C for 60 sec) using Platinum Taq DNA Polymerase High Fidelity reagents (Invitrogen). Primers to amplify mouse relaxin-3 were created based on published mouse relaxin-3 primer sequences (1): forward primer, 5'-gggtcgcaggcatctcaactg-3'; reverse primer, 5'-gacagcagcttgcaggcacgg-3'. The expected relaxin-3 amplicons of 426 bp were obtained after amplification for 40 cycles (denaturing at 94 C for 30 sec, annealing at 48 C for 30 sec, and elongation at 68 C for 60 sec) using Platinum Taq DNA Polymerase High Fidelity reagents. The mouse relaxin and relaxin-3 cDNA amplified products were subcloned into pPCR-Script using the PCR-Script Amp Cloning Kit (Stratagene, La Jolla, CA) and sequenced in both forward and reverse orientation, using T7 and T3 primers. DNA sequencing was performed using a Model 377 ABI sequencer from Applied Biosystems (ACGT Corp., Toronto, Ontario, Canada). All molecular subcloning was performed with Escherichia coli XL-10 Ultracompetent cells (Stratagene).

Engineering of LVs
The mouse relaxin and relaxin-3 cDNAs were subcloned from pPCR-Script into the multiple cloning site of the pIRES2-eGFP expression plasmid (Clontech, Palo Alto, CA) using BamHI and SacII restriction enzymes (New England Biolabs, Mississauga, Ontario, Canada) and termed pRLN1-IRES-eGFP and pRLN3-IRES-eGFP (where RLN1 and RLN3 denote mouse relaxin and mouse relaxin-3), respectively. These constructs were then double digested with EcoRI/BamHI (New England Biolabs). The mouse relaxin and relaxin-3 cDNAs cassettes were then purified after electrophoresis on a 1% agarose gel, and subcloned into the pHR' LV backbone downstream of the elongation factor 1{alpha} (EF1{alpha}) promoter (19).

An envelope plasmid (pCI-neo; Promega) harboring the EboZ GP cDNA driven by a cytomegalovirus (CMV) promoter (generous gift from Dr. H. Feldmann, National Microbiology Laboratory, Public Health Agency of Canada, Winnipeg, Manitoba, Canada) was modified by subcloning a polyglutamine kinase promoter (pPGK) in substitution for the CMV promoter (pCI-PGK-Eb; Fig, 1AGo). This substitution was made as a safety precaution to reduce the chance of homologous recombination between pCI-PGK-Eb and the packaging plasmid (pCMV{Delta}R8.91), which also has a CMV promoter element, during the triple-transfection procedure used to make virus. LVs were constructed to engineer expression from the EF1{alpha}-RLN1-WPRE, EF1{alpha}-RLN3-WPRE, EF1{alpha}-eGFP-WPRE, or EF1{alpha}-Luciferase-WPRE cassettes, analogous to those described previously (19, 20, 21). LV virions were produced by a transient triple-transfection method using 293T monolayers (19). Briefly, approximately 11 x 106 293T cells were seeded in 15-cm-diameter plates in DMEM supplemented with 10% FBS. After a 24-h incubation, cells were transfected with 32 µg of one of four gene transfer vectors (pHR-cPPT-EF1{alpha}-RLN1-WPRE, pHR-cPPT-EF1{alpha}-RLN3-WPRE, pHR-cPPT-EF1{alpha}-eGFP-WPRE, or pHR-cPPT-EF1{alpha}-Luciferase-WPRE), 16.25 µg of packaging vector (pCMV{Delta}R8.91), and 7 µg of either the pCI-PGK-Eb or the VSVg (pMDG; Fig. 1BGo) envelope plasmid using calcium phosphate-mediated transfection (22). After 30 h, viral supernatants were harvested, filtered with a 0.45-µm unit (Nalgene, Rochester, NY), and concentrated approximately 300-fold in tissue-grade water (Sigma) after ultracentrifugation at 28,000 rpm for 1.5 h. LV vectors were denoted LV-Eb-RLN1, LV-Eb-RLN3, LV-Eb-eGFP, LV-Eb-Luc, or LV-VSV-Luc (Fig. 1CGo). Once concentrated, LV samples were prepared for electron microscopy analyses using the direct application method, a standard operating procedure for negative staining (Microscopy Imaging Laboratory, University of Toronto) (23, 24).


Figure 1
View larger version (55K):
[in this window]
[in a new window]
 
FIG. 1. LV constructs. A and B, Schematics of LV envelope plasmids pPGK-EboZ-GP (A) and pMDG (pCMV-VSVg) (B); C, schematic of LV pHR-cPPT-EF1{alpha}-TRANSGENE-WPRE gene transfer vectors used in this study. Transgene includes cDNA of eGFP, luciferase, mouse RLN1, or mouse RLN3. D and E, Electron microscopy ultrastructural images of LV-VSV-Luc (D) and LV-Eb-Luc (E) virions.

 
Titration of LVs
In the absence of reporter genes in the RLN1/RLN3 expression cassettes or antibodies available for mouse relaxins, concentrated LV suspensions were titered indirectly using two assays. In the first assay, concentrated LV titers measured by an HIV-1 p24 ELISA (PerkinElmer, Norwalk, CT) were determined to range from 1 x 108 to 5 x 108 virion particles/ml (1 x 104 virions {cong} 1 pg p24). In the second assay, titers were measured indirectly for functional infectious particles. 293T cells (2 x 105) were seeded in a six-well culture plate in complete medium and infected 24 h later with limiting dilutions of either the LV-Eb-Luc or LV-VSV-Luc vector. After another 72 h, cell cultures were incubated with D-luciferin (Molecular Imaging Products Co., Inc., Ann Arbor, MI), and imaged using the Xenogen IVIS Imaging System 100 (Xenogen Biosciences, Cranbury, NJ) with a back-illuminated CCD camera, cryogenically cooled to –105 C (Spectral Instruments, Tucson, AZ). Images were captured using Living Image software (Xenogen Biosciences) as previously described (20).

LV transduction and immunocytofluorescence (ICF) of primary lung cells
Primary NOD/SCID and C57BL/6 lung cell cultures (passage number 4) were seeded at a density of 4 x 104 cells per well in a 24-well culture dish. Cells were transduced at an estimated multiplicity of infection (MOI) of 1 with LV-Eb-Luc in the presence of protamine sulfate (8 µg/ml; Sigma). After 3 wk in culture, cells were analyzed by ICF for luciferase expression as previously described (20).

RT-PCR for relaxin receptor expression
RNA was isolated using the Trizol reagent (Invitrogen) from THP-1, 293T, and primary NOD/SCID and C57BL/6 lung cell cultures. RT-PCR was performed (as above) on 5 µg total RNA for each cell sample. Primers to amplify murine GPCR135 and GPCR142 relaxin-3 receptors (also termed as RXFP3 and RXFP4, respectively) (25) were created based on published primer sequences (26). The expected amplicons of approximately 385 bp (GPCR135) and 440 bp (GPCR142) were obtained after amplification for 40 cycles (denaturing at 94 C for 30 sec, annealing at 65 C for 30 sec, and elongation at 72 C for 2 min) using Taq DNA polymerase reagents (Invitrogen). Primers to amplify murine LGR7 (also termed as RXFP1) (25) were created based on accession number AY509975: forward primer, tataaactggcttccactaactcc; reverse primer, tgactgaggtacagtttagtgagg. The expected amplicon of approximately 311 bp was obtained after amplification for 35 cycles (denaturing at 94 C for 30 sec, annealing at 55 C for 35 sec, and elongation at 72 C for 35 sec). Primers and conditions to amplify the human transcripts of ß-actin, GPCR135, and GPCR142 were based on previously published data (27, 28, 29). Primers to amplify glyceraldehyde-3-phosphate dehydrogenase mRNA transcripts were created based on published sequences (30). The expected amplicon of approximately 300 bp was obtained after amplification for 30 cycles (denaturing at 94 C for 30 sec, annealing at 56 C for 30 sec, and elongation at 72 C for 60 sec) using Taq DNA polymerase reagents (Invitrogen).

Development of a stable LGR7-expressing 293T cell line
293T cells were transfected (as above) with the pcDNA3.1-Zeo expression vector (Invitrogen) expressing human LGR7 (generous gift from Dr. Sheau Yu Teddy Hsu, Stanford University) and subjected to antibiotic selection with 0.5 mg/ml Zeocin (Invitrogen) as described before (31). Two days after transfection, cells were seeded at ultra-low density onto 10-cm-diameter plates. After 2 wk, 12 clones were isolated with cloning rings (Bellco Glass, Inc., Vineland, NJ) and expanded. RNA was extracted, and RT-PCR was performed for LGR7 expression (as above). 293T-LGR7 clones were subsequently maintained in 0.25 mg/ml Zeocin.

cAMP ELISA
To confirm that the cloned cDNAs encode bioactive mouse relaxin and relaxin-3 hormones, the THP-1 and 293T-LGR7 cell lines were employed as target cells to measure cAMP as in vitro relaxin bioassays (31, 32, 33). To prepare samples, 293T cell cultures were infected with LV-Eb-RLN1, LV-Eb-RLN3, or LV-Eb-eGFP at an MOI of approximately 1. After 2 wk in culture, LV-infected 293T cells were seeded at a density of 3 x 105 cells per well in a six-well dish in complete medium. After 5 d, conditioned medium (CM) were harvested from each sample and lyophilized, and each was resuspended in one tenth the original volume. THP-1 and 293T-LGR7 cells were seeded at a density of 8 x 104 viable cells per well in a 96-well plate. Cells were allowed to equilibrate at 37 C in a 5% C02 incubator for 2 h. THP-1 and 293T-LGR7 cells were stimulated with 10 µl concentrated CM and diluted CM (1:50) from each LV-infected 293T sample, respectively. Samples were diluted in assay diluent (THP-1 culture medium, 0.1% BSA, 0.01% polysorbate 80), containing forskolin (Sigma) and isobutylmethylxanthine (Sigma) giving final concentrations of 1 and 50 µM, respectively. Levels of intracellular and extracellular cAMP were determined with the cAMP Biotrak Enzymeimmunoassay (EIA) System (GE Healthcare, Piscataway, NJ), according to the manufacturer’s instructions. Experiments were repeated three times, and all samples were analyzed in triplicate.

LV tracheal delivery and bioluminescent imaging (BLI)
Six- to 8-wk-old C57BL/6 mice (Jackson Laboratories, Bar Harbor, ME) were maintained at the Animal Resource Facility at the Princess Margaret Hospital (Toronto, Ontario, Canada) under an approved University Health Network (UHN; Toronto, Ontario, Canada) protocol. All animal preparations and LV deliveries were approved by UHN Biosafety and Animal Care Committees, and performed in a Level 2 biological safety cabinet. Animals were anesthetized with 10 mg/kg ketamine hydrochloride (100 mg/ml, ip; Ketalean) and 150 mg/kg xylazine (1 mg/ml, im; Rompun). After adequate anesthesia, ETI was performed in mice using a 22-gauge iv catheter (Surflo; Terumo, Leuven, Belgium) and connected to a small-animal ventilator (model 693; Harvard Apparatus, Boston, MA) using HEPA-filtered air (Fig. 2AGo). To deliver the LV, mice were temporarily detached from ventilation, and 10-gauge polyethylene tubing (PE10, Intramedic, Clay Adams Brand; BD Biosciences, San Jose, CA) connected to a 30-gauge needle was inserted into the endotracheal tube. Approximately 40 µl concentrated LV suspension of similar p24 titers (LV-Eb-Luc, n = 9; LV-VSV-Luc, n = 6; LV-Eb-RLN1, n = 6; or LV-Eb-RLN3, n = 6) or saline was delivered to each mouse over a period of 10 sec. Mice were promptly placed back on ventilation for an additional 15 min until unassisted breathing was observed. Mice were monitored daily for adverse reactions and changes in behavior. On d 4 and 10, three mice from each LV-Eb-Luc- or LV-VSV-Luc-delivered group were given an ip injection of D-luciferin (150 mg/kg) immediately before BLI. After 10 min, mice were killed, and lungs were removed and washed with PBS, placed in a six-well dish, and imaged using the Xenogen IVIS Imaging System 100 (Xenogen Biosciences).


Figure 2
View larger version (47K):
[in this window]
[in a new window]
 
FIG. 2. Delivery of LV by ETI. A, ETI of an anesthetized mouse using a 22-gauge iv catheter used as an endotracheal tube connected to a small-animal ventilator (arrow) using HEPA-filtered air. When the endotracheal tube is detached from the ventilator tube (arrow), tubing connected to a 30-gauge needle and syringe is inserted for LV delivery. B, Mouse lung anatomy and lobation. Mice have six lung lobes: two left lobes (termed caudal and cranial), and four lobes on the right (termed cranial, middle, caudal, and accessory).

 
Gelatin zymography
Cell culture samples.
C57BL/6 mouse primary lung and 293T cell cultures were seeded and infected with LV-Eb-RLN1, LV-Eb-RLN3 or LV-eGFP at an MOI of 1. After 4 d in culture, the LV-infected C57BL/6 mouse primary lung and 293T cells were seeded at a density of 1 x 105 and 2 x 105 cells per well, respectively, in a six-well dish. After 24 h, culture media were replaced with serum-free media. After 48 h in culture, CM were harvested, lyophilized, and resuspended in one tenth the original volume. Gelatinase activity from samples were analyzed by gelatin zymography as described previously (20, 21).

Lung cell lysate samples.
At d 10 and 21, three animals from each group receiving LV-Eb-Luc, LV-Eb-RLN1, or LV-Eb-RLN3 were killed, and lungs were harvested. Intact lungs and trachea were perfused and washed with sterile HBSS to remove blood. The lungs were divided into separate lobes for each animal (Fig. 2BGo). Lobes were individually minced with a sterile scalpel and homogenized, and cell lysate was extracted as described previously (20). Cell lysate samples (14 µg/lane) were examined for gelatinase activity by gelatin zymography as described previously (20, 21).

Densitometry.
The relative levels of MMP activity were quantified by densitometry analyses using the Quantity One software version 4.5.1 according to the Quantity One User’s Guide for Version 4 (Bio-Rad, Mississauga, Ontario, Canada). For each zymogram, the density of each band was individually calculated by subtracting the OD units per square millimeter of the local background from the OD units per square millimeter of the sample band. The calculated densities of the bands from each group were averaged and presented in graphs as relative density units. Gelatin zymographies and densitometry analyses were repeated three or four times. Bands denoting either the latent (pro-) or the active forms of both MMP-2 and MMP-9 were identified by aligning bands on the zymogram with the Kaleidoscope-prestained weight markers (Bio-Rad).

Statistical analysis
Data within each time point were analyzed using a two-tailed, independent-samples t test (Microsoft Excel). Error bars indicate the SE, and significance is indicated by an asterisk when P ≤ 0.05. Statistical analyses were performed under consultation with the Clinical Studies Resource Centre, UHN (Toronto, Canada).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning and characterization of EboZ GP-pseudotyped LVs
Mouse relaxin and mouse relaxin-3 cDNAs were successfully cloned from mouse ovary and brain tissue, respectively. Each cDNA was cloned into a LV backbone vector for constitutive expression driven by the EF1{alpha} promoter. Figure 1CGo shows a schematic linear map of the LVs used. Electron microscopy of the LV virions was performed as a measure to confirm packaging and structural integrity of the LV virions (Fig. 1Go, D and E). Detection by Western blotting of recombinant mouse relaxin and relaxin-3 protein expression present in CM from LV-infected 293T cell cultures was attempted (20, 33) using rabbit antiporcine antisera from Drs. O. D. Sherwood (University of Urbana-Champaign, Urbana, IL) and Bernie Steinetz (R6 antiserum; Nelson Institute of Environmental Medicine, New York University School of Medicine, New York, NY) and by a specific human H2 ELISA (20, 32, 33). None of these methods resulted in productive immunodetection of mouse relaxins (data not shown).

LV vectors pseudotyped with EboZ GP tend to be produced at lower titers and exhibit differential infectivity patterns depending on species and tissue types examined compared with VSVg-pseudotyped LVs (15, 34). BLI of luciferase expressed from 293T-infected cells with limiting dilutions of concentrated LV suspension illustrated the differences in titers and infection rates between concentrated LV-VSV-Luc and LV-Eb-Luc (Fig. 3AGo) preparations. Using 293T cells as the recipient cell type for indirect titering, LV-Eb-Luc titers appear to be approximately 2 logs lower in functional titers than LV-VSV-Luc functional titers (Figs. 3BGo).


Figure 3
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 3. A, Luciferase BLI of 293T cell cultures 3 d after LV transduction, illustrating differences in functional titers of LV-Luc when LVs are pseudotyped with either VSVg or EboZ GP. 293T cell monolayers were incubated with different dilutions of concentrated LV suspensions ranging from 100 to 10–2. B, Relative luciferase activity from 293T cell cultures transduced with different dilutions of concentrated LV suspensions.

 
To confirm that EboZ GP-pseudotyped LVs can infect primary C57BL/6 and NOD/SCID lung cells, cell cultures infected with LV-Eb-Luc were examined by ICF for luciferase expression. Transduced cell culture samples were positive for luciferase expression as shown by donkey antigoat IgG-Alexa 488 (Molecular Probes, Eugene, OR) staining (Fig. 4Go).


Figure 4
View larger version (8K):
[in this window]
[in a new window]
 
FIG. 4. Immunohistofluorescence of cultured primary lung cells isolated from NOD/SCID and C57BL/6 mice transduced with LV-Eb-Luc (MOI {cong} 1).

 
RT-PCR for relaxin receptors
Mouse relaxin is recognized by the LGR7 receptor, and mouse relaxin-3 has been shown to be recognized by the LGR7, GPCR135, and GPCR142 receptors (2, 26, 35). To investigate the presence of relaxin receptors in primary lung tissues for relaxin, RT-PCR was performed for detection of relaxin receptor mRNA transcripts. Transcripts from the LGR7 (Fig. 5AGo), GPCR135, and GPCR142 (Fig. 5BGo) receptor genes were detected in lungs of C57BL/6 and NOD/SCID mice. Although GPCR142 but not GPCR135 transcript was detected in the mouse lung in a previous study (26), we detected distinct bands for both GPCR135 (385 bp) and GPCR142 (440 bp) in the C57BL/6 and NOD/SCID mice strains. As a positive control, a cDNA library of the NOD/SCID mouse brain subjected to RT-PCR was also confirmed to express transcripts for all three of these relaxin receptors (Fig. 5CGo).


Figure 5
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 5. RT-PCR for relaxin receptor mRNA expression. A and B, LGR7 (311 bp) (A) and GPCR135 (385 bp) and GPCR142 (440 bp) (B) relaxin receptor mRNA transcripts from C57BL/6 and NOD/SCID mouse lung tissue. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts (300 bp) were amplified to confirm RNA fidelity. C, LGR7, GPCR135, and GPCR142 relaxin receptor mRNA expression (also known as RXFP1, -3, and -4, respectively) (25 ) is detected in the mouse brain as a positive control. Ladder, 50-bp ladder (New England Biolabs). Samples containing no reverse transcriptase or water in substitution for cDNA template showed no amplification.

 
Measuring bioactivity of LV-engineered mouse relaxin and mouse relaxin-3
To determine that primary lung cells can be effectively transduced by LV-Eb-RLN1 and LV-Eb-RLN3 and secrete biologically active mouse relaxin and relaxin-3 peptides, two in vitro bioassays were employed. In the first assay, two cell lines were used as target cells for measuring relaxin-stimulated cAMP. The human monocytic cell line, THP-1, known to be highly responsive to relaxins as evidenced by increased expression of cAMP in a dose-dependent manner (32, 33) were indeed confirmed to respond to increasing doses of rhH2 (Fig. 6AGo). However, the human embryonic kidney cell line, 293T, did not exhibit significant sensitivity to similar doses of rhH2 (Fig. 6BGo). The difference in responsiveness to rhH2 between the two lines probably lies in the number of relaxin receptors present on the cell surface. THP-1 cells, but not 293T cells, express mRNA transcript for LGR7 as detected by RT-PCR (Fig. 6CGo). GPCR135 and GPCR142 receptor transcripts were not detected by RT-PCR in either the THP-1 or 293T cell line (data not shown). Therefore, to demonstrate that LV-engineered mouse relaxin and relaxin-3 exhibit specific binding affinity for LGR7, a 293T clonal cell line stably expressing human LGR7 termed 293T-LGR7#3 was generated. This clone was selected for the greatest sensitivity to rhH2 incubation as determined by measuring subsequent changes in cAMP levels (data not shown). RT-PCR of three 293T-LGR7 clones for LGR7 expression of receptor mRNA transcript is shown in Fig. 6DGo. In a previous study, 293T cells expressing human LGR7 were able to bind and elicit a cAMP response after stimulation with mouse prorelaxin-3 (35). In our study, 293T-LGR7 cells exhibited a magnitude greater level of sensitivity compared with THP-1 cells. Although THP-1 cells are able to show a dose-dependent response to rhH2 in nanogram quantities (Fig. 6AGo), the 293T-LGR7 cells exhibited a dose-dependent response to rhH2 in picogram quantities (Fig. 6EGo). In fact, when these cells were stimulated with a similar rhH2 dose curve as performed for the THP-1 cells, cAMP levels were too high to provide any accurate measurement (data not shown). This greater level of sensitivity is likely because 293T-LGR7 present greater levels of LGR7 receptor because of its constitutive expression driven by a CMV promoter (31) compared with basal levels (approximately 275 receptors per cell) on THP-1 cells (32).


Figure 6
View larger version (38K):
[in this window]
[in a new window]
 
FIG. 6. Stimulation of cAMP confirms biological activity of LV-engineered mouse relaxin and mouse relaxin-3. A, THP-1 cells exhibit dose-dependent sensitivity to rhH2 by stimulation of cAMP; B, 293T cells do not exhibit significant responsiveness to rhH2 by measurement of cAMP; C, LGR7 (244 bp) relaxin receptor expression is present in THP-1 cells but not in 293T cells as determined by RT-PCR; D, LGR7 expression was detected by RT-PCR in three 293T-LGR7 clones (#2, #3, and #5) but not in nontransfected (NT) 293T cells. Although all examined clones expressed LGR7 mRNA, 293T-LGR7#3 demonstrated the greatest sensitivity to rhH2 by measurement of cAMP levels (data not shown). E, 293T-LGR7 cells exhibit dose-dependent sensitivity to picogram quantities of rhH2 by measurement of cAMP; F, levels of cAMP secretion from THP-1 cells stimulated by recombinant mouse relaxin or mouse relaxin-3 present in CM harvested from LV-transduced 293T cultures measured by a cAMP ELISA; G, levels of cAMP secretion from 293T-LGR7 cells stimulated by unconcentrated and diluted (1:50) CM harvested from LV-transduced 293T cultures containing recombinant mouse relaxin or mouse relaxin-3 measured by a cAMP ELISA. *, P < 0.05;**, P < 0.01 compared with relative values from eGFP control samples.

 
Concentrated CM containing recombinant LV-engineered mouse relaxin or relaxin-3 hormone consistently elicited significantly more cAMP from THP-1 cells (646 ± 85 fmol/well, P < 0.03, and 958 ± 14 fmol/well, P < 0.0001, respectively) compared with cells stimulated with CM from 293T-eGFP control samples (356 ± 18 fmol/well; Fig. 6FGo). In this experiment, mouse relaxin-3 exhibited more biological activity in the THP-1 cAMP assay compared with mouse relaxin (P = 0.02). 293T-LGR7 cells provided a significantly greater level of sensitivity to the mouse relaxins than THP-1 cells. Unconcentrated CM containing recombinant LV-engineered mouse relaxin or relaxin-3 hormone diluted 1:50 consistently elicited significantly more cAMP from 293T-LGR7 cells (1006 ± 76 fmol/well, P < 0.02, and 1108 ± 98 fmol/well, P < 0.02, respectively) compared with cells stimulated with CM from 293T-eGFP control samples (611 ± 4 fmol/well; Fig. 6GGo).

H2 relaxin and mouse prorelaxin-3 have been shown to regulate MMPs in a number of cell types (4, 35, 36). Therefore, in a second assay, we tested the indirect biological activities of LV-engineered mouse relaxin and mouse relaxin-3 by gelatin zymography. Gelatinase activity (MMP-2 and MMP-9) was measured in CM from LV-transduced C57BL/6 primary lung cell cultures (Fig. 7AGo). Significantly greater levels of MMP-2 activity were exhibited in concentrated CM harvested from cells infected with LV-Eb-RLN1 (2.7-fold; P = 0.003) and LV-Eb-RLN3 (3.6-fold; P < 0.001) compared with LV-Eb-eGFP samples. Although not significant (P = 0.1) as determined by densitometry, CM from treated LV-Eb-RLN3 samples exhibited a trend in containing greater levels of MMP-2 activity compared with CM from treated LV-Eb-M1 samples. No evidence of MMP-9 activity could be observed in the control or treated primary lung cell cultures. As a negative control, CM harvested from 293T cell cultures infected with LV-Eb-RLN1 or LV-Eb-RLN3 did not contain significantly greater levels of MMP-2 activity compared with LV-Eb-eGFP control samples (Fig. 7BGo). The lack of differences is likely because 293T cells do not express LGR7 (Fig. 6Go, B and C) or GPCR135 and GPCR142 relaxin receptor transcripts (data not shown).


Figure 7
View larger version (30K):
[in this window]
[in a new window]
 
FIG. 7. Stimulation of MMP-2 activity confirms biological activity of LV-engineered mouse relaxin and mouse relaxin-3. Gelatin zymography was employed to measure the effects of mouse relaxins on gelatinase expression from C57BL/6 primary lung cell cultures. A and B, Representative gelatin zymograms revealing the presence of MMP-2 but not MMP-9 activity from C57BL/6 primary lung (A) and 293T cell (B) cultures infected with LV-Eb-eGFP, LV-Eb-RLN1, or LV-Eb-RLN3. Densitometry was used to quantify band intensity as an indicator of relative MMP-2 activity. Gelatin zymographies and densitometry analyses were repeated three or four times. *, P < 0.05.

 
EboZ GP-pseudotyped LV but not VSVg-pseudotyped LV infects mouse lungs
To investigate the tropism of LVs pseudotyped with either EboZ GP or VSVg, concentrated virus suspensions of LV-Eb-Luc or LV-VSV-Luc were delivered to C57BL/6 mice by ETI. Using BLI at d 4 and 10, luciferase expression could be detected only in lungs infected with LV-Eb-Luc and not in lungs receiving LV-VSV-Luc or saline (Fig. 8Go). Despite LV-VSV-Luc functional titers being an estimated approximately 2 logs greater than LV-Eb-Luc functional titers (titered on 293T cell monolayers; Fig. 3Go), vectors pseudotyped with VSVg were not observed to infect C57BL/6 mouse lungs.


Figure 8
View larger version (20K):
[in this window]
[in a new window]
 
FIG. 8. BLI of LV-infected lungs. Saline, VSVg-, or EboZ GP-pseudotyped LVs expressing luciferase were delivered by ETI to C57BL/6 mice. At d 4 and 10, mice were injected ip with D-luciferin, and lungs were removed, washed, and imaged by BLI.

 
LV-engineered mouse relaxin and mouse relaxin-3 induce MMP activity in vivo
We wished to test the potency and efficacy of LV-engineered mouse relaxin and relaxin-3 hormones to regulate MMP enzyme activity in the C57BL/6 mouse lung. Cell lysates collected from lung lobes from each mouse were tested by gelatin zymography for MMP activity (Fig. 9Go). LV infection within the lung was hypothesized to be variably distributed among the six lobes. Therefore, measurements were made from each lobe individually, as a strategy to avoid the possibility of diluting relaxin-induced differences by examination of entire lung tissue lysates (Fig. 2BGo).


Figure 9
View larger version (56K):
[in this window]
[in a new window]
 
FIG. 9. Gelatin zymography was employed to measure the effects of mouse relaxins on gelatinase activity from LV-infected C57BL/6 mouse lungs in vivo. Shown are representative gelatin zymograms, revealing the presence of gelatinase (MMP-2 and MMP-9) activity in lung cell lysates (14 µg/lane) for lung lobes harvested at d 10 (A) and 21 (B). Densitometry (after each set of zymograms in the figure) was used to quantify band intensity as an indicator of relative MMP activity. Gelatin zymographies and densitometry analyses were repeated three or four times. *, P < 0.05; **, P < 0.01; ***, P < 0.001 compared with relative values from Luc control samples, unless otherwise noted where comparisons are made between treated groups.

 
At d 10, differences in MMP-2 and MMP-9 activities were detected only in the right cranial and caudal lobes (Fig. 9AGo). Densitometry analyses of zymograms for the right cranial lobe confirmed that MMP-2 (but not MMP-9) activity was greater on average in LV-Eb-RLN1/RLN3-treated samples compared LV-Eb-Luc-treated controls (P < 0.05; Fig. 9AGo). Densitometry analyses of zymograms for the right caudal lobe confirmed that MMP-9 activity was greater on average in LV-Eb-RLN1-treated (P < 0.05) and LV-Eb-RLN3-treated (P < 0.001) samples compared with LV-Luc-treated controls (Fig. 8AGo). MMP-9 activity in LV-Eb-M3 right caudal lobe samples was greater than enzyme levels in LV-Eb-RLN1-treated samples (P < 0.01).

At d 21, marked differences in MMP-2 activity, but not MMP-9 activity (data not shown), could be observed in the relaxin-treated animals compared with controls. Densitometry analyses of zymograms for cell lysates of the right middle lung lobe exhibited more pronounced MMP-2 activity in relaxin-treated animals compared with control animals (P < 0.05; Fig. 9BGo). Furthermore, densitometry analyses of zymograms for cell lysates of the right caudal lung lobe exhibited more pronounced MMP-2 activity in LV-Eb-RLN3-treated animals compared with LV-Eb-RLN1-treated and control animals (P < 0.03; Fig. 9BGo).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report for the first time the expression and characterization of the biological activities of recombinant mouse relaxin and mouse relaxin-3 peptides. Both hormones exhibited bioactivity in vitro by 1) stimulating two cell types expressing LGR7 to secrete cAMP and 2) inducing up-regulation of MMP-2 expression in primary C57BL/6 mouse lung cell cultures. In contrast to surgical and other invasive viral delivery strategies, we present an alternative lung delivery approach for LVs by ETI. Recombinant EboZ GP-pseudotyped LVs engineering the expression of mouse relaxin or mouse relaxin-3 resulted in sustained bioactivity after delivery for the duration of our 21-d study period.

The gelatinase enzymes are well characterized mediators in the pathophysiological manifestation of pulmonary fibrosis. MMP-2 (gelatinase A; 72-kDa type N collagenase) and MMP-9 (gelatinase B; 92-kDa type IV collagenase) most specifically cleave gelatin and type N collagen, important constituents of the basement membrane, a specialized form of ECM underlying the epithelium and endothelium of parenchymal tissue (37). The relaxin polypeptide hormone modulates gelatinolytic MMP enzymes, and it has been demonstrated to have both physiological and therapeutic significance as an antifibrotic agent in animal models (4, 36). In mouse models, relaxin was proposed to ameliorate cardiac and renal fibroses by modulating ECM proteins via the up-regulation of MMP-2 and MMP-9 enzymes (38, 39). The ability of H2 relaxin to up-regulate gelatinases in other rodent systems in vivo has also been reported, including rat small renal arteries (40, 41) and prostate tumor xenografts (20). More recently, recombinant H3 relaxin in combination with both the presence and absence of TGF-ß was shown to up-regulate MMP-2 expression and activity from neonatal rat ventricular fibroblasts that express LGR7 (35).

In the current study, we show for the first time that recombinant murine relaxins can induce enhanced MMP-2 and MMP-9 activity from both primary lung cell cultures and in the lungs of vector-transduced C57BL/6 mice. Overall, it is possible that LV-engineered mouse relaxin-3 elicited greater biological activity than mouse relaxin. This observation is based on the results obtained in the stimulation of cAMP from THP-1 cells (Fig. 6FGo), a trend in the up-regulation of MMP-2 from C57BL/6 primary lung cell cultures (Fig. 7AGo), and in the promotion of gelatinase activity in the mouse lung (Fig. 9Go). Considering that similar LV titers were used in all experiments, it is possible that mouse relaxin-3 is more biologically active than mouse relaxin in the C57BL/6 mouse lung. However, we cannot discount the possibility of this difference being a result of the variations in expressed mRNA levels, protein stability, posttranslational effects, receptor-binding affinities, and/or signaling patterns. The disparity in bioactivities between the two mouse relaxin peptides can be also be attributed to the expressional patterns of relaxin receptor mRNA in the mouse lung. It appears that in both the mouse lung and brain, GPCR135 and GPCR142 receptors are present at greater levels compared with LGR7. Although relaxin-3 has been shown to bind to LGR7, GPCR135, and GPCR142 (26, 28, 29, 42), no evidence is present in the literature to suggest that relaxin (or relaxin-1) can bind to any receptor other than LGR7. Therefore, the bioactivity of mouse relaxin-3 may be a result of greater receptor-binding opportunities and subsequent downstream effects because it has up to three receptors through which it can signal compared with just LGR7 for mouse relaxin.

In contrast to previous studies that employed experimentation with a xenogenic relaxin form (i.e. rhH2 in the rodent) (7, 8, 9), here we used species-specific relaxins. Possible immunogenic responses to human relaxin in the lung may result in an indirect increase in MMP activity leading to false-positive observations. Often, xenogenic reporter genes (i.e. eGFP, LacZ, etc.) are included in viral vectors in a bicistronic format to assist with monitoring transgene expression. However, in the current study, to reduce the chance of eliciting potential confounding immunogenic responses in vivo (43), no reporter genes were included in the LV-Eb-RLN1 and LV-Eb-RLN3 constructs. We did use, in separate experiments, eGFP and luciferase marker genes for proof-of-principle vector tracking to demonstrate infectivity using EboZ GP-pseudotyped LVs.

The murine trachea extends to the apex where the left and right bronchi branch leading to the lungs (Fig. 2BGo). The lungs are divided into lobes with two lobes on the left (termed cranial and caudal) and four on the right (termed cranial, middle, caudal, and accessory) (44, 45). Gelatin zymographic analyses showed that LV-engineered mouse relaxin and mouse relaxin-3 had sustained biological effects up until the end of the study period at d 21, as indicated by increased MMP-2 activity (Fig. 9Go). It is interesting to note that although MMP-9 activity was not detected from C57BL/6 primary lung cell cultures by zymographic analyses, its activity was detected and up-regulated in vivo by LV-engineered mouse relaxin and relaxin-3 on d 10. This observation was likely made because of the in vivo stimuli affecting transcriptional and/or MMP enzyme regulation that is not present in in vitro systems. Only two lobes at each time point were observed to present greater levels of gelatinase activity compared with controls. It is possible that LV biodistribution and tissue transduction was greater in some lobes and not others.

A notable outcome of this study is the observation that no differences in any gelatinase activity were observed in the left lobes between relaxin-treated and control animals. This finding is attributed to the method of LV tracheal delivery. All anesthetized, tracheally cannulated animals were rested on their right side when the LVs were delivered by ETI, likely resulting in biased right lung delivery because of gravitational forces. Although we have shown that vector delivery by ETI can be targeted to the right lung lobes (Fig. 9Go), future studies encompassing ETI deliveries will need to take into account the animal position at times before and after delivery. Importantly, the method of ETI may be preferable for some studies because it negates the need for surgical incision as some groups have performed for intratracheal deliveries (15, 16, 46) and also avoids the risks of losing viral vector in nasal passages when administering vectors intranasally (47).

Pseudotyping LVs with the envelope of EboZ GP results in efficient transduction of airway epithelium, large airways, and submucosal glands without eliciting an immune response (15, 16). Kobinger and colleagues (15) originally reported that EboZ GP-pseudotyped LVs but not VSVg-pseudotyped LVs after intratracheal delivery resulted in efficient transduction of airway epithelia in C57BL/6 mice after 28 d but not as early as 7 d (15). Similarly, in the current study, EboZ GP-pseudotyped LVs, but not VSVg-pseudotyped LVs, resulted in transduction of C57BL/6 mouse lungs (Fig. 8Go). Indeed, we were able to observe luciferase expression in lungs after delivery of LV-Eb-Luc by ETI as early as d 4. Tarantal and colleagues (48) observed eGFP transgene expression in airway surface epithelium in newborn rhesus monkeys after direct injection of VSVg-pseudotyped LVs into the fetal lung. Therefore, although we and other groups (15) did not observe VSVg-pseudotyped LV transduction in the murine lung, a notion is supported that transgene product, transgene detection, method of LV delivery, LV titer, and LV pseudotyping may offer differential infectivity and expression patterns depending on the recipient species and tissue type (34).

The role of human relaxin as a collagen-modulating agent has been tested in several pulmonary fibrosis systems (8, 9, 49). Moreover, collagen degradation and prevention of collagen deposition have been observed after relaxin therapy in studies employing animal models of airway inflammatory and asthmatic states (49, 50, 51). This study provides proof-of-principle indication that relaxin gene expression targeted to the mouse lungs can result in enhanced MMP activity, offering potential for alleviating disease conditions characterized by collagen and other ECM protein buildup. Additionally, indirect evidence has been presented for the first time that relaxin gene therapy applications can be extended to other biological systems for which relaxin is implicated, such as the nervous and cardiovascular systems.


    Acknowledgments
 
We thank Dr. Fayez Dawood (Toronto General Hospital Research Institute and Ontario Cancer Institute, University Health Network) for providing technical information regarding the endotracheal intubation, Vanessa Rasaiah for assisting in the mouse lung processing and offering a critical examination of the manuscript, and Steven Doyle (Microscopy Imaging Laboratory, University of Toronto) for assisting with the preparation and imaging of the virus samples for electron microscopy.


    Footnotes
 
This work was supported by the Natural Sciences and Engineering Research Council.

J.D.S., J.S.W., A.J.S.S., and J.A.M. have nothing to declare.

First Published Online May 18, 2006

Abbreviations: BLI, Bioluminescent imaging; CM, conditioned medium; CMV, cytomegalovirus; EboZ GP, Zaire strain of the Ebola virus glycoprotein; ECM, extracellular matrix; EF1{alpha}, elongation factor 1{alpha}; ETI, endotracheal intubation; FBS, fetal bovine serum; HBSS, Hanks’ buffered salt solution, without Ca2+ and Mg2+; ICF, immunocytofluorescence; LV, lentiviral vector; MMP, matrix metalloproteinase; MOI, multiplicity of infection; rhH2, recombinant human H2 relaxin; pPGK, polyglutamine kinase promoter; UHN, University Health Network; VSVg, vesicular stomatitis virus glycoprotein.

Received January 9, 2006.

Accepted for publication May 8, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bathgate RA, Samuel CS, Burazin TC, Layfield S, Claasz AA, Reytomas IG, Dawson NF, Zhao C, Bond C, Summers RJ, Parry LJ, Wade JD, Tregear GW 2002 Human relaxin gene 3 (H3) and the equivalent mouse relaxin (M3) gene. Novel members of the relaxin peptide family. J Biol Chem 277:1148–1157[Abstract/Free Full Text]
  2. Sherwood OD 2004 Relaxin’s physiological roles and other diverse actions. Endocr Rev 25:205–234[Abstract/Free Full Text]
  3. Burazin TC, Bathgate RA, Macris M, Layfield S, Gundlach AL, Tregear GW 2002 Restricted, but abundant, expression of the novel rat gene-3 (R3) relaxin in the dorsal tegmental region of brain. J Neurochem 82:1553–1557[CrossRef][Medline]
  4. Samuel CS 2005 Relaxin: antifibrotic properties and effects in models of disease. Clin Med Res 3:241–249[Abstract/Free Full Text]
  5. Zhao L, Roche PJ, Gunnersen JM, Hammond VE, Tregear GW, Wintour EM, Beck F 1999 Mice without a functional relaxin gene are unable to deliver milk to their pups. Endocrinology 140:445–453[Abstract/Free Full Text]
  6. Kamat AA, Feng S, Bogatcheva NV, Truong A, Bishop CE, Agoulnik AI 2004 Genetic targeting of relaxin and insulin-like factor 3 receptors in mice. Endocrinology 145:4712–4720[Abstract/Free Full Text]
  7. Samuel CS, Zhao C, Bathgate RA, Bond CP, Burton MD, Parry LJ, Summers RJ, Tang ML, Amento EP, Tregear GW 2003 Relaxin deficiency in mice is associated with an age-related progression of pulmonary fibrosis. FASEB J 17:121–123[Abstract/Free Full Text]
  8. Unemori EN, Beck LS, Lee WP, Xu Y, Siegel M, Keller G, Liggitt HD, Bauer EA, Amento EP 1993 Human relaxin decreases collagen accumulation in vivo in two rodent models of fibrosis. J Invest Dermatol 101:280–285[CrossRef][Medline]
  9. Unemori EN, Pickford LB, Salles AL, Piercy CE, Grove BH, Erikson ME, Amento EP 1996 Relaxin induces an extracellular matrix-degrading phenotype in human lung fibroblasts in vitro and inhibits lung fibrosis in a murine model in vivo. J Clin Invest 98:2739–2745[Medline]
  10. Nakao A, Fujii M, Matsumura R, Kumano K, Saito Y, Miyazono K, Iwamoto I 1999 Transient gene transfer and expression of Smad7 prevents bleomycin-induced lung fibrosis in mice. J Clin Invest 104:5–11[Medline]
  11. Shimizukawa M, Ebina M, Narumi K, Kikuchi T, Munakata H, Nukiwa T 2003 Intratracheal gene transfer of decorin reduces subpleural fibroproliferation induced by bleomycin. Am J Physiol Lung Cell Mol Physiol 284:L526–L532
  12. Russell WC 2000 Update on adenovirus and its vectors. J Gen Virol 81:2573–2604[Free Full Text]
  13. Sanders DA 2004 Ebola virus glycoproteins: guidance devices for targeting gene therapy vectors. Expert Opin Biol Ther 4:329–336[CrossRef][Medline]
  14. Feldmann H, Volchkov VE, Volchkova VA, Klenk HD 1999The glycoproteins of Marburg and Ebola virus and their potential roles in pathogenesis. Arch Virol Suppl 15:159–169
  15. Kobinger GP, Weiner DJ, Yu QC, Wilson JM 2001 Filovirus-pseudotyped lentiviral vector can efficiently and stably transduce airway epithelia in vivo. Nat Biotechnol 19:225–230[CrossRef][Medline]
  16. Medina MF, Kobinger GP, Rux J, Gasmi M, Looney DJ, Bates P, Wilson JM 2003 Lentiviral vectors pseudotyped with minimal filovirus envelopes increased gene transfer in murine lung. Mol Ther 8:777–789[CrossRef][Medline]
  17. Sinn PL, Hickey MA, Staber PD, Dylla DE, Jeffers SA, Davidson BL, Sanders DA, McCray Jr PB 2003 Lentivirus vectors pseudotyped with filoviral envelope glycoproteins transduce airway epithelia from the apical surface independently of folate receptor alpha. J Virol 77:5902–5910[Abstract/Free Full Text]
  18. Caniggia I, Tseu I, Han RN, Smith BT, Tanswell K, Post M 1991 Spatial and temporal differences in fibroblast behavior in fetal rat lung. Am J Physiol 261:L424–L433
  19. Yoshimitsu M, Sato T, Tao K, Walia JS, Rasaiah VI, Sleep GT, Murray GJ, Poeppl AG, Underwood J, West L, Brady RO, Medin JA 2004 Bioluminescent imaging of a marking transgene and correction of Fabry mice by neonatal injection of recombinant lentiviral vectors. Proc Natl Acad Sci USA 101:16909–16914[Abstract/Free Full Text]
  20. Silvertown JD, Ng J, Sato T, Summerlee AJ, Medin JA 2006 H2 relaxin overexpression increases in vivo prostate xenograft tumor growth and angiogenesis. Int J Cancer 118:62–73[CrossRef][Medline]
  21. Silvertown JD, Walia JS, Medin JA 2005 Cloning, sequencing and characterization of lentiviral-mediated expression of rhesus macaque (Macaca mulatta) interleukin-2 receptor {alpha} cDNA. Dev Comp Immunol 29:989–1002[CrossRef][Medline]
  22. Dull T, Zufferey R, Kelly M, Mandel RJ, Nguyen M, Trono D, Naldini L 1998 A third-generation lentivirus vector with a conditional packaging system. J Virol 72:8463–8471[Abstract/Free Full Text]
  23. Doane FW, Anderson N 1987 Electron microscopy. In: Diagnostic virology. Cambridge, UK: Cambridge University Press; 15
  24. Hayat MA, Miller SE 1990 Negative staining. New York: McGraw-Hill; 218
  25. Bathgate RA, Ivell R, Sanborn BM, Sherwood OD, Summers RJ 2006 International Union of Pharmacology LVII: recommendations for the nomenclature of receptors for relaxin family peptides. Pharmacol Rev 58:7–31[Abstract/Free Full Text]
  26. Chen J, Kuei C, Sutton SW, Bonaventure P, Nepomuceno D, Eriste E, Sillard R, Lovenberg TW, Liu C 2005 Pharmacological characterization of relaxin-3/INSL7 receptors GPCR135 and GPCR142 from different mammalian species. J Pharmacol Exp Ther 312:83–95[Abstract/Free Full Text]
  27. Li Q, Wang H, Zhao Y, Lin H, Sang QA, Zhu C 2002 Identification and specific expression of matrix metalloproteinase-26 in rhesus monkey endometrium during early pregnancy. Mol Hum Reprod 8:934–940[Abstract/Free Full Text]
  28. Liu C, Eriste E, Sutton S, Chen J, Roland B, Kuei C, Farmer N, Jornvall H, Sillard R, Lovenberg TW 2003 Identification of relaxin-3/INSL7 as an endogenous ligand for the orphan G-protein-coupled receptor GPCR135. J Biol Chem 278:50754–50764[Abstract/Free Full Text]
  29. Liu C, Chen J, Sutton S, Roland B, Kuei C, Farmer N, Sillard R, Lovenberg TW 2003 Identification of relaxin-3/INSL7 as a ligand for GPCR142. J Biol Chem 278:50765–50770[Abstract/Free Full Text]
  30. Ploszaj T, Motyl T, Orzechowski A, Zimowska W, Wareski P, Skierski J, Zwierzchowski L 1998 Antiapoptotic action of prolactin is associated with up-regulation of Bcl-2 and down-regulation of Bax in HC11 mouse mammary epithelial cells. Apoptosis 3:295–304[CrossRef][Medline]
  31. Hsu SY, Nakabayashi K, Nishi S, Kumagai J, Kudo M, Sherwood OD, Hsueh AJ 2002 Activation of orphan receptors by the hormone relaxin. Science 295:671–674[Abstract/Free Full Text]
  32. Parsell DA, Mak JY, Amento EP, Unemori EN 1996 Relaxin binds to and elicits a response from cells of the human monocytic cell line, THP-1. J Biol Chem 271:27936–27941[Abstract/Free Full Text]
  33. Silvertown JD, Geddes BJ, Summerlee AJ 2003 Adenovirus-mediated expression of human prorelaxin promotes the invasive potential of canine mammary cancer cells. Endocrinology 144:3683–3691[Abstract/Free Full Text]
  34. Wool-Lewis RJ, Bates P 1998 Characterization of Ebola virus entry by using pseudotyped viruses: identification of receptor-deficient cell lines. J Virol 72:3155–3160[Abstract/Free Full Text]
  35. Bathgate RA, Lin F, Hanson NF, Otvos Jr L, Guidolin A, Giannakis C, Bastiras S, Layfield SL, Ferraro T, Ma S, Zhao C, Gundlach AL, Samuel CS, Tregear GW, Wade JD 2006 Relaxin-3: improved synthesis strategy and demonstration of its high-affinity interaction with the relaxin receptor LGR7 both in vitro and in vivo. Biochemistry 45:1043–1053[CrossRef][Medline]
  36. McGuane JT, Parry LJ 2005 Relaxin and the extracellular matrix: molecular mechanisms of action and implications for cardiovascular disease. Expert Rev Mol Med 7:1–18[Medline]
  37. Corbel M, Belleguic C, Boichot E, Lagente V 2002 Involvement of gelatinases (MMP-2 and MMP-9) in the development of airway inflammation and pulmonary fibrosis. Cell Biol Toxicol 18:51–61[CrossRef][Medline]
  38. Heeg MH, Koziolek MJ, Vasko R, Schaefer L, Sharma K, Muller GA, Strutz F 2005 The antifibrotic effects of relaxin in human renal fibroblasts are mediated in part by inhibition of the Smad2 pathway. Kidney Int 68:96–109[CrossRef][Medline]
  39. Lekgabe ED, Kiriazis H, Zhao C, Xu Q, Moore XL, Su Y, Bathgate RA, Du XJ, Samuel CS 2005 Relaxin reverses cardiac and renal fibrosis in spontaneously hypertensive rats. Hypertension 46:412–418[Abstract/Free Full Text]
  40. Jeyabalan A, Novak J, Danielson LA, Kerchner LJ, Opett SL, Conrad KP 2003 Essential role for vascular gelatinase activity in relaxin-induced renal vasodilation, hyperfiltration, and reduced myogenic reactivity of small arteries. Circ Res 93:1249–1257[Abstract/Free Full Text]
  41. Jeyabalan A, Kerchner LJ, Fisher MC, McGuane JT, Doty KD, Conrad KP 2006 Matrix metalloproteinase-2 activity, protein, mRNA and tissue inhibitors in small arteries from pregnant and relaxin-treated nonpregnant rats. J Appl Physiol 100:1955–1963[Abstract/Free Full Text]
  42. Liu C, Kuei C, Sutton S, Chen J, Bonaventure P, Wu J, Nepomuceno D, Kamme F, Tran DT, Zhu J, Wilkinson T, Bathgate R, Eriste E, Sillard R, Lovenberg TW 2004 INSL5 is a high affinity specific agonist for GPCR142 (GPR100). J Biol Chem 280:292–300
  43. Stripecke R, Carmen Villacres M, Skelton D, Satake N, Halene S, Kohn D 1999 Immune response to green fluorescent protein: implications for gene therapy. Gene Ther 6:1305–1312[CrossRef][Medline]
  44. Popesko P, Rajtová V, Horák J 1990 A colour atlas of anatomy of small laboratory animals. Vol. 2. Rat, mouse, hamster. London: Wolfe
  45. Cook MJ 1965 The anatomy of the laboratory mouse. New York: Academic Press; 63
  46. Griesenbach U, Chonn A, Cassady R, Hannam V, Ackerley C, Post M, Tanswell AK, Olek K, O’Brodovich H, Tsui LC 1998 Comparison between intratracheal and intravenous administration of liposome-DNA complexes for cystic fibrosis lung gene therapy. Gene Ther 5:181–188[CrossRef][Medline]
  47. Bonniaud P, Kolb M, Galt T, Robertson J, Robbins C, Stampfli M, Lavery C, Margetts PJ, Roberts AB, Gauldie J 2004 Smad3 null mice develop airspace enlargement and are resistant to TGF-ß-mediated pulmonary fibrosis. J Immunol 173:2099–2108[Abstract/Free Full Text]
  48. Tarantal AF, Lee CI, Ekert JE, McDonald R, Kohn DB, Plopper CG, Case SS, Bunnell BA 2001 Lentiviral vector gene transfer into fetal rhesus monkeys (Macaca mulatta): lung-targeting approaches. Mol Ther 4:614–621[CrossRef][Medline]
  49. Kenyon NJ, Ward RW, Last JA 2003 Airway fibrosis in a mouse model of airway inflammation. Toxicol Appl Pharmacol 186:90–100[CrossRef][Medline]
  50. Mookerjee I, Solly NR, Royce SG, Tregear GW, Samuel CS, Tang ML 2006 Endogenous relaxin regulates collagen deposition in an animal model of allergic airways disease. Endocrinology 147:754–761[Abstract/Free Full Text]
  51. Bani D, Ballati L, Masini E, Bigazzi M, Sacchi TB 1997 Relaxin counteracts asthma-like reaction induced by inhaled antigen in sensitized guinea pigs. Endocrinology 138:1909–1915[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
B. B. Moore and C. M. Hogaboam
Murine models of pulmonary fibrosis
Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L152 - L160.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
J. D. Silvertown, J. C. Symes, A. Neschadim, T. Nonaka, J. C. H. Kao, A. J. S. Summerlee, and J. A. Medin
Analog of H2 relaxin exhibits antagonistic properties and impairs prostate tumor growth
FASEB J, March 1, 2007; 21(3): 754 - 765.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/8/3797    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted