| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Molecular and Cellular Biology (L.L., S.Z., A.V.L., J.X.) and Department of Medicine and Breast Cancer Center (R.K.D., O.L.B., A.V.L.), Baylor College of Medicine and Methodist Hospital, Houston, Texas 77030
Address all correspondence and requests for reprints to: Jianming Xu, Ph.D., Department of Molecular and Cellular Biology, Baylor College of Medicine, One Baylor Plaza, Houston, Texas 77030. E-mail: jxu{at}bcm.tmc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-subunit of the IGF-I receptor (IGF-IR) complex and activating the intracellular tyrosine kinase domain of the ß-subunit of IGF-IR, which triggers the transphosphorylation of IGF-IRß subunits and activates its downstream signaling pathways (1, 2). Because both IGF-I and IGF-IR are widely expressed in different tissues, IGF-I may act on its target cells through endocrine, paracrine, and/or autocrine mechanisms. Therefore, it has been difficult to define the contribution of circulating IGF-I to somatic growth in response to GH stimulation. In the circulation, most IGF-I associates with IGF-binding protein 3 (IGFBP-3) and acid-labile subunit (ALS) to form a ternary complex, which remarkably extends the half-life of IGF-I and IGFBP-3 in the circulation and efficiently maintains the reservoir of IGF-I and its endocrine function (1, 2). Consistent with this, overexpression of IGFBP-3 led to an increase in plasma IGF-I in transgenic mice (5). Conversely, a reduction of IGF-I in mice caused a reduction of circulating IGFBP-3 levels without affecting its mRNA expression in the liver (6). Null mutation of the ALS gene in mice also caused a significant decrease of IGF-I and IGFBP-3 in the circulation without affecting their mRNA transcription (7). These studies indicate that ALS is required for the stability of both IGF-I and IGFBP-3, whereas IGF-I and IGFBP-3 are required for each other’s stability. These associated changes among the components of the ternary complex make it difficult to assess the specific role of systemic IGF-I in somatic growth. The liver is the principle organ that produces circulating IGF-I, IGFBP-3, and ALS (1, 2). ALS is exclusively expressed in the liver, and its expression is dependent on GH stimulation. GH also directly stimulates IGF-I mRNA expression in the liver. The transcriptional regulation of IGFBP-3 in the liver is unclear, although some studies suggest that GH may indirectly regulate IGFBP-3 expression through enhancing IGF-I production (8, 9). Earlier studies showed that IGF-I could stimulate growth of pituitary-deficient rats, suggesting that the endocrine action of IGF-I was to promote somatic growth (10, 11, 12). However, this concept was challenged by a study demonstrating that deletion of the liver IGF-I gene in mice resulted in a 75% reduction in total plasma IGF-I levels, but mice exhibited normal growth (6). This study suggested that normal body growth might be mainly mediated by autocrine/paracrine actions of IGF-I. However, two concerns of this animal model were the significantly elevated GH levels and the lack of reduction in free IGF-I levels in the circulation (6, 13). Interestingly, ALS null mice with a 65% reduction of circulating IGF-I levels but without change of GH levels exhibited a 13% growth deficit (7), suggesting that the endocrine action of IGF-I does play a role in the regulation of somatic growth. The difference between growth in liver-specific IGF-I knockout mice and ALS knockout mice may be the result of a higher turnover of IGF-I in ALS knockout mice and thus reduced bioavailability. Importantly, disruption of both the liver IGF-I and ALS genes resulted in a 30% decrease in body weight, further substantiating the role for circulating IGF-I in body growth (14). Although these loss-of-function animal models provide great insight into the understanding of the endocrine function of the liver-generated or systemic IGF-I, a gain-of-function animal model with liver-specific and GH-independent production of IGF-I may provide additional insight into understanding the role of circulating IGF-I in the regulation of the GH/IGF-I axis, somatic growth, and carcinogenesis.
In the present study, we have generated transthyretin (TTR)-IGF-I transgenic mice with TTR gene enhancer/promoter-directed liver-specific expression of a mouse IGF-I transgene. We show that these mice have a significant increase in their plasma IGF-I levels, which is accompanied by increases in body weight, body length, bone length, and lean mass, improved glucose tolerance, and partially suppressed serum GH levels. In wild-type (WT) mice, blockade of the GH receptor (GHR) by pegvisomant treatment diminished ALS mRNA in the liver and ALS protein in the blood, reduced IGF-I mRNA in the liver and IGF-I protein in the blood, and reduced IGFBP-3 protein in the blood without changing IGFBP-3 mRNA in the liver. These alterations were accompanied by severe growth deficit. Interestingly, in the IGF-I transgenic mice treated with pegvisomant, the IGFBP-3 mRNA levels in the liver and the plasma levels of IGF-I and IGFBP-3 were much higher compared with pegvisomant-treated WT mice. Pegvisomant-treated TTR-IGF-I mice also exhibited heavier body weight and longer body length than pegvisomant-treated WT mice. These results indicate that the liver-produced IGF-I can promote somatic growth under both normal physiological and GHR-dysfunctional conditions. Importantly, the liver-produced IGF-I also can stabilize IGFBP-3 and stimulate IGFBP-3 transcription under GH-deficient conditions, which may facilitate the maintenance of IGF-I concentration and endocrine function and thereby increase the resistance to GH deficiency.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). The vector backbone was removed by NotI digestion. The 6-kb transgene DNA was gel purified and microinjected into the pronuclei of fertilized eggs of C57BL/6J mice. Microinjected eggs were transferred into the uteri of pseudopregnant female mice and allowed to develop to term.
|
A comparative PCR method was used to estimate the copy number of the IGF-I transgene. Genomic DNA isolated from WT and transgenic mice were used as PCR templates. Both endogenous and transgene were amplified by the same pair of primers, 5-CCACAGGCTATGGCTCCAGC and 5'-AGTCTTGGGCATGTCAGTGTG, which produced a 190-bp amplicon. The results were normalized by coamplification of the endogenous steroid receptor coactivator-3 (SRC-3) gene by another pair of primers as described (16). The copy number of the IGF-I transgene was estimated by comparing the relative ratio of IGF-I to SRC-3 gene products in transgenic mice containing two endogenous IGF-I alleles and transgene alleles with the relative ratio of IGF-I to SRC-3 gene products in WT mice with two endogenous IGF-I alleles.
RNase protection assay (RPA)
Total RNA was extracted from WT and IGF-I transgenic mouse livers by using the Trizol reagent (Invitrogen, Hercules, CA). [32P]UTP-labeled riboprobes were transcribed by the MAXIscript T7 kit (Ambion, Austin, TX). RPA was performed with 15 µg total RNA by using the RPA III kit (Ambion). The RNase-protected bands were detected by running 6% denaturing polyacrylamide gel at 330 V and by exposing dried gel to x-ray film at –80 C.
Two riboprobes were generated to detect the endogenous IGF-I mRNA and the IGF-I mRNA transcribed from the transgene. The DNA template for the first probe was complementary to the exon 3 of the IGF-I gene, and it was amplified from reverse transcribed mouse liver cDNA by PCR using the following primers: 5'-CCACAGGCTATGGCTCCAGC and 5'-GTAATACGACTCACTATAGGGCGAATTGGGTAGTCTTGGGCATGTCAGTGTG (italic, T7; underlined, a sequence taken from the pBluescript II SK plasmid). The transcribed probe was 180 bp in length, and its protective length was 170 bp. This probe was able to equally hybridize with both endogenous and transgenic IGF-I mRNA. The second riboprobe was designed to distinguish the transgenic IGF-I mRNA from the endogenous IGF-I mRNA. The 5' portion of its sequence was complementary to IGF-I mRNA, but the 3' portion of its sequence was specific to the SV40 polyadenylation signaling sequence of the transgene. The template of this probe was amplified by PCR using primer T1 (ACAAGTAGAGGAAGTGCAG) and T2 (GTAATACGA CTCACTATAGGGCGAATTGGGTGATCCCCCGGGCTGCAGGAA). The transcribed probe was 150 bp in length. The protective lengths for endogenous and transgenic IGF-I mRNAs were 120 and 140 bp, respectively.
The DNA template of the IGFBP-3 riboprobe was amplified from reverse transcribed mouse liver cDNA by PCR using primer P149 (ACATCAGTGAGTCCAAGGAG) and P151 (GTAATACGACTCACTATAGGGCGAATTGGGTAGCGCTGGCTGTCCCTGGCG). The length of the transcribed probe was 160 bp, and its protective length was 150 bp. The DNA template of the ALS riboprobe was amplified from reverse transcribed mouse liver cDNA by PCR using primer ALS-P1 (GTGTTCCAAGGGCTGGGCAG) and ALS-P3 (GTAATACGACTCACTATAGGGCGAATTGGGTTGGAGATGCTGTTGTCCCGGA). Its transcribed length was 140 bp, and its protective length was 130 bp.
RIA
IGF-I assay was carried out as previously described (16). Briefly, total IGF-I was extracted from serum and measured by using the rat IGF-I RIA kit (Diagnostic Systems Laboratories, Webster, TX). Samples, standards, and controls were incubated with 125I-labeled IGF-I and antibodies against IGF-I according to the manufacturer’s protocol. The IGF-I and antibody complexes were precipitated, and its 125I radioactivity was counted on a 
-counter. The IGF-I concentration in serum samples was determined against the standard curve.
For GH measurement, mice were bled at 0800 h on d 1, 1500 h on d 14, and 2200 h on d 21. This schedule was designed based on the limiting mice blood volume and the fluctuation feature of GH secretion. The serum GH concentration was measured by using the Rat GH Assay Kit (Amersham Pharmacia, Piscataway, NJ), but the GH antibody in the kit was replaced by a rabbit anti-rGH antiserum (1:100,000 dilution) provided by Dr. A. F. Parlow (National Hormone and Peptide Program, Torrance, CA). The average value of three samples from a mouse was used to represent the GH level for this mouse. Insulin was measured by using the Sensitive Rat Insulin RIA Kit (Linco Research, St. Charles, MO).
Measurement of body weight, body length, bone length, lean mass, and fat mass
The mouse body weight was measured once a week by using an electronic scale. The mouse body length from the tip of nose to the bottom of the tail was measured under anesthesia at the end points of experiments with a ruler. Femur and tibia bone length was measured using a Faxiton Specimen Radiography System from DALSA Life Sciences (Tucson, AZ). Beginning at 5 wk of age, mice were x-rayed under anesthesia every 2 wk until 11 wk old, and bone length measurements (in millimeters) were acquired using the Faxitron computer ruler program. Femur length was determined by starting at the femoral head to the formation of the genual joint at the medial and lateral condyles. The tibia was measured from the cranial intercondylar area to the medial malleolus. At 13 wk of age, mice were anesthetized and body mass composition was analyzed by dual-energy x-ray absorptiometry densitometry using a PIXImus II Densitometer (Lunar Corp., Madison, WI) as previously described (17).
Muscle histology
Adult male mice (5–6 months old) were killed, and the hind-limb muscle soleus was isolated together with its connecting bones. After being fixed in 4% paraformaldehyde in PBS overnight at 4 C, the soleus muscle was washed in PBS, cut into two segments in the middle, and embedded in paraffin. Cross-sections were prepared from the thickest portion of the muscle and stained with hematoxylin and eosin for histological examination. The muscle sections were analyzed as previously described (18). The electronic images of muscle cross-sections were recorded under a 5-fold microscope objective. The area (pixels) of each muscle cross-section was measured by using NIH Image 1.62 Allas software, and the number of muscle fibers was counted by using the UTHSCSA Image Tool software. The average thickness of muscle fibers in the soleus was calculated by dividing the cross-sectional area with the total number of muscle fibers.
Glucose measurement and glucose and insulin tolerance tests
Adult WT and TTR-IGF-I male mice (5–6 months) were fasted for 6 h. Blood glucose levels were measured by collecting one drop of blood from the tail and using the One Touch Ultra Glucose Meter (LifeScan, Inc., Milpitas, CA). For the glucose tolerance test, ip injection of glucose (200 mg/ml in saline, using 2 g/kg body weight) was performed, and the mouse blood glucose levels were measured at 15, 30, 60, and 120 min after the injection. For the insulin tolerance test, ip injection of insulin (0.05 U/ml in saline, using 0.5 U/kg body weight) was performed after the basal glucose level was measured. After insulin injection, mouse glucose levels were measured at 15, 30, 60, and 120 min. After the time course was finished, mice were injected with 0.2 ml glucose solution (200 mg/ml in saline, ip injection) for recovery.
Pegvisomant treatment
Pegvisomant was a generous gift from Pfizer (Cambridge, MA). The buffered pegvisomant was resuspended in water at 20 mg/ml and stored at 4 C until use within a week. Three-week-old WT and IGF-I transgenic mice were injected with pegvisomant (ip, 250 mg/kg) or an equal volume of PBS (vehicle) at 0900 h on every other day. Mice were treated for 5 consecutive weeks. Mice were weighed every time before injection. Blood samples were collected for IGF-I and GH measurement at the second, fourth, and fifth week of pegvisomant treatment. At the end of treatment, mice were killed and the weight of their brain, pituitary, heart, liver, and kidney was measured.
Ligand blotting analysis
The level of serum IGFBP-3 was assayed by ligand blotting analysis as previously described (7, 14, 19). Briefly, 0.5 µl serum was mixed with nonreducing SDS-PAGE sample buffer, heat-denatured, and separated by running a 10% SDS-PAGE mini-gel at 100 V. Proteins were blotted to nitrocellulose membrane, and the membrane was washed with PBS and then incubated with PBS containing 3% Nonidet P40 for 30 min at 4 C. The membrane was blocked with 1% BSA (fraction V, RIA grade, catalog no. A-7888; Sigma Chemical Co., St. Louis, MO) in PBS at 4 C for 2 h and then washed for 10 min at 4 C in PBS containing 0.1% Tween 20. The membrane was subsequently incubated at 4 C overnight in 5 ml PBS containing 1% RIA-grade BSA, 0.1% Tween 20, and 5 x 105 cpm of the 125I-labeled recombinant human IGF-I (receptor grade; Diagnostic Systems Laboratories) in a sealed plastic bag. The membrane was washed two times with PBS containing 0.1% Tween 20 and three times with PBS, air dried, wrapped with plastic membrane, and exposed to x-ray film for 2–3 d at –80 C.
Western blot analysis
The ALS antibody (AF1436; R&D Systems, Minneapolis, MN) was used in Western blot analysis as described previously (20). Briefly, mouse serum was mixed with SDS-PAGE reducing sample buffer, boiled, and separated by 10% SDS-PAGE. Proteins were transferred to nitrocellulose membrane. The membrane was blocked in Tris-buffered saline (TBS) containing 5% fat-free dry milk powder for 30 min at room temperature or overnight at 4 C. Then, the membrane was incubated in TBS containing 1% BSA and the ALS antibody for 1 h at room temperature. After washing with TBS, the membrane was incubated in TBS containing 1% BSA and a secondary antibody (1:5000 dilution) conjugated with horseradish peroxidase for 1 h at room temperature. The membrane was washed in TBS, developed for 1 min in 2 ml ECL solution (Amersham), and exposed to x-ray film.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). The TTR enhancer/promoter has been shown to target transgene expression specifically to the liver (15, 21, 22). To minimize the positional effect of chromosomal integration sites on transgene expression, the IGF-I transgene was flanked with a tandem repeat of the HS4 chromosomal insulator sequence from the 5' region of the chicken ß-globin gene (23). Transgene DNA was isolated and microinjected into fertilized eggs prepared from C57BL/6 mice to produce transgenic founder mice.
TTR-IGF-I transgenic founder mice were identified by PCR analysis using DNA samples isolated from the tail tips. PCR analyses using nested primer pairs spanning two or more exon-exon junctions revealed that this transgenic line harbored the full-length IGF-I transgene (Fig. 1B, lane 4). These primers specifically detected the TTR-IGF-I transgene because PCR using these primer pairs and Taq DNA polymerase was unable to amplify the products containing large introns from the endogenous IGF-I alleles. The transgenic colony was established by crossing the male founder with C57BL/6 female mice. The established line was maintained as heterozygous TTR-IGF-I transgenic mice. Both heterozygous and homozygous TTR-IGF-I transgenic mice exhibited normal development and normal reproductive function.
Next, we estimated the transgene copy number by semiquantitative PCR analysis. When a serial dilution of genomic DNA from WT mice was used as PCR template, PCR products of the reference gene and the IGF-I gene were equally amplified because there were two alleles for both genes in WT mice (Fig. 1C, top). The reference band was detected by a pair of primers located in an exon of the SRC-3 gene (16). The IGF-I band was detected by P1 and P4 primers located in the exon 3 of the IGF-I gene (Fig. 1A), so they could detect both the endogenous IGF-I gene and the transgenic TTR-IGF-I gene. When a serial dilution of genomic DNA from the TTR-IGF-I mice was used for PCR analysis, the amount of reference product was the same as that amplified from WT mice. However, the intensity of the IGF-I band amplified from TTR-IGF-I mice with both IGF-I WT and TTR-IGF-I transgenic alleles was much stronger than that amplified from WT mice. The ratio of the IGF-I band intensity to the reference band intensity was about 5:2. Therefore, we estimated that there are approximately three copies of the TTR-IGF-I transgene in the TTR-IGF-I heterozygous mice.
Liver-specific expression of the TTR-IGF-I transgene causes an increase in IGF-I and a decrease in GH in the circulation
The expression profile of the TTR-IGF-I transgene was examined by RPA analysis of RNA samples isolated from different organs including brain, heart, liver, kidney, spleen, and skeletal muscle. A 32P-labeled riboprobe, probe 1 shown in Fig. 1A, complementary to a common region of the endogenous and transgenic IGF-I mRNA detected a strong band from the liver RNA and a weak band from RNA samples isolated from other organs of WT mice. The same probe detected a 4-fold stronger band from the liver RNA of the TTR-IGF-I transgenic mice, and the relative intensity of the protected IGF-I bands from RNA samples of other organs stayed the same as compared with WT mice (Fig. 2A). These results suggested that the TTR-IGF-I transgene is specifically expressed in the liver at a higher level than the endogenous IGF-I gene. To further analyze the expression profile and levels of the TTR-IGF-I transgene, we designed another riboprobe (probe 2 in Fig. 1A) consisting of the 3' IGF-I coding region that was common to both endogenous and transgenic IGF-I mRNAs and the 5' SV40t polyadenylation-signaling sequence that was unique for the transgenic mRNA. This riboprobe should distinguish the TTR-IGF-I transgene expression (full-length protection) from the endogenous IGF-I expression (partial region protection). Indeed, this second riboprobe not only detected the equal expression levels of the endogenous IGF-I mRNA in livers of both WT and TTR-IGF-I transgenic mice but also detected the exclusive expression of the TTR-IGF-I transgene in the liver of the TTR-IGF-I transgenic mice. The expression level of the TTR-IGF-I transgene was about 3-fold higher than the endogenous IGF-I gene (Fig. 2B). These results indicate that the TTR-IGF-I transgenic mice with liver-specific overexpression of IGF-I were successfully developed.
|
). These results indicate that the liver-specific expression of the TTR-IGF-I transgene significantly increases IGF-I levels in the circulation.
To examine whether the increased IGF-I would suppress GH secretion, we collected blood samples from adult male WT and TTR-IGF-I mice for GH analysis. Given the pulsatile fashion of GH secretion and the limited volume of the mouse blood pool, we bled each mouse once every other week at three different time points (see Materials and Methods) and measured GH levels in these individual samples. We assayed 14 WT and 15 TTR-IGF-I male adult mice and found that the average GH levels in TTR-IGF-I mice were significantly lower than in WT mice (Fig. 2D), suggesting that the elevated IGF-I from the TTR-IGF-I transgene is biologically active and plays a role in negative-feedback regulation of GH levels in the circulation.
Liver-specific expression of the TTR-IGF-I transgene increases body weight, lean mass, and bone length
To address the question as to whether the elevation of plasma IGF-I levels by the liver-specific transgene would stimulate somatic growth, the body weight of WT and TTR-IGF-I transgenic mice was measured. The measurement started at the age of 2 wk and ended at the age of 12 wk. Most measured and compared WT and TTR-IGF-I transgenic mice were littermates derived from breeding pairs of WT and TTR-IGF-I heterozygous mice. The male TTR-IGF-I mice started to grow faster than male WT mice at the age of 5 wk, and their average body weight became significantly heavier than male WT mice at 9 wk and older ages (Fig. 3A). The female TTR-IGF-I mice also grew faster than female WT mice. The average body weight of female TTR-IGF-I mice was significantly heavier than the average body weight of female WT mice at the ages of 8, 10, 11, and 12 wk (Fig. 3A). To find out what caused the increase in the body weight of TTR-IGF-I mice, lean mass and fat mass were measured. The lean masses of 13-wk-old WT and TTR-IGF-I female mice were 16.17 ± 0.56 g/mouse (n = 10) and 16.93 ± 0.53 g/mouse (n = 10), respectively. The lean mass of TTR-IGF-I mice was statistically heavier than the lean mass of WT mice (P = 0.01, unpaired t test). In contrast, the fat masses of WT and TTR-IGF-I mice were not significantly different, which were 1.86 ± 0.26 g/WT mouse (n = 10) and 1.90 ± 0.18 g/TTR-IGF-I mouse (n = 10). Taken together, these results indicate that the elevated systemic IGF-I originated from the liver-specific expression of the TTR-IGF-I transgene can significantly stimulate somatic growth and lean mass increase.
|
, compare the entire cross-sections and the enlarged insets). Quantitative analysis of eight WT and six TTR-IGF-I mice further confirmed that the average area and the total number of muscle fibers per soleus section were significantly larger in TTR-IGF-I mice (Table 1). The individual muscle fiber was also much thicker in TTR-IGF-I mice compared with WT mice (Table 1). These results indicate that the increased lean mass in TTR-IGF-I mice is associated with both the increase of muscle fiber numbers and the increase of muscle fiber thickness.
|
). We also measured the bone density and found that the bone density was identical in WT mice and TTR-IGF-I mice, which was 0.05 ± 0.002 g/cm2 (n = 10 for each group). These results indicate that the elevated level of plasma IGF-I is able to enhance bone growth without additional enhancement of bone density.
|
The TTR-IGF-I mice showed a slightly improved glucose tolerance. In the glucose tolerance test, the glucose levels in TTR-IGF-I mice were significantly lower at the 60-min time point compared with WT mice, but no significant differences were observed at other time points (Fig. 4A). In addition, the insulin tolerance test did not reveal any difference between WT and TTR-IGF-I mice (Fig. 4B). These results suggest that the increased IGF-I in TTR-IGF-I mice can slightly enhance glucose tolerance.
|
). The average body weight and body length of the PBS-treated TTR-IGF-I mice were statistically heavier than WT mice after the age of 5 wk and longer than WT mice as measured at the end of treatment (Fig. 5, B and C), which was consistent with the results observed from the other batch of untreated mice shown in Fig. 3. Pegvisomant treatment significantly inhibited the growth of body weight and body length of both WT and TTR-IGF-I mice compared with the PBS-treated WT and TTR-IGF-I mice. However, the body weight and length of the pegvisomant-treated TTR-IGF-I mice were still statistically heavier and longer than the body weight and length of the pegvisomant-treated WT mice (Fig. 5, B and C). Importantly, the body weight and length of the pegvisomant-treated TTR-IGF-I mice showed no statistical differences from that of the PBS-treated WT mice (Fig. 5, B and C). These results suggest that mice with the liver-specific and GH-independent expression of the TTR-IGF-I transgene are more resistant to GH deficiency.
|
). Interestingly, after pegvisomant treatment, the liver and kidney in TTR-IGF-I mice were significantly heavier compared with the liver and kidney in WT mice (P < 0.01 and P < 0.001 by t test, respectively). The other organs including pituitary, heart, and spleen in the pegvisomant-treated TTR-IGF-I mice were slightly heavier than that in pegvisomant-treated WT mice, but their differences did not reach statistical significance (Table 3). These results suggest that IGF-I originating from the TTR-IGF-I transgene may preferentially stimulate liver and kidney growth under the condition of GH deficiency.
|
). Although the difference between GH levels in PBS-treated WT and TTR-IGF-I mice did not reach statistical significance because of limited mice number and single-point analysis in this experiment, the GH levels in PBS-treated TTR-IGF-I mice still showed a lower trend compared with the PBS-treated WT mice. The GH level in pegvisomant-treated TTR-IGF-I mice was lower than that in pegvisomant-treated WT mice, but their difference was also not statistically significant (Fig. 6A). These results indicate that pegvisomant treatment efficiently inhibited the function of GHR in both WT and TTR-IGF-I mice.
|
and 2C). The pegvisomant-treated WT mice exhibited a predictable reduction of the serum IGF-I levels to about 20% of the PBS-treated WT mice. These low levels of IGF-I remained unchanged during the 48-h period from the preceding to the next pegvisomant injection (Fig. 6B), indicating that the pegvisomant successfully resulted in a sustained GH deficiency in WT mice during the entire 5-wk treatment period. Surprisingly, pegvisomant treatment also significantly reduced the IGF-I levels in TTR-IGF-I mice. However, the IGF-I levels in the pegvisomant-treated TTR-IGF-I mice were 2- to 4-fold higher than the IGF-I levels in pegvisomant-treated WT mice. Furthermore, the average IGF-I level in pegvisomant-treated TTR-IGF-I mice rose significantly at 24 and 48 h after injection compared with their IGF-I levels at 6 h after injection, indicating that the pegvisomant-treated TTR-IGF-I mice can restore their IGF-I levels much faster than the pegvisomant-treated WT mice.
To understand how the pegvisomant treatment affects IGF-I expression, we measured IGF-I mRNA expressed from the endogenous IGF-I gene and the TTR-IGF-I transgene in the liver by RPA. Pegvisomant treatment efficiently and equally reduced the IGF-I mRNA expressed from the endogenous IGF-I gene in WT and TTR-IGF-I mice but did not affect the transgenic IGF-I mRNA expressed from the TTR-IGF-I transgene as normalized to the cyclophilin A control mRNA levels (Fig. 6C). These results suggest that transcriptional inhibition of the endogenous IGF-I gene by the pegvisomant contributes to the significant decrease in IGF-I levels in both WT and TTR-IGF-I mice.
Higher expression of IGFBP-3 mRNA and blunted reduction of IGFBP-3 in pegvisomant-treated TTR-IGF-I mice
The majority of IGF-I molecules form ternary complexes with ALS and IGFBP-3 in the circulation (1, 2). These IGF-binding proteins protect IGF-I from degradation and thereby maintain a high systemic IGF-I concentration and its physiological function. To understand why pegvisomant could remarkably reduce the systemic IGF-I levels not only in WT mice but also in the TTR-IGF-I mice without affecting the TTR-IGF-I transgene expression that produced many-fold higher IGF-I mRNA than the endogenous IGF-I gene after pegvisomant treatment, we first examined the ALS mRNA levels in the liver and the ALS protein levels in the serum. RPA analysis using a riboprobe complementary to the mouse ALS mRNA revealed that the pegvisomant treatment severely and equally reduced the ALS expression in both WT and TTR-IGF-I mice compared with PBS treatment (Fig. 7A). Immunoblotting with an ALS-specific antibody detected the ALS protein in the serum of PBS-treated WT and TTR-IGF-I mice but not in the serum of pegvisomant-treated WT and TTR-IGF-I mice (Fig. 7B). Because ALS is a direct target gene of the GH signaling pathway, these results further validated the efficiency of GHR blockade by pegvisomant. These results also suggest that the significant decrease of IGF-I in pegvisomant-treated WT and TTR-IGF-I mice was associated not only with the reduced expression of the endogenous IGF-I gene but also with the predictable reduction of ALS.
|
), indicating that the IGFBP-3 gene is not a direct target gene of the signaling pathway of GH and its receptor. Surprisingly, the IGFBP-3 mRNA in the liver of pegvisomant-treated TTR-IGF-I mice was increased about 2-fold compared with the pegvisomant-treated WT mice and PBS-treated WT and TTR-IGF-I mice (Fig. 7C). [125I]IGF-I ligand blotting analysis revealed that serum IGFBP-3 levels were higher in PBS-treated TTR-IGF-I mice than in PBS-treated WT mice (Fig. 7D). Pegvisomant treatment significantly decreased the levels of IGFBP-3 in WT and TTR-IGF-I mice, presumably because of the reduction of ALS (7). However, the levels of IGFBP-3 were much higher in pegvisomant-treated TTR-IGF-I mice than in pegvisomant-treated WT mice (Fig. 7D). These results demonstrate that expression of the liver-specific TTR-IGF-I transgene is able to up-regulate IGFBP-3 mRNA under GHR-dysfunction conditions and counterbalance the decrease of IGFBP-3 caused by GH deficiency, which in turn helps to maintain IGF-I levels in the circulation. |
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We also showed that the TTR-IGF-I transgenic mice have a slightly improved glucose tolerance without significant changes of their glucose and insulin levels under normal feeding and fast conditions. Because GH plays a role in regulation of insulin resistance (24), the improved glucose tolerance in TTR-IGF-I mice may be a result of down-regulated GH levels in these mice. However, it is also possible that the elevated IGF-I stimulates glucose uptake by peripheral tissues.
To our knowledge, the TTR-IGF-I transgenic mouse line is the first line that exclusively overexpresses transgenic IGF-I in the liver. Because the liver is the major organ responsible for production of the circulating IGF-I, this transgenic mouse model should be particularly useful for studying the endocrine function of IGF-I. One of the previously established IGF-I transgenic mouse lines used the promoter of avian skeletal -actin to direct the expression of human IGF-I in the striated muscle. The epitopic expression of the IGF-I transgene in these transgenic mice resulted in myofiber hypertrophy with no effect on the circulating IGF-I levels and body weight (28). Another documented IGF-I transgenic mouse line was developed by using the mouse metallothionein I promoter. This mouse line overexpressed human IGF-I in most tissues and manifested a 1.5-fold increase in circulating IGF-I levels and a 1.3-fold increase in body weight (29). Although the results from this transgenic mouse line demonstrated that elevated IGF-I played an important role in the control of somatic growth, it was not able to distinguish the contribution of the elevated plasma IGF-I from the contribution of locally produced IGF-I to the transgene-enhanced somatic growth.
Interestingly, although the TTR-IGF-I transgene was expressed several-fold higher than the endogenous IGF-I gene in the liver, the plasma IGF-I levels were increased only 50–60% in untreated or 65–100% in PBS-treated TTR-IGF-I mice compared with WT mice (Figs. 2C and 6B). This could be attributed to the limiting concentrations of ALS and IGFBP-3 in the circulation because they are key factors that determine IGF-I stability. We noticed that the IGFBP-3 levels were slightly higher in PBS-treated TTR-IGF-I mice compared with PBS-treated WT mice (Fig. 7D), suggesting that the increased production of IGF-I also extended the IGFBP-3 half-life in the circulation because IGFBP-3 mRNA levels were unaltered under this condition. Therefore, the plasma ALS concentration may be the major limiting factor for final levels of IGF-I increase in TTR-IGF-I mice. This notion is further supported by the significant reduction of plasma IGF-I levels in TTR-IGF-I mice after pegvisomant treatment, where ALS was severely reduced, whereas the expression of the TTR-IGF-I transgene was unaffected in these mice with GHR dysfunction.
In this study, we have used pegvisomant to determine whether transgenic non-GH-regulated IGF-I can alter phenotypes associated with loss of GH action. Under the condition of GHR dysfunction caused by pegvisomant treatment, we found that ALS was diminished from the circulation of both WT and TTR-IGF-I mice. This was an expected effect because ALS is a direct target of the GHR signaling pathway, and blockade of GHR severely reduced ALS mRNA expression in the liver (1, 2, 7). As expected, GHR dysfunction also caused a significant reduction of IGF-I mRNA transcribed from the endogenous IGF-I gene in the liver of both WT and TTR-IGF-I mice but did not alter the IGF-I mRNA transcribed from the TTR-IGF-I transgene in the transgenic mice. In this case, transgene expression resulted in 2- to 3-fold higher IGF-I concentrations in TTR-IGF-I mice compared with WT mice after pegvisomant treatment. Consequently, the serum IGF-I levels were reduced much less in TTR-IGF-I mice than in WT mice after pegvisomant treatment, although IGF-I was significantly reduced in pegvisomant-treated WT and TTR-IGF-I mice compared with PBS-treated WT and TTR-IGF-I mice, respectively.
In the pegvisomant-treated WT mice, the expression of IGFBP-3 mRNA in the liver was unaffected, indicating that IGFBP-3 is not a direct target of the GH/GHR signaling pathway in vivo. However, the plasma IGFBP-3 levels were drastically reduced in pegvisomant-treated WT mice, likely because of its impaired stability after the severe reduction of ALS and IGF-I as observed in mice lacking ALS or lacking liver-produced IGF-I (6, 7, 14). In the pegvisomant-treated TTR-IGF-I mice, the plasma IGFBP-3 levels were reduced compared with the PBS-treated TTR-IGF-I mice. However, the plasma IGFBP-3 levels in the pegvisomant-treated TTR-IGF-I mice were about 2-fold higher than in the pegvisomant-treated WT mice. These results were consistent with those of a previous study showing that the IGFBP-3 levels were higher in the GH-deficient mice harboring a widely expressed IGF-I transgene compared with GH-deficient mice (30). The higher IGFBP-3 levels in pegvisomant-treated TTR-IGF-I mice can be attributed to two contributions. First, the consistently available IGF-I produced from the transgene should stabilize IGFBP-3 in the circulation and extend its half-life; second, the IGFBP-3 mRNA expression was increased in pegvisomant-treated TTR-IGF-I mice compared with pegvisomant-treated WT mice as well as PBS-treated TTR-IGF-I and WT mice. Interestingly, the transgene-produced IGF-I stimulates IGFBP-3 mRNA expression in the liver only under the condition of GHR dysfunction. Consequently, the pegvisomant-treated TTR-IGF-I mice with better-maintained plasma IGF-I and IGFBP-3 levels manifested a higher resistance to GHR dysfunction or GH deficiency, including a heavier body weight, longer body length, and a maintained IGF-I/IGF-IR signaling pathway in target tissues.
At the present time, it is not clear why the increase of IGFBP-3 transcription in the liver appeared only in the pegvisomant-treated TTR-IGF-I mice and how the TTR-IGF-I transgene-produced IGF-I stimulated the increase in IGFBP-3 mRNA under the condition of GHR dysfunction. Because pegvisomant treatment had no effect on the TTR-IGF-I transgene expression but significantly reduced serum ALS and IGFBP-3 concentrations, it is possible that the unaltered synthesis and secretion of transgenic IGF-I in the liver created an excess ratio of IGF-I to its binding proteins, ALS and IGFBP-3, which at least locally increased the free IGF-I concentration. The locally increased free IGF-I might stimulate IGFBP-3 expression in hepatic nonparenchymal cells and endothelial cells because parenchymal liver cells do not express IGF-IR and IGFBP-3 (1, 8).
Clinical studies have found a positive correlation between circulating IGF-I concentrations and the risk of breast cancer among premenopausal but not postmenopausal women (31), suggesting that plasma IGF-I levels may play an important role in ovarian steroids-promoted breast tumorigenesis. Other studies also have suggested a positive correlation between the circulating IGF-I levels and the relative risks of colon, prostate, and lung cancers (32, 33, 34, 35). These clinical observations have been mimicked in mouse models, where lowering IGF-I inhibits growth of an array of different cancers (36). We believe that the TTR-IGF-I transgenic mice will be very useful for studying the role and molecular mechanisms of the circulating IGF-I in promotion of carcinogenesis. Furthermore, the TTR-IGF-I mice also will be valuable to be used in conjunction with other genetically manipulated mouse models to investigate the endocrine function of the liver-generated IGF-I in regulation of many physiological processes. For instance, the TTR-IGF-I mice can be crossed with the IGF-I knockout mice to produce IGF-I knockout mice harboring the liver-specific IGF-I transgene. This bigenic animal model would help to address the question as to how the circulating IGF-I regulates somatic growth and targets different tissues that do not express endogenous IGF-I through an endocrine mechanism.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Author disclosure summary: L.L., R.D., S.Z., O.B., and J.X. have nothing to declare. A.L. received lecture fees and consulting fees from Pfizer and Bristol Myers Squibb.
First Published Online May 18, 2006
Abbreviations: ALS, Acid-labile subunit; GHR, GH receptor; IGFBP-3, IGF-binding protein 3; IGF-IR, IGF-I receptor; RPA, RNase protection assay; SRC-3, steroid receptor coactivator-3; SV40, simian virus 40; TBS, Tris-buffered saline; TTR, transthyretin; WT, wild type.
Received December 5, 2005.
Accepted for publication May 8, 2006.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  A. Casillas-Ramirez, A. Zaouali, S. Padrissa-Altes, I. Ben Mosbah, A. Pertosa, I. Alfany-Fernandez, M. Bintanel-Morcillo, C. Xaus, A. Rimola, J. Rodes, et al. Insulin-Like Growth Factor and Epidermal Growth Factor Treatment: New Approaches to Protecting Steatotic Livers against Ischemia-Reperfusion Injury Endocrinology, July 1, 2009; 150(7): 3153 - 3161. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Ueki, S. L. Giesy, K. J. Harvatine, J. W. Kim, and Y. R. Boisclair The Acid-Labile Subunit Is Required for Full Effects of Exogenous Growth Hormone on Growth and Carbohydrate Metabolism Endocrinology, July 1, 2009; 150(7): 3145 - 3152. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Cybulski, P. Polak, J. Auwerx, M. A. Ruegg, and M. N. Hall mTOR complex 2 in adipose tissue negatively controls whole-body growth PNAS, June 16, 2009; 106(24): 9902 - 9907. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Kleinberg, T. L. Wood, P. A. Furth, and A. V. Lee Growth Hormone and Insulin-Like Growth Factor-I in the Transition from Normal Mammary Development to Preneoplastic Mammary Lesions Endocr. Rev., February 1, 2009; 30(1): 51 - 74. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Bogazzi, D. Russo, F. Raggi, F. Ultimieri, C. Urbani, M. Gasperi, L. Bartalena, and E. Martino Transgenic Mice Overexpressing Growth Hormone (GH) Have Reduced or Increased Cardiac Apoptosis through Activation of Multiple GH-Dependent or -Independent Cell Death Pathways Endocrinology, November 1, 2008; 149(11): 5758 - 5769. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Liao, X. Chen, S. Wang, A. F. Parlow, and J. Xu Steroid Receptor Coactivator 3 Maintains Circulating Insulin-Like Growth Factor I (IGF-I) by Controlling IGF-Binding Protein 3 Expression Mol. Cell. Biol., April 1, 2008; 28(7): 2460 - 2469. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Tarasiuk and Y. Segev Chronic upper airway resistive loading induces growth retardation via the GH/IGF-I axis in prepubescent rats J Appl Physiol, March 1, 2007; 102(3): 913 - 918. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
