help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology, doi:10.1210/en.2005-1483
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/8/3898    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zitzer, H.
Right arrow Articles by Efanov, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zitzer, H.
Right arrow Articles by Efanov, A. M.
Endocrinology Vol. 147, No. 8 3898-3905
Copyright © 2006 by The Endocrine Society

Sterol Regulatory Element-Binding Protein 1 Mediates Liver X Receptor-ß-Induced Increases in Insulin Secretion and Insulin Messenger Ribonucleic Acid Levels

Heike Zitzer, Wolf Wente, Martin B. Brenner, Sabine Sewing, Karsten Buschard, Jesper Gromada and Alexander M. Efanov

Lilly Research Laboratories (H.Z., W.W., M.B.B., S.S., J.G., A.M.E.), D-22419 Hamburg, Germany; and Bartholin Instituttet (K.B.), Rigshospitalet, DK-2100 Copenhagen, Denmark

Address all correspondence and requests reprints to: Dr. Alexander M. Efanov, Lilly Research Laboratories, Essener Bogen 7, D-22419 Hamburg, Germany. E-mail: efanov_alexander{at}lilly.com.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Liver X receptors (LXR{alpha} and LXRß) regulate glucose and lipid metabolism. Pancreatic ß-cells and INS-1E insulinoma cells express only the LXRß isoform. Activation of LXRß with the synthetic agonist T0901317 increased glucose-induced insulin secretion and insulin content, whereas deletion of the receptor in LXRß knockout mice severely blunted insulin secretion. Analysis of gene expression in LXR agonist-treated INS-1E cells and islets from LXRß-deficient mice revealed that LXRß positively regulated expression of ATP-binding cassette transporter A1 (ABCA1), sterol regulatory element-binding protein 1 (SREBP-1), insulin, PDX-1, glucokinase, and glucose transporter 2 (Glut2). Down-regulation of SREBP-1 expression with the specific small interfering RNA blocked basal and LXRß-induced expression of pancreatic duodenal homeobox 1 (PDX-1), insulin, and Glut2 genes. SREBP-1 small interfering RNA also prevented an increase in insulin secretion and insulin content induced by T0901317. Moreover, 5-(tetradecyloxy)-2-furoic acid, an inhibitor of the SREBP-1 target gene acetyl-coenzyme A carboxylase, blocked T0901317-induced stimulation of insulin secretion. In conclusion, activation of LXRß in pancreatic ß-cells increases insulin secretion and insulin mRNA expression via SREBP-1-regulated pathway. These data support the role of LXRß, SREBP-1, and cataplerosis/anaplerosis pathways in the control of insulin secretion in pancreatic ß-cells.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
TYPE 2 DIABETES IS commonly associated with lipid abnormalities, such as increases in circulating levels of free fatty acids (FFA), triglycerides, and dense low-density lipoprotein cholesterol particles, together with reduced levels of high-density lipoprotein cholesterol levels (1). Lipids play an important role in pancreatic ß-cell responses (2). FFA provided exogenously or produced in the ß-cell are essential to maintain proper nutrient-induced insulin secretion. Acutely, FFA generate an increase in glucose-induced insulin secretion, whereas chronic exposure to elevated lipids results in ß-cell exhaustion, impaired secretory response to glucose, and eventually, induction of ß-cell apoptosis (3).

Liver X receptors (LXR), members of a nuclear receptor superfamily of ligand-activated transcription factors, serve as intracellular sensors in regulation of lipid homeostasis. Activated by oxysterols, products of cholesterol metabolism, LXR activates a transcription program leading to the transport of excessive cholesterol from peripheral tissues to liver and conversion of cholesterol to bile acids (4). LXR{alpha} is expressed in a number of metabolically active tissues, such as liver, adipose, intestine, and macrophages, whereas LXRß is ubiquitously expressed. Major LXR target genes involved in cholesterol metabolism are ATP-binding cassette transporter A1 (ABCA1) and ATP-binding cassette transporter G1 (ABCG1), transporting cholesterol out of the cells; apolipoprotein E and cholesterol ester transfer protein, promoting transport of cholesterol into blood and its uptake by liver; as well as cytochrome P450 family 7A1 (CYP7A1), converting cholesterol into bile acids in liver (4, 5).

In addition to regulation of cholesterol metabolism, LXR promotes synthesis of triglycerides and fatty acids via induction of sterol regulatory element-binding protein 1 (SREBP-1) (6). SREBP-1 orchestrates expression of enzymes crucial for synthesis of FFA, triglyceride, and phospholipids. Two forms for SREBP-1 are derived from the same gene as a result of the use of alternative promoters and different splicing (7). SREBP-1a activates expression of genes involved in both cholesterol and fatty acid metabolism, whereas SREBP-1c is more specific in stimulation of fatty acid synthesis. SREBP-1c-responsive genes involved in fatty acid synthesis are ATP citrate lyase (ACL), acetyl-coenzyme A (CoA) carboxylase (ACC), fatty acid synthase (FAS), steroyl-CoA desaturase, and glycerol-3-phosphate acyltransferase. SREBP-1 is synthesized as a transmembrane protein residing in the endoplasmic reticulum membrane. To reach the nucleus and regulate transcription, SREBP-1 needs to be transported from endoplasmic reticulum to Golgi, where it is cleaved by the consecutive action of two proteases and then released for translocation into the nucleus (6).

Recently, it was shown that LXR is involved in regulation of glucose metabolism. Synthetic LXR agonists, T0901317 and GW3965, lower blood glucose levels and improve insulin sensitivity in db/db, ob/ob, and high-fat-diet-fed mice as well as Zucker diabetic fatty and fa/fa rats (8, 9, 10). Normalization of plasma glucose with LXR agonists can be achieved through a number of mechanisms. LXR activation inhibits hepatic gluconeogenesis via down-regulation of the expression of peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha}, phosphoenolpyruvate carboxykinase, and glucose-6-phosphatase (8, 9). Inhibition of gluconeogenic genes with LXR agonists is complemented by up-regulation of glucokinase (GK) expression leading to the elevation in hepatic glucose uptake (9). In adipose tissue, activation of LXR induces expression of the insulin-sensitive glucose transporter 4 and promotes glucose utilization (9, 11). Moreover, LXR agonists inhibit expression and activity of 11ß-hydroxysteroid dehydrogenase type 1 and may improve insulin resistance by decreasing the local concentration of active glucocorticoids (12). Alleviation of insulin resistance with LXR ligands in liver and adipose tissues is likely to be mediated via LXR{alpha} (11, 13, 14).

LXR activation may normalize plasma glucose levels in diabetic animals not only via improvements in insulin sensitivity but also via increases in insulin secretion. We have recently shown that human and rodent pancreatic islets express both LXR{alpha} and LXRß isoforms (15). T0901317 promotes glucose-dependent insulin secretion and insulin biosynthesis in rat islets and insulin-secreting cells (15), whereas islets from LXRß knockout mice (LXRß–/–) displayed lack of glucose-induced insulin secretion and increased lipid accumulation (14). Moreover, LXRß–/– mice are glucose intolerant and develop diabetes when kept on a high-fat diet because of impaired insulin secretion (14, 16). Unfortunately, the molecular mechanisms underlying LXR-induced insulin secretion and insulin biosynthesis as well as the relative contribution of LXR{alpha} vs. LXRß isoform in the regulation of insulin secretion by LXR agonists remain currently unclear. In this study, we have characterized LXR expression in isolated pancreatic ß-cells and focused on the elucidation of molecular mechanisms, by which LXR influences insulin production and secretion.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Materials
T0901317 was obtained from Cayman Chemicals (Ann Arbor, MI). 5-(Tetradecyloxy)-2-furoic acid (TOFA), cytokines, and human GH were from Sigma-Aldrich (St. Louis, MO). INS-1E cells were obtained from Dr. C. B. Wollheim (University of Geneva, Switzerland). The LXRß knockout mice were from Deltagen Inc. (San Carlos, CA) (16).

Preparation of islets and cell culture
Intact pancreatic islets were isolated from 4-month-old male LXRß–/– and age-matched control mice (C57BL/129OlaHsd) as previously described (17). Isolated islets were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA) supplemented with 10% (vol/vol) heat-inactivated fetal calf serum (Sigma-Aldrich), 100 IU/ml penicillin, and 100 µg/ml streptomycin (Invitrogen). INS-1E cells (passages 55–70) were cultured in RPMI 1640 medium with L-glutamine, 1 mM sodium pyruvate, 10 mm HEPES, 5% heat-inactivated fetal calf serum, 50 µM 2-mercaptoethanol, 10,000 IU/ml penicillin, and 10,000 µg/ml streptomycin as described (18). Incubation of INS-1E cells with T0901317 and TOFA was performed in the culture medium. Compounds were added as dimethylsulfoxide (DMSO) stock solutions and vehicle control group contained up to 0.1% DMSO.

Measurements of insulin secretion and insulin content
Islets were first incubated for 30 min in Earle’s balanced salt solution (EBSS) (Invitrogen) supplemented with 0.1% BSA and 3 mM glucose. Groups of three islets of similar size were then selected and transferred into 48-well plates containing 0.3 ml EBSS with 0.1% BSA and test compounds. Islets were additionally cultured for 1 h, and supernatant was collected for insulin measurements. To measure insulin secretion in INS-1E cells, cells were seeded in 96-well plates at a density 25,000 cells per well and cultured for 3 d. When indicated, T0901317 and TOFA were added to the culture medium. Then cells were washed with EBSS, preincubated for 30 min with 0.2 ml/well EBSS containing 0.1% BSA and further incubated in 0.2 ml/well EBSS containing 0.1% BSA and test compounds. Supernatant was collected for insulin measurements. For determination of insulin content, islets and INS-1E cells were subjected to overnight incubation in a lysis buffer containing 75% ethanol, 23.5% water, and 1.5% HCl. Insulin was measured with ELISA.

Determination of cell viability, death, and proliferation
Cell viability in INS-1E cells was determined by a colorimetric assay using a tetrazolium compound 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Madison, WI) (19). The dye reagent was added to cells and incubated for 4 h, and then absorbance at 490 nm was recorded. Apoptosis was measured with the Cell Death ELISA Plus assay according to the manufacturer’s instructions (Roche Applied Science, Basel, Switzerland). The cytokine mixture used to induce cell death consisted of 20 ng/ml IL-1ß and 40 ng/ml TNF-{alpha}. Cell proliferation in INS-1E cells was assessed with the Cell Proliferation ELISA BrdU assay according to the manufacturer’s instructions (Roche Applied Science).

Total RNA extraction and RT
Total RNA was extracted using the RNEasy Micro Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. In brief, islets or INS-1E cells were disrupted in a buffer containing guanidine isothiocyanate and homogenized by vortexing for 1 min. RNA was then selectively bound by a silica-gel membrane, contaminants were washed away, DNA was digested via column DNase treatment (RNase-Free DNase Set; QIAGEN), and total RNA was eluted in RNase-free water. The concentration and quality of the RNA preparations were checked by spectrophotometry. Two hundred nanograms of RNA were reverse transcribed in a 50-µl reaction mixture using the high-capacity cDNA archive kit (Applied Biosystems, Darmstadt, Germany) according to the manufacturer’s instructions.

Real-time quantitative PCR
Real-time RT-PCR was performed using the ABI prism 7900 HS sequence detection system (Applied Biosystems) based on the 5'-nuclease assay (20). The PCR for each mRNA was performed in quadruple on cDNA samples in an ABI PRISM 384-well optical reaction plate (Applied Biosystems). A master mixture for each quadruple was set up in a total reaction volume of 30 µl with 5 µl cDNA (in a 1:5 dilution), 15 µl 2x TaqMan Universal Master Mix, No AmpErase UNG (Applied Biosystems), 5 µl of diethylpyrocarbonate-treated water (Ambion Ltd., Huntingdon, UK), and 1.5 µl 20x primer/probe set (Assay-on-Demand Assay Mix; Applied Biosystems). From this mixture, an aliquot of 5 µl was placed in each of the four wells. The thermal cycling conditions were 95 C for 10 min and then 40 cycles of 95 C for 15 sec and 60 C for 1 min. Relative expression was calculated by normalization to 36B4 mRNA by {Delta}{Delta}Ct method (21). Assay-on-Demand numbers for individual genes are available on request.

Immunoblotting
Membrane and nuclear protein fractions of INS-1E cells were obtained using ProteoExtract subcellular proteome extraction kit (Calbiochem, EMD Biosciences, La Jolla, CA) according to the manufacturer’s instructions. The protein amount in the samples was measured with Bradford reagent (Sigma-Aldrich). Samples with equal amounts of protein were separated by SDS-PAGE, transferred to polyvinylidine difluoride (PVDF) membrane, and probed with the antibodies against SREBP-1 (Santa Cruz Biotechnology, Santa Cruz, CA), actin (Sigma-Aldrich), and lamin B (Abcam Plc, Cambridge, UK).

Transfection
For transfection with small interfering RNA (siRNA), INS-1E cells were plated in 96-well plates at a density 25,000 cells per well. The next day, cells were transfected with SREBP-1 siRNA in OPTI-MEM with 5 µg/ml Lipofectamine 2000 (Invitrogen). The final siRNA concentration was 100 nM. Efficiency of transfection was approximately 50% as assessed with a fluorescein-labeled RNA probe. After 6 h of transfection, T0901317 or DMSO was added to the culture medium. Cells were cultured for an additional 48 h before expression or functional studies were performed. Target sequence for rat SREBP-1 siRNA was AAGTACACAGGAGGCCATCTT, and target sequence for control nonsilencing siRNA (mock) was AATTCTCCGAACGTGTCACGT (QIAGEN).

Statistical analysis
Results are presented as mean values ± SEM for the indicated number of experiments. Statistical significance was evaluated using Student’s t test for pairs of data, Dunnett’s test for multiple comparisons with a control, and Tukey’s test when multiple comparisons between groups were required.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
We employed the insulinoma cell line INS-1E to explore the effects of LXR activation on insulin secretion and insulin content. INS-1E cells were cultured with a selective LXR agonist, T0901317, for 72 h before the challenge with different glucose concentrations. The 72-h incubation time was selected based on the time course for the T0901317-induced increase of insulin secretion observed in isolated islets (15). INS-1E cells treated for 72 h with 1 µM T0901317 displayed a significant elevation in insulin secretion at all tested glucose concentrations (Fig. 1AGo). At high glucose concentration (17 mm), LXR activation resulted in a 90% stimulation of insulin secretion. In addition to an increase in insulin secretion, LXR activation in INS-1E cells produced a 50% elevation in insulin content after treatment with 1 µM T0901317 (Fig. 1BGo). Stimulation of insulin secretion induced by T0901317 was concentration dependent with the compound EC50 of 17 ± 5 nM (Fig. 1CGo). The potency of T0901317 in the insulin secretion assay was in agreement with the compound potency for LXR activation of approximately 20 nm (22). Importantly, 72 h of culture of INS-1E cells with the LXR agonist did not influence cell number or cell viability measured with the MTS assay (data not shown). Moreover, T0901317 did not have any effect on cell death and proliferation (Fig. 1Go, D and E), arguing against the nonspecific effects of the compound on insulin secretion and insulin content. Results with T0901317 observed in INS-1E cells are consistent with the effects of this agonist produced in isolated islets, where the compound also induced increases in glucose-induced insulin secretion and insulin content (15).


Figure 1
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 1. Activation of LXR increases insulin secretion and insulin content in pancreatic ß-cells without influencing cell death and proliferation. A, Insulin secretion in INS-1E cells treated with either vehicle (white bars) or 1 µM T0901317 (black bars) for 72 h before a challenge with indicated glucose (Glu) concentrations; B, insulin content of INS-1E cells treated with either vehicle (white bars) or 1 µM T0901317 (black bars) for 72 h; C, insulin secretion in INS-1E cells treated with indicated concentrations of T0901317 and then challenged with 11 mM glucose; D, apoptosis in INS-1E cells treated with vehicle (white bars), 1 µM T0901317 (black bars), or cytokine mixture (hatched bars) for 72 h; E, cell proliferation in INS-1E cells cultured with vehicle (white bars), 1 µM T0901317 (black bars), or 1 µg/ml human GH (hatched bars) for 72 h. Proliferation was assessed in cells cultured with regular culture medium (+FBS) or culture medium without FBS (–FBS). Data are mean ± SEM for seven (A and C) or eight (B, D, and E) observations. **, P < 0.01; ***, P < 0.001 vs. vehicle group.

 
T0901317 is a potent agonist for both LXR{alpha} and LXRß (22). We have previously shown that pancreatic islets express LXR{alpha} and LXRß (15). To evaluate whether a specific subtype of LXR is involved in the stimulation of insulin secretion in ß-cells, we measured LXR{alpha} and LXRß mRNA expression with a quantitative RT-PCR approach. Isolated rat pancreatic islets expressed higher amounts of LXRß compared with LXR{alpha} (Fig. 2Go). Pancreatic islet is a heterogeneous cell population and includes several cell types with the majority being insulin-secreting ß-cells. We have assessed the expression of LXR subtypes in mRNA preparations from rat pancreatic ß- and non-ß-cells (mainly {alpha}-cells), which have been purified using fluorescence-activated cell sorting (FACS) as described (23). Pancreatic non-ß-cells expressed both subtypes of LXR (Fig. 2Go). When compared with islet preparations, non-ß-cells expressed significantly higher LXR{alpha} levels (P < 0.05). On the contrary, FACS-purified ß-cells did not express LXR{alpha} but expressed only LXRß isoform. Similar to purified primary ß-cells, RT-PCR in INS-1E cells detected the expression of only LXRß mRNA. The expression of LXR subtypes in pancreatic ß-cells was different from LXR mRNA expression in hepatocytes, where LXR{alpha} was predominant (Fig. 2Go). The LXR expression data in ß-cells point to the role of LXRß in regulation of insulin biosynthesis and secretion.


Figure 2
View larger version (9K):
[in this window]
[in a new window]
  		FIG. 2. LXRß is the predominant LXR isoform in pancreatic ß-cells. Expression of LXR{alpha} (white bars) or LXRß (black bars) mRNA was assessed by quantitative RT-PCR in pancreatic islets, FACS-purified pancreatic cells and hepatocytes. ND is not detected. Data are mean ± SEM for four observations. **, P < 0.01 vs. LXR{alpha} expression in the corresponding cell type.

 
To identify the molecular mechanisms mediating LXRß-induced stimulation of insulin production and secretion, we investigated the expression of LXRß target genes SREBP-1 and ABCA1 as well as expression of genes known to play an important role in the maintenance of the pancreatic ß-cell phenotype. Treatment of INS-1E cells with 1 µM T0901317 for 72 h induced a strong increase in both SREBP-1 and ABCA1 mRNA levels (Fig. 3AGo). In addition to these well established LXR target genes, expression of insulin gene 2 (Ins2), pancreatic duodenal homeobox 1 (PDX-1), glucokinase, and glucose transporter 2 (Glut2) was elevated in cells treated with T0901317 (Fig. 3AGo). At the same time, the expression of other studied genes including Isl1, HNF1{alpha}, and HNF4{alpha} transcription factors as well as UCP2 did not significantly change (Fig. 3AGo).


Figure 3
View larger version (13K):
[in this window]
[in a new window]
  		FIG. 3. LXRß regulates expression of genes essential for pancreatic ß-cell function. A, Relative gene expression in INS-1E cells treated for 72 h with either vehicle (white bars) or 1 µM T0901317 (black bars), B, relative gene expression in islets isolated from either wild-type (black bars) or LXRß–/– (white bars) mice. Data are mean ± SEM for three (A) and six (B) observations. *, P < 0.05; **, P < 0.01 vs. expression in nontreated (A) or wild-type (B) cells.

 
PDX-1 is required for pancreas development and is critical for maintaining the differentiated ß-cell phenotype (24). To examine the role of LXRß in regulation of PDX-1 and Ins2 expression in vivo, we determined the expression of these genes in isolated pancreatic islets from LXRß–/– mice. Compared with wild-type islets, expression of both PDX-1 and Ins2 genes was severely impaired in islets from LXRß–/– mice, by 5-fold for Ins2 and 3-fold for PDX-1 (Fig. 3BGo). Islets from LXRß–/– mice displayed also a significant decrease in expression of the classical LXR target genes SREBP-1 and ABCA1 (Fig. 3BGo). Importantly, the LXRß deficiency did not produce a compensatory up-regulation of LXR{alpha} mRNA in islets from the knockout mice (data not shown). Reduction of expression of PDX-1 and Ins2 genes observed in LXRß–/– mice confirms the critical role of LXRß in the maintenance and regulation of expression of the genes essential for ß-cell function.

LXRß–/– mice display glucose intolerance and develop diabetes when fed a high-fat diet (14, 16). Disturbances in glucose metabolism in these animals result from the impairments in insulin secretion. We have measured insulin secretion in islets isolated from LXRß–/– mice (Fig. 4AGo) (16). Compared with islets from control animals, LXRß–/– islets secreted significantly less insulin under basal conditions (70% of control at 3 mM glucose). Moreover, insulin secretion in response to high glucose (17 mm) and depolarizing potassium (30 mM) was severely impaired in LXRß–/– islets, whereas glucagon-like peptide 1 (GLP-1) (50 nM) could partially restore insulin secretion in LXRß–/– islets (Fig. 4AGo). Islets from LXRß–/– mice displayed also a decrease in insulin content (Fig. 4BGo). After normalization of insulin secretion by insulin content in islets from different groups, insulin secretion in LXRß–/– islets was still significantly impaired, when measured under conditions of high glucose, high KCl, and GLP-1: 23, 41, and 71% of secretion in wild-type islets, respectively.


Figure 4
View larger version (11K):
[in this window]
[in a new window]
  		FIG. 4. Deletion of LXRß impairs insulin secretion and insulin content in pancreatic islets. A, Insulin secretion in response to glucose (Glu), potassium chloride (KCl), and GLP-1 in islets isolated from either wild-type (black bars) or LXRß–/– (white bars) mice; B, insulin content of islets isolated from wild-type (black bars) or LXRß–/– (white bars) mice. Data are mean ± SEM for six observations. *, P < 0.05; **, P < 0.01; ***, P < 0.001 vs. insulin secretion/insulin content in islets from wild-type mice.

 
Induction of cataplerosis, the export of mitochondrial intermediates into the cytosol and the synthesis of lipid-derived signaling molecules (25), is implicated in the up-regulation of insulin secretion in pancreatic ß-cells in response to high-glucose treatment (26). The LXRß target gene, SREBP-1, is induced in ß-cells by high-glucose treatment and, in turn, activates expression of genes mediating cataplerosis (27, 28). We have examined the effect of elevated glucose and the LXR agonist on protein SREBP-1 levels. Culture of INS-1E cells for 72 h with 1 µM T0901317 at 11 mm glucose produced a strong increase in both precursor membrane and cleaved nuclear forms of SREBP-1 (Fig. 5AGo). Exposure to 30 mM glucose elevated the amount of the processed nuclear form of SREBP-1, suggesting that glucose stimulates processing of SREBP-1. These data are in agreement with a recent observation that transcriptional induction of SREBP-1 with glucose in INS-1E cells is short-lived and that glucose-induced SREBP-1 activity can be explained by activation of SREBP-1 processing (29).


Figure 5
View larger version (45K):
[in this window]
[in a new window]
  		FIG. 5. LXR agonist and glucose increase SREBP-1 protein levels. A, Precursor (pSREBP-1) and nuclear (nSREBP-1) forms of SREBP-1 in INS-1E cells treated with indicated glucose (Glu) concentrations and 1 µM T0901317; B, modulation of SREBP-1 protein expression in INS-1E cells transfected with mock or SREBP-1-specific siRNA and cultured with 1 µM T0901317 as indicated. Lamin B and actin were used to demonstrate equal protein loading. Data are representative of three experiments.

 
Two splicing forms of SREBP-1 have been described, 1a and 1c (7). We have examined the expression of SREBP-1a and SREBP-1c in INS-1E cells using isoform-specific RT-PCR assays. The basal expression of SREBP-1a and SREBP-1c in INS-1E cells was similar. However, T0901317 treatment produced a strong 7-fold increase in SREBP-1c mRNA expression and only 2-fold increase in SREBP-1a expression (data not shown).

Next we used a SREBP-1-specific siRNA to examine the role of the SREBP-1 pathway in LXRß-mediated activation of insulin production and secretion. Transfection of INS-1E cells with the SREBP-1 siRNA produced approximately 70% inhibition of T0901317-induced SREBP-1 protein expression (Fig. 5BGo). SREBP-1 down-regulation in the siRNA-transfected cells was also confirmed with quantitative RT-PCR (Fig. 6AGo). Cells with inhibited SREBP-1 expression displayed lower basal expression of Ins2, PDX-1, and Glut2 genes, with the strongest down-regulation observed for Ins2 (50% inhibition). Moreover, siRNA treatment blunted the T0901317-induced expression of Ins2, PDX-1, and Glut2 genes, implying the essential role of SREBP-1 in the LXRß regulation of expression of these genes. Interestingly, inhibition of SREBP-1 did not influence GK expression, suggesting an SREBP-1-independent mechanism for LXRß regulation of GK expression, which could be mediated via retinoid X receptors (30).


Figure 6
View larger version (22K):
[in this window]
[in a new window]
  		FIG. 6. SREBP-1 is involved in LXRß-induced increases in insulin secretion and insulin production. A, Effect of SREBP-1 siRNA transfection on relative gene expression in INS-1E cells determined by quantitative RT-PCR; B, effect of SREBP-1 siRNA transfection on glucose (Glu) regulated insulin secretion in INS-1E cells; C, effect of SREBP-1 siRNA transfection on insulin content in INS-1E cells. Cells were transfected with mock siRNA and treated with vehicle (white bars), transfected with mock siRNA and treated with 1 µM T0901317 (black bars), transfected with SREBP-1 siRNA and treated with vehicle (hatched bars), or transfected with SREBP-1 siRNA and treated with 1 µM T0901317 (crossed bars). Data are mean ± SEM for three (A), six (B), and 12 (C) observations. *, P < 0.05; **, P < 0.01 vs. corresponding response in cells transfected with the mock siRNA and treated with vehicle; ##, P < 0.01 vs. corresponding response in cells transfected with the mock siRNA and treated with T0901317.

 
We have also examined effects of SREBP-1 inhibition on ß-cell functional responses. Down-regulation of SREBP-1 did not alter basal insulin secretion in INS-1E cells but decreased glucose-induced insulin secretion (Fig. 6BGo). Down-regulation of SREBP-1 expression also drastically decreased LXRß-mediated increase in insulin secretion. Measurements of cellular insulin content in siRNA-treated cells showed that SREBP-1 inhibition resulted in a 20% decrease in basal insulin content and a 35% decrease in LXRß-stimulated insulin content (Fig. 6CGo). We also evaluated the role of ABCA1 in LXRß-induced insulin secretion. ABCA1 siRNA treatment of INS-1E cells significantly decreased ABCA1 protein levels but failed to modify insulin secretion (data not shown).

Our data on the role of SREBP-1 in LXRß-induced insulin biosynthesis and secretion are consistent with the current view on cataplerosis/anaplerosis as one of the pathways mediating nutrient-induced insulin secretion (25, 26). In this pathway, Krebs cycle intermediates leave mitochondria and are further metabolized to produce cytosolic reduced nicotinamide adenine dinucleotide phosphate or get converted into acetyl-CoA by ACL and, subsequently, malonyl-CoA by ACC. Malonyl-CoA inhibits fatty acid oxidation and serves as a substrate for generation of acyl-CoAs, which, in turn, promote insulin secretion (31). Both ACL and ACC are SREBP-1 target genes (32, 33). To confirm our data obtained with SREBP-1 siRNA, we examined the effects of the ACC inhibitor TOFA (34) on insulin secretion and insulin content. INS-1E cells have been cultured for 72 h with 2 µg/ml TOFA and then challenged with glucose and KCl. Culture of cells for 72 h with TOFA alone or in combination with T0901317 did not influence cell viability measured with the MTS assay (data not shown). Incubation of cells with TOFA produced a slight inhibition of glucose- and KCl-induced insulin secretion as well as insulin content (Fig. 7Go, A and B). TOFA completely blocked T0901317-mediated increases in insulin secretion measured at 2 and 11 mM glucose (Fig. 7AGo). The inhibitor also significantly reduced increase in insulin content induced by T0901317 (Fig. 7BGo). Data with TOFA confirm the involvement of SREBP-1 signaling pathway in LXR-induced increase in insulin secretion.


Figure 7
View larger version (16K):
[in this window]
[in a new window]
  		FIG. 7. Inhibition of ACC activity with TOFA blocks LXRß-induced increase in insulin secretion and insulin content. A, Insulin secretion in INS-1E cells treated for 72 h with vehicle (white bars), 1 µM T0901317 (black bars), 2 µg/ml TOFA (hatched bars), and 1 µM T0901317 with 2 µg/ml TOFA (crossed bars) before challenge with glucose (Glu) and KCl; B, insulin content in INS-1E cells treated for 72 h with vehicle (white bars), 1 µM T0901317 (black bars), 2 µg/ml TOFA (hatched bars), and 1 µM T0901317 with 2 µg/ml TOFA (crossed bars). Data are mean ± SEM for eight observations. *, P < 0.5; **, P < 0.01; ***, P < 0.001 vs. insulin secretion/insulin content in cells treated with vehicle.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We demonstrate here that LXR agonists promote insulin secretion and insulin production via activation of LXRß in pancreatic ß-cells. LXRß plays an important role in controlling expression of genes crucial for the ß-cell phenotype, i.e. PDX-1 and insulin. Activation of SREBP-1, the target gene of LXRß in ß-cells, is likely the mechanism for the induction of insulin secretion as well as insulin and PDX-1 mRNA levels.

Mechanisms of nutrient-stimulated insulin secretion in ß-cells are fairly well characterized. A raise in the ATP/ADP ratio is considered to be a major signal coupling an increase in the rate of nutrient metabolism with the elevation in cytosolic free Ca2+ and, eventually, in insulin secretion (35). In addition to the classical pathway, Ca2+-independent mechanisms mediating stimulation of glucose-induced insulin secretion have been demonstrated and may involve cataplerosis/anaplerosis (25, 35). In ß-cells, up to 50% of glucose-derived carbon enters the Krebs cycle via pyruvate carboxylation, implying that similar amounts of carbon should leave mitochondria without being oxidized (25). Krebs cycle intermediates, which leave mitochondria, can be used via a number of pathways, one of which being the production of acetyl-CoA and then malonyl-CoA by subsequent reactions of ACL and ACC (3, 25). Malonyl-CoA is further used for de novo synthesis of fatty acids and lipids (lipogenesis) or accumulates in the cytosol, where it decreases oxidation of fatty acids and increases accumulation of long-chain acyl-CoA. Production of lipid-containing molecules, in turn, promotes insulin exocytosis by not well defined mechanisms (31). Numerous lines of evidence characterize this pathway as essential for glucose-induced insulin secretion in ß-cells. Acute exposure to glucose induces parallel elevations in cytosolic citrate, malate, malonyl-CoA, and insulin secretion (26). Long-term exposure to high glucose produces concomitant increases in insulin secretion and expression of ACL, ACC, and FAS (27). Inhibition of pyruvate carboxylase (PC) or ACC decreases glucose-induced insulin secretion (26, 36). And finally, overexpression of malonyl-CoA decarboxylase decreases malonyl-CoA levels and reduces insulin secretion (37). The results of this study suggest that one of the mechanisms for LXRß-induced insulin secretion is SREBP-1-mediated activation of cataplerosis in pancreatic ß-cells. Indeed, ACL, ACC, and FAS are all target genes of SREBP-1, and we have shown previously that LXR activation resulted in increases in PC activity as well as ACC and FAS protein levels (15). Moreover, pharmacological agents interfering with the cataplerosis pathway, such as phenylacetic acid (15) and TOFA, blunted LXR-promoted insulin secretion.

Importantly, in addition to activation of the cataplerosis pathway, SREBP-1 is involved in LXRß-induced up-regulation of PDX-1 expression. PDX-1 is a key regulator of insulin gene expression and is critical for the endocrine pancreas development and maintenance of the ß-cell phenotype and ß-cell mass (24, 38). Disruption of PDX-1 in ß-cells results in progression of diabetes in aged animals as well as reduction in insulin and Glut2 expression (39). Mice containing only half the amount of PDX-1 display glucose intolerance and increased rate of ß-cell apoptosis (39, 40). Transcriptional regulation of PDX-1 expression is rather complex and involves interaction of a number of transcription factors at the PDX-1 promoter (24). Here we propose SREBP-1 as an additional player in the regulation of PDX-1 transcription.

PDX-1 is a major transactivator of the insulin gene and mediates glucose-induced up-regulation of insulin expression (24). Induction of PDX-1 expression by SREBP-1 may suggest that the increase in insulin mRNA observed upon LXRß stimulation is mediated through the increase in PDX-1 expression. However, recently it was demonstrated that SREBP-1 can activate the insulin gene expression by binding to three sterol response elements on the insulin gene promoter as well as by serving as coactivator for BETA2/E47 (41). Interestingly, the cited study showed that SREBP-1 and PDX-1 play a redundant role in controlling insulin gene expression with SREBP-1 being more efficacious under conditions of low PDX-1. The relative contributions of direct vs. indirect effects of SREBP-1 on insulin gene transcription remain to be explored.

In the natural development of type 2 diabetes, the ß-cell passes through at least two stages: enhanced insulin secretion (hyperinsulinemia) to keep plasma glucose close to normal in the face of insulin resistance and ß-cell dysfunction at later stages of disease progression, when raised glucose and lipid levels induce ß-cell damage. Activation of SREBP-1c by elevated glucose has been implicated in the development of ß-cell dysfunction. Islets from diabetic animals display increased levels of SREBP-1 (42). Moreover, overexpression of constitutively active nuclear SREBP-1c leads to a dramatic lipid deposition, decreased glucose oxidation, and impaired glucose-induced insulin secretion (28, 43, 44, 45, 46). In contrast to overexpression studies, induction of SREBP-1 with LXRß did not impair ß-cell function within the time limits used in the current study. One of the possible explanations for the opposite effects of SREBP-1 activation is differences in the levels of active nuclear SREBP-1 as well as in the duration of SREBP-1 activation produced by the two approaches. Contrary to forced nuclear SREBP-1 overexpression, LXRß activation produces nuclear SREBP-1 in a regulated and controlled manner at milder levels close to those induced by hyperglycemia. Thus, our data together with the studies mentioned above (28, 43, 44, 45, 46) suggest that the effects of SREBP-1 induction on ß-cell function can be biphasic. Initially, mild SREBP-1 induction by hyperglycemia can be important for up-regulation of insulin secretion to adapt to the increased demand for insulin at the insulin-resistance state. However, long-term and strong SREBP-1 activation would eventually lead to ß-cell toxicity via increased lipid accumulation.

Recent data point to the plausible role of SREBP-1 in the initial adaptation of ß-cell response to insulin resistance. Islets from insulin-resistant Zucker fatty rats display elevated insulin secretion and glucose utilization as a result of the increased glucose flux through PC and activation of the anaplerosis pathway (47). Moreover, islets from SREBP-1 knockout mice fail to raise insulin secretion in respond to high-glucose treatment (48). The mechanisms of SREBP-1 induction under hyperglycemia in ß-cells have not been studied yet. Potentially, LXRß could be involved in this process and, thereby, in the adaptation response of the ß-cell to insulin resistance.


   Acknowledgments
 
We thank Gina Tillmann, Eva-Marie Azizi, and Henrik Benjes for technical assistance.


   Footnotes
 
Present address for J.G.: Novartis Institute for Biomedical Research, Cambridge, MA.

Disclosure Statement: W.W. and K.B. have nothing to declare; H.Z., M.B.B., S.S.,and A.E.M. hold stock in Eli Lilly; and J.G. holds stock in Novartis, Eli Lilly, and Novo Nordisk.

First Published Online April 27, 2006

Abbreviations: ACC, Acetyl-coenzyme A carboxylase; ACL, ATP citrate lyase; CoA, coenzyme A; DMSO, dimethylsulfoxide; EBSS, Earle’s balanced salt solution; FACS, fluorescence-activated cell sorting; FAS, fatty acid synthase; FFA, free fatty acids; GK – glucokinase; GLP-1, glucagon-like peptide 1; Glut2, glucose transporter 2; Ins2, insulin gene 2; LXR, liver X receptor; LXRß–/–, LXRß knockout mice; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; PC, pyruvate carboxylase; PDX-1, pancreatic duodenal homeobox 1; siRNA, small interfering RNA; SREBP-1, sterol regulatory element-binding protein 1; TOFA, 5-(tetradecyloxy)-2-furoic acid.

Received November 22, 2005.

Accepted for publication April 14, 2006.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Haffner SM 1998 Management of dyslipidemia in adults with diabetes. Diabetes Care 21:160–178[Abstract]
  2. Yaney GC, Corkey BE 2003 Fatty acid metabolism and insulin secretion in pancreatic ß cells. Diabetologia 46:1297–1312[CrossRef][Medline]
  3. Prentki M, Joly E, El-Assaad W, Roduit R 2002 Malonyl-CoA signaling, lipid partitioning, and glucolipotoxicity: role in ß-cell adaptation and failure in the etiology of diabetes. Diabetes 51:S405–S413
  4. Zhang Y, Mangelsdorf DJ 2002 LuXuRies of lipid homeostasis: the unity of nuclear hormone receptors, transcription regulation, and cholesterol sensing. Mol Interv 2:78–87[Abstract/Free Full Text]
  5. Tontonoz P, Mangelsdorf DJ 2003 Liver X receptor signaling pathways in cardiovascular disease. Mol Endocrinol 17:985–993[Abstract/Free Full Text]
  6. Horton JD, Goldstein JL, Brown MS 2002 SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. J Clin Invest 109:1125–1131[CrossRef][Medline]
  7. Shimomura I, Shimano H, Horton JD, Goldstein JL, Brown MS 1997 Differential expression of exons 1a and 1c in mRNAs for sterol regulatory element binding protein-1 in human and mouse organs and cultured cells. J Clin Invest 99:838–845[Medline]
  8. Cao G, Liang Y, Broderick CL, Oldham BA, Beyer TP, Schmidt RJ, Zhang Y, Stayrook KR, Suen C, Otto KA, Miller AR, Dai J, Foxworthy P, Gao H, Ryan TP, Jiang XC, Burris TP, Eacho PI, Etgen GJ 2003 Antidiabetic action of a liver X receptor agonist mediated by inhibition of hepatic gluconeogenesis. J Biol Chem 278:1131–1136[Abstract/Free Full Text]
  9. Laffitte BA, Chao LC, Li J, Walczak R, Hummasti S, Joseph SB, Castrillo A, Wilpitz DC, Mangelsdorf DJ, Collins JL, Saez E, Tontonoz P 2003 Activation of liver X receptor improves glucose tolerance through coordinate regulation of glucose metabolism in liver and adipose tissue. Proc Natl Acad Sci USA 100:5419–5424[Abstract/Free Full Text]
  10. Grefhorst A, van Dijk TH, Hammer A, van der Sluijs FH, Havinga R, Havekes LM, Romijn JA, Groot PH, Reijngoud DJ, Kuipers F 2005 Differential effects of pharmacological liver X receptor activation on hepatic and peripheral insulin sensitivity in lean and ob/ob mice. Am J Physiol Endocrinol Metab 289:E829–E838
  11. Dalen KT, Ulven SM, Bamberg K, Gustafsson JA, Nebb HI 2003 Expression of the insulin-responsive glucose transporter GLUT4 in adipocytes is dependent on liver X receptor {alpha}. J Biol Chem 278:48283–48291[Abstract/Free Full Text]
  12. Stulnig TM, Oppermann U, Steffensen KR, Schuster GU, Gustafsson JA 2002 Liver X receptors downregulate 11ß-hydroxysteroid dehydrogenase type 1 expression and activity. Diabetes 51:2426–2433[Abstract/Free Full Text]
  13. Lehrke M, Lebherz C, Millington SC, Guan HP, Millar J, Rader DJ, Wilson JM, Lazar MA 2005 Diet-dependent cardiovascular lipid metabolism controlled by hepatic LXR{alpha}. Cell Metab 1:297–308[CrossRef][Medline]
  14. Gerin I, Dolinsky VW, Shackman JG, Kennedy RT, Chiang SH, Burant CF, Steffensen KR, Gustafsson JA, MacDougald OA 2005 LXRß is required for adipocyte growth, glucose homeostasis, and ß cell function. J Biol Chem 280:23024–23031[Abstract/Free Full Text]
  15. Efanov AM, Sewing S, Bokvist K, Gromada J 2004 Liver X receptor activation stimulates insulin secretion via modulation of glucose and lipid metabolism in pancreatic ß-cells. Diabetes 53:S75–S78
  16. Guenther C, Phillips R, Allen KD, Zhang Q, Baribault H 2002 Transgenic mice containing retinoid X receptor interacting protein gene disruptions. PCT Int Appl WO02057438
  17. Brenner MB, Gromada J, Efanov AM, Bokvist K, Mest HJ 2003 Restoration of first-phase insulin secretion by the imidazoline compound LY374284 in pancreatic islets of diabetic db/db mice. Ann NY Acad Sci 1009:332–340[Abstract/Free Full Text]
  18. Merglen A, Theander S, Rubi B, Chaffard G, Wollheim CB, Maechler P 2004 Glucose sensitivity and metabolism-secretion coupling studied during two-year continuous culture in INS-1E insulinoma cells. Endocrinology 145:667–678[Abstract/Free Full Text]
  19. Buttke TM, McCubrey JA, Owen TC 1993 Use of an aqueous soluble tetrazolium/formazan assay to measure viability and proliferation of lymphokine-dependent cell lines. J Immunol Methods 157:233–240[CrossRef][Medline]
  20. Holland PM, Abramson RD, Watson R, Gelfand DH 1991 Detection of specific polymerase chain reaction product by utilizing the 5'–3' exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88:7276–7280[Abstract/Free Full Text]
  21. Livak KJ, Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2{Delta}{Delta}CT method. Methods 25:402–408[CrossRef][Medline]
  22. Schultz JR, Tu H, Luk A, Repa JJ, Medina JC, Li L, Schwendner S, Wang S, Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B 2000 Role of LXRs in control of lipogenesis. Genes Dev 14:2831–2838[Abstract/Free Full Text]
  23. Josefsen K, Stenvang JP, Kindmark H, Berggren PO, Horn T, Kjaer T, Buschard K 1996 Fluorescence-activated cell sorted rat islet cells and studies of the insulin secretory process. J Endocrinol 149:145–154[Abstract]
  24. McKinnon CM, Docherty K 2001 Pancreatic duodenal homeobox-1, PDX-1, a major regulator of ß cell identity and function. Diabetologia 44:1203–1214[CrossRef][Medline]
  25. MacDonald MJ, Fahien LA, Brown LJ, Hasan NM, Buss JD, Kendrick MA 2005 Perspective: emerging evidence for signaling roles of mitochondrial anaplerotic products in insulin secretion. Am J Physiol Endocrinol Metab 288:E1–E15
  26. Farfari S, Schulz V, Corkey B, Prentki M 2000 Glucose-regulated anaplerosis and cataplerosis in pancreatic ß-cells: possible implication of a pyruvate/citrate shuttle in insulin secretion. Diabetes 49:718–726[Abstract]
  27. Flamez D, Berger V, Kruhoffer M, Orntoft T, Pipeleers D, Schuit FC 2002 Critical role for cataplerosis via citrate in glucose-regulated insulin release. Diabetes 51:2018–2024[Abstract/Free Full Text]
  28. Andreolas C, da Silva Xavier G, Diraison F, Zhao C, Varadi A, Lopez-Casillas F, Ferre P, Foufelle F, Rutter GA 2002 Stimulation of acetyl-CoA carboxylase gene expression by glucose requires insulin release and sterol regulatory element binding protein 1c in pancreatic MIN6 ß-cells. Diabetes 51:2536–2545[Abstract/Free Full Text]
  29. Sandberg MB, Fridriksson J, Madsen L, Rishi V, Vinson C, Holmsen H, Berge RK, Mandrup S 2005 Glucose-induced lipogenesis in pancreatic ß-cells is dependent on SREBP-1. Mol Cell Endocrinol 240:94–106[CrossRef][Medline]
  30. Cabrera-Valladares G, German MS, Matschinsky FM, Wang J, Fernandez-Mejia C 1999 Effect of retinoic acid on glucokinase activity and gene expression and on insulin secretion in primary cultures of pancreatic islets. Endocrinology 140:3091–3096[Abstract/Free Full Text]
  31. Deeney JT, Gromada J, Hoy M, Olsen HL, Rhodes CJ, Prentki M, Berggren PO, Corkey BE 2000 Acute stimulation with long chain acyl-CoA enhances exocytosis in insulin-secreting cells (HIT T-15 and NMRI ß-cells). J Biol Chem 275:9363–9368[Abstract/Free Full Text]
  32. Sato R, Okamoto A, Inoue J, Miyamoto W, Sakai Y, Emoto N, Shimano H, Maeda M 2000 Transcriptional regulation of the ATP citrate-lyase gene by sterol regulatory element-binding proteins. J Biol Chem 275:12497–12502[Abstract/Free Full Text]
  33. Lopez JM, Bennett MK, Sanchez HB, Rosenfeld JM, Osborne TE 1996 Sterol regulation of acetyl coenzyme A carboxylase: a mechanism for coordinate control of cellular lipid. Proc Natl Acad Sci USA 93:1049–1053[Abstract/Free Full Text]
  34. Halvorson DL, McCune SA 1984 Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid. Lipids 19:851–856[Medline]
  35. Henquin JC 2000 Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes 49:1751–1760[Abstract]
  36. Zhang S, Kim KH 1998 Essential role of acetyl-CoA carboxylase in the glucose-induced insulin secretion in a pancreatic ß-cell line. Cell Signal 10:35–42[CrossRef][Medline]
  37. Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V, Przybykowski E, Morin J, Masse F, Massie B, Ruderman N, Rhodes C, Poitout V, Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of lipid signaling in the regulation of insulin secretion in response to both fuel and nonfuel stimuli. Diabetes 53:1007–1019[Abstract/Free Full Text]
  38. Ohlsson H, Karlsson K, Edlund T 1993 IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12:4251–4259[Medline]
  39. Ahlgren U, Jonsson J, Jonsson L, Simu K, Edlund H 1998 ß-Cell-specific inactivation of the mouse Ipf1/Pdx1 gene results in loss of the ß-cell phenotype and maturity onset diabetes. Genes Dev 12:1763–1768[Abstract/Free Full Text]
  40. Johnson JD, Ahmed NT, Luciani DS, Han Z, Tran H, Fujita J, Misler S, Edlund H, Polonsky KS 2003 Increased islet apoptosis in Pdx1+/– mice. J Clin Invest 111:1147–1160[CrossRef][Medline]
  41. Amemiya-Kudo M, Oka J, Ide T, Matsuzaka T, Sone H, Yoshikawa T, Yahagi N, Ishibashi S, Osuga JI, Yamada N, Murase T, Shimano H 2005 SREBPs activate insulin gene promoter directly and indirectly through synergy with BETA2/E47. J Biol Chem 280:34577–34589[Abstract/Free Full Text]
  42. Kakuma T, Lee Y, Higa M, Wang Z, Pan W, Shimomura I, Unger RH 2000 Leptin, troglitazone, and the expression of sterol regulatory element binding proteins in liver and pancreatic islets. Proc Natl Acad Sci USA 97:8536–8541[Abstract/Free Full Text]
  43. Wang H, Maechler P, Antinozzi PA, Herrero L, Hagenfeldt-Johansson KA, Bjorklund A, Wollheim CB 2003 The transcription factor SREBP-1c is instrumental in the development of ß-cell dysfunction. J Biol Chem 278:16622–16629[Abstract/Free Full Text]
  44. Diraison F, Parton L, Ferre P, Foufelle F, Briscoe CP, Leclerc I, Rutter GA 2004 Over-expression of sterol-regulatory-element-binding protein-1c (SREBP1c) in rat pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin release: modulation by 5-aminoimidazole-4-carboxamide ribonucleoside (AICAR). Biochem J 378:769–778[CrossRef][Medline]
  45. Yamashita T, Eto K, Okazaki Y, Yamashita S, Yamauchi T, Sekine N, Nagai R, Noda M, Kadowaki T 2004 Role of uncoupling protein-2 up-regulation and triglyceride accumulation in impaired glucose-stimulated insulin secretion in a ß-cell lipotoxicity model overexpressing sterol regulatory element-binding protein-1c. Endocrinology 145:3566–3577[Abstract/Free Full Text]
  46. Takahashi A, Motomura K, Kato T, Yoshikawa T, Nakagawa Y, Yahagi N, Sone H, Suzuki H, Toyoshima H, Yamada N, Shimano H 2005 Transgenic mice overexpressing nuclear SREBP-1c in pancreatic ß-cells. Diabetes 54:492–499[Abstract/Free Full Text]
  47. Liu YQ, Jetton TL, Leahy JL 2002 ß-Cell adaptation to insulin resistance. Increased pyruvate carboxylase and malate-pyruvate shuttle activity in islets of nondiabetic Zucker fatty rats. J Biol Chem 277:39163–39168[Abstract/Free Full Text]
  48. Diraison F, Ravier MA, Richards SK, Smith RM, Shimano H, Rutter GA 2005 Sterol regulatory element binding protein1 (SREBP1) is required for the potentiation by culture at high glucose concentrations of glucose-stimulated insulin secretion from mouse islets. Diabetologia 48:A165–A166



This article has been cited by other articles:


Home page
 J. Lipid Res.Home page
F. Diraison, M. A. Ravier, S. K. Richards, R. M. Smith, H. Shimano, and G. A. Rutter
SREBP1 is required for the induction by glucose of pancreatic {beta}-cell genes involved in glucose sensing
J. Lipid Res., April 1, 2008; 49(4): 814 - 822.
[Abstract] [Full Text] [PDF]

Home page
 DiabetesHome page
S. S. Choe, A H. Choi, J.-W. Lee, K. H. Kim, J.-J. Chung, J. Park, K.-M. Lee, K.-G. Park, I.-K. Lee, and J. B. Kim
Chronic Activation of Liver X Receptor Induces {beta}-Cell Apoptosis Through Hyperactivation of Lipogenesis: Liver X Receptor-Mediated Lipotoxicity in Pancreatic {beta}-Cells
Diabetes, June 1, 2007; 56(6): 1534 - 1543.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
J. Chen, P. B. Jeppesen, I. Nordentoft, and K. Hermansen
Stevioside improves pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA carboxylase
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1906 - E1916.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
W. Wente, M. B. Brenner, H. Zitzer, J. Gromada, and A. M. Efanov
Activation of Liver X Receptors and Retinoid X Receptors Induces Growth Arrest and Apoptosis in Insulin-Secreting Cells
Endocrinology, April 1, 2007; 148(4): 1843 - 1849.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
147/8/3898    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zitzer, H.
Right arrow Articles by Efanov, A. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zitzer, H.
Right arrow Articles by Efanov, A. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res.