| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Lilly Research Laboratories (H.Z., W.W., M.B.B., S.S., J.G., A.M.E.), D-22419 Hamburg, Germany; and Bartholin Instituttet (K.B.), Rigshospitalet, DK-2100 Copenhagen, Denmark
Address all correspondence and requests reprints to: Dr. Alexander M. Efanov, Lilly Research Laboratories, Essener Bogen 7, D-22419 Hamburg, Germany. E-mail: efanov_alexander{at}lilly.com.
| Abstract |
|---|
|
|
|---|
and LXRß) regulate glucose and lipid metabolism. Pancreatic ß-cells and INS-1E insulinoma cells express only the LXRß isoform. Activation of LXRß with the synthetic agonist T0901317 increased glucose-induced insulin secretion and insulin content, whereas deletion of the receptor in LXRß knockout mice severely blunted insulin secretion. Analysis of gene expression in LXR agonist-treated INS-1E cells and islets from LXRß-deficient mice revealed that LXRß positively regulated expression of ATP-binding cassette transporter A1 (ABCA1), sterol regulatory element-binding protein 1 (SREBP-1), insulin, PDX-1, glucokinase, and glucose transporter 2 (Glut2). Down-regulation of SREBP-1 expression with the specific small interfering RNA blocked basal and LXRß-induced expression of pancreatic duodenal homeobox 1 (PDX-1), insulin, and Glut2 genes. SREBP-1 small interfering RNA also prevented an increase in insulin secretion and insulin content induced by T0901317. Moreover, 5-(tetradecyloxy)-2-furoic acid, an inhibitor of the SREBP-1 target gene acetyl-coenzyme A carboxylase, blocked T0901317-induced stimulation of insulin secretion. In conclusion, activation of LXRß in pancreatic ß-cells increases insulin secretion and insulin mRNA expression via SREBP-1-regulated pathway. These data support the role of LXRß, SREBP-1, and cataplerosis/anaplerosis pathways in the control of insulin secretion in pancreatic ß-cells. | Introduction |
|---|
|
|
|---|
Liver X receptors (LXR), members of a nuclear receptor superfamily of ligand-activated transcription factors, serve as intracellular sensors in regulation of lipid homeostasis. Activated by oxysterols, products of cholesterol metabolism, LXR activates a transcription program leading to the transport of excessive cholesterol from peripheral tissues to liver and conversion of cholesterol to bile acids (4). LXR
is expressed in a number of metabolically active tissues, such as liver, adipose, intestine, and macrophages, whereas LXRß is ubiquitously expressed. Major LXR target genes involved in cholesterol metabolism are ATP-binding cassette transporter A1 (ABCA1) and ATP-binding cassette transporter G1 (ABCG1), transporting cholesterol out of the cells; apolipoprotein E and cholesterol ester transfer protein, promoting transport of cholesterol into blood and its uptake by liver; as well as cytochrome P450 family 7A1 (CYP7A1), converting cholesterol into bile acids in liver (4, 5).
In addition to regulation of cholesterol metabolism, LXR promotes synthesis of triglycerides and fatty acids via induction of sterol regulatory element-binding protein 1 (SREBP-1) (6). SREBP-1 orchestrates expression of enzymes crucial for synthesis of FFA, triglyceride, and phospholipids. Two forms for SREBP-1 are derived from the same gene as a result of the use of alternative promoters and different splicing (7). SREBP-1a activates expression of genes involved in both cholesterol and fatty acid metabolism, whereas SREBP-1c is more specific in stimulation of fatty acid synthesis. SREBP-1c-responsive genes involved in fatty acid synthesis are ATP citrate lyase (ACL), acetyl-coenzyme A (CoA) carboxylase (ACC), fatty acid synthase (FAS), steroyl-CoA desaturase, and glycerol-3-phosphate acyltransferase. SREBP-1 is synthesized as a transmembrane protein residing in the endoplasmic reticulum membrane. To reach the nucleus and regulate transcription, SREBP-1 needs to be transported from endoplasmic reticulum to Golgi, where it is cleaved by the consecutive action of two proteases and then released for translocation into the nucleus (6).
Recently, it was shown that LXR is involved in regulation of glucose metabolism. Synthetic LXR agonists, T0901317 and GW3965, lower blood glucose levels and improve insulin sensitivity in db/db, ob/ob, and high-fat-diet-fed mice as well as Zucker diabetic fatty and fa/fa rats (8, 9, 10). Normalization of plasma glucose with LXR agonists can be achieved through a number of mechanisms. LXR activation inhibits hepatic gluconeogenesis via down-regulation of the expression of peroxisome proliferator-activated receptor-
coactivator-1
, phosphoenolpyruvate carboxykinase, and glucose-6-phosphatase (8, 9). Inhibition of gluconeogenic genes with LXR agonists is complemented by up-regulation of glucokinase (GK) expression leading to the elevation in hepatic glucose uptake (9). In adipose tissue, activation of LXR induces expression of the insulin-sensitive glucose transporter 4 and promotes glucose utilization (9, 11). Moreover, LXR agonists inhibit expression and activity of 11ß-hydroxysteroid dehydrogenase type 1 and may improve insulin resistance by decreasing the local concentration of active glucocorticoids (12). Alleviation of insulin resistance with LXR ligands in liver and adipose tissues is likely to be mediated via LXR
(11, 13, 14).
LXR activation may normalize plasma glucose levels in diabetic animals not only via improvements in insulin sensitivity but also via increases in insulin secretion. We have recently shown that human and rodent pancreatic islets express both LXR
and LXRß isoforms (15). T0901317 promotes glucose-dependent insulin secretion and insulin biosynthesis in rat islets and insulin-secreting cells (15), whereas islets from LXRß knockout mice (LXRß/) displayed lack of glucose-induced insulin secretion and increased lipid accumulation (14). Moreover, LXRß/ mice are glucose intolerant and develop diabetes when kept on a high-fat diet because of impaired insulin secretion (14, 16). Unfortunately, the molecular mechanisms underlying LXR-induced insulin secretion and insulin biosynthesis as well as the relative contribution of LXR
vs. LXRß isoform in the regulation of insulin secretion by LXR agonists remain currently unclear. In this study, we have characterized LXR expression in isolated pancreatic ß-cells and focused on the elucidation of molecular mechanisms, by which LXR influences insulin production and secretion.
| Materials and Methods |
|---|
|
|
|---|
Preparation of islets and cell culture
Intact pancreatic islets were isolated from 4-month-old male LXRß/ and age-matched control mice (C57BL/129OlaHsd) as previously described (17). Isolated islets were cultured in RPMI 1640 medium (Invitrogen, Carlsbad, CA) supplemented with 10% (vol/vol) heat-inactivated fetal calf serum (Sigma-Aldrich), 100 IU/ml penicillin, and 100 µg/ml streptomycin (Invitrogen). INS-1E cells (passages 5570) were cultured in RPMI 1640 medium with L-glutamine, 1 mM sodium pyruvate, 10 mm HEPES, 5% heat-inactivated fetal calf serum, 50 µM 2-mercaptoethanol, 10,000 IU/ml penicillin, and 10,000 µg/ml streptomycin as described (18). Incubation of INS-1E cells with T0901317 and TOFA was performed in the culture medium. Compounds were added as dimethylsulfoxide (DMSO) stock solutions and vehicle control group contained up to 0.1% DMSO.
Measurements of insulin secretion and insulin content
Islets were first incubated for 30 min in Earles balanced salt solution (EBSS) (Invitrogen) supplemented with 0.1% BSA and 3 mM glucose. Groups of three islets of similar size were then selected and transferred into 48-well plates containing 0.3 ml EBSS with 0.1% BSA and test compounds. Islets were additionally cultured for 1 h, and supernatant was collected for insulin measurements. To measure insulin secretion in INS-1E cells, cells were seeded in 96-well plates at a density 25,000 cells per well and cultured for 3 d. When indicated, T0901317 and TOFA were added to the culture medium. Then cells were washed with EBSS, preincubated for 30 min with 0.2 ml/well EBSS containing 0.1% BSA and further incubated in 0.2 ml/well EBSS containing 0.1% BSA and test compounds. Supernatant was collected for insulin measurements. For determination of insulin content, islets and INS-1E cells were subjected to overnight incubation in a lysis buffer containing 75% ethanol, 23.5% water, and 1.5% HCl. Insulin was measured with ELISA.
Determination of cell viability, death, and proliferation
Cell viability in INS-1E cells was determined by a colorimetric assay using a tetrazolium compound 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) (Promega, Madison, WI) (19). The dye reagent was added to cells and incubated for 4 h, and then absorbance at 490 nm was recorded. Apoptosis was measured with the Cell Death ELISA Plus assay according to the manufacturers instructions (Roche Applied Science, Basel, Switzerland). The cytokine mixture used to induce cell death consisted of 20 ng/ml IL-1ß and 40 ng/ml TNF-
. Cell proliferation in INS-1E cells was assessed with the Cell Proliferation ELISA BrdU assay according to the manufacturers instructions (Roche Applied Science).
Total RNA extraction and RT
Total RNA was extracted using the RNEasy Micro Kit (QIAGEN, Hilden, Germany) according to the manufacturers instructions. In brief, islets or INS-1E cells were disrupted in a buffer containing guanidine isothiocyanate and homogenized by vortexing for 1 min. RNA was then selectively bound by a silica-gel membrane, contaminants were washed away, DNA was digested via column DNase treatment (RNase-Free DNase Set; QIAGEN), and total RNA was eluted in RNase-free water. The concentration and quality of the RNA preparations were checked by spectrophotometry. Two hundred nanograms of RNA were reverse transcribed in a 50-µl reaction mixture using the high-capacity cDNA archive kit (Applied Biosystems, Darmstadt, Germany) according to the manufacturers instructions.
Real-time quantitative PCR
Real-time RT-PCR was performed using the ABI prism 7900 HS sequence detection system (Applied Biosystems) based on the 5'-nuclease assay (20). The PCR for each mRNA was performed in quadruple on cDNA samples in an ABI PRISM 384-well optical reaction plate (Applied Biosystems). A master mixture for each quadruple was set up in a total reaction volume of 30 µl with 5 µl cDNA (in a 1:5 dilution), 15 µl 2x TaqMan Universal Master Mix, No AmpErase UNG (Applied Biosystems), 5 µl of diethylpyrocarbonate-treated water (Ambion Ltd., Huntingdon, UK), and 1.5 µl 20x primer/probe set (Assay-on-Demand Assay Mix; Applied Biosystems). From this mixture, an aliquot of 5 µl was placed in each of the four wells. The thermal cycling conditions were 95 C for 10 min and then 40 cycles of 95 C for 15 sec and 60 C for 1 min. Relative expression was calculated by normalization to 36B4 mRNA by 
Ct method (21). Assay-on-Demand numbers for individual genes are available on request.
Immunoblotting
Membrane and nuclear protein fractions of INS-1E cells were obtained using ProteoExtract subcellular proteome extraction kit (Calbiochem, EMD Biosciences, La Jolla, CA) according to the manufacturers instructions. The protein amount in the samples was measured with Bradford reagent (Sigma-Aldrich). Samples with equal amounts of protein were separated by SDS-PAGE, transferred to polyvinylidine difluoride (PVDF) membrane, and probed with the antibodies against SREBP-1 (Santa Cruz Biotechnology, Santa Cruz, CA), actin (Sigma-Aldrich), and lamin B (Abcam Plc, Cambridge, UK).
Transfection
For transfection with small interfering RNA (siRNA), INS-1E cells were plated in 96-well plates at a density 25,000 cells per well. The next day, cells were transfected with SREBP-1 siRNA in OPTI-MEM with 5 µg/ml Lipofectamine 2000 (Invitrogen). The final siRNA concentration was 100 nM. Efficiency of transfection was approximately 50% as assessed with a fluorescein-labeled RNA probe. After 6 h of transfection, T0901317 or DMSO was added to the culture medium. Cells were cultured for an additional 48 h before expression or functional studies were performed. Target sequence for rat SREBP-1 siRNA was AAGTACACAGGAGGCCATCTT, and target sequence for control nonsilencing siRNA (mock) was AATTCTCCGAACGTGTCACGT (QIAGEN).
Statistical analysis
Results are presented as mean values ± SEM for the indicated number of experiments. Statistical significance was evaluated using Students t test for pairs of data, Dunnetts test for multiple comparisons with a control, and Tukeys test when multiple comparisons between groups were required.
| Results |
|---|
|
|
|---|
|
and LXRß (22). We have previously shown that pancreatic islets express LXR
and LXRß (15). To evaluate whether a specific subtype of LXR is involved in the stimulation of insulin secretion in ß-cells, we measured LXR
and LXRß mRNA expression with a quantitative RT-PCR approach. Isolated rat pancreatic islets expressed higher amounts of LXRß compared with LXR
(Fig. 2
-cells), which have been purified using fluorescence-activated cell sorting (FACS) as described (23). Pancreatic non-ß-cells expressed both subtypes of LXR (Fig. 2
levels (P < 0.05). On the contrary, FACS-purified ß-cells did not express LXR
but expressed only LXRß isoform. Similar to purified primary ß-cells, RT-PCR in INS-1E cells detected the expression of only LXRß mRNA. The expression of LXR subtypes in pancreatic ß-cells was different from LXR mRNA expression in hepatocytes, where LXR
was predominant (Fig. 2
|
, and HNF4
transcription factors as well as UCP2 did not significantly change (Fig. 3A
|
mRNA in islets from the knockout mice (data not shown). Reduction of expression of PDX-1 and Ins2 genes observed in LXRß/ mice confirms the critical role of LXRß in the maintenance and regulation of expression of the genes essential for ß-cell function.
LXRß/ mice display glucose intolerance and develop diabetes when fed a high-fat diet (14, 16). Disturbances in glucose metabolism in these animals result from the impairments in insulin secretion. We have measured insulin secretion in islets isolated from LXRß/ mice (Fig. 4A
) (16). Compared with islets from control animals, LXRß/ islets secreted significantly less insulin under basal conditions (70% of control at 3 mM glucose). Moreover, insulin secretion in response to high glucose (17 mm) and depolarizing potassium (30 mM) was severely impaired in LXRß/ islets, whereas glucagon-like peptide 1 (GLP-1) (50 nM) could partially restore insulin secretion in LXRß/ islets (Fig. 4A
). Islets from LXRß/ mice displayed also a decrease in insulin content (Fig. 4B
). After normalization of insulin secretion by insulin content in islets from different groups, insulin secretion in LXRß/ islets was still significantly impaired, when measured under conditions of high glucose, high KCl, and GLP-1: 23, 41, and 71% of secretion in wild-type islets, respectively.
|
|
Next we used a SREBP-1-specific siRNA to examine the role of the SREBP-1 pathway in LXRß-mediated activation of insulin production and secretion. Transfection of INS-1E cells with the SREBP-1 siRNA produced approximately 70% inhibition of T0901317-induced SREBP-1 protein expression (Fig. 5B
). SREBP-1 down-regulation in the siRNA-transfected cells was also confirmed with quantitative RT-PCR (Fig. 6A
). Cells with inhibited SREBP-1 expression displayed lower basal expression of Ins2, PDX-1, and Glut2 genes, with the strongest down-regulation observed for Ins2 (50% inhibition). Moreover, siRNA treatment blunted the T0901317-induced expression of Ins2, PDX-1, and Glut2 genes, implying the essential role of SREBP-1 in the LXRß regulation of expression of these genes. Interestingly, inhibition of SREBP-1 did not influence GK expression, suggesting an SREBP-1-independent mechanism for LXRß regulation of GK expression, which could be mediated via retinoid X receptors (30).
|
Our data on the role of SREBP-1 in LXRß-induced insulin biosynthesis and secretion are consistent with the current view on cataplerosis/anaplerosis as one of the pathways mediating nutrient-induced insulin secretion (25, 26). In this pathway, Krebs cycle intermediates leave mitochondria and are further metabolized to produce cytosolic reduced nicotinamide adenine dinucleotide phosphate or get converted into acetyl-CoA by ACL and, subsequently, malonyl-CoA by ACC. Malonyl-CoA inhibits fatty acid oxidation and serves as a substrate for generation of acyl-CoAs, which, in turn, promote insulin secretion (31). Both ACL and ACC are SREBP-1 target genes (32, 33). To confirm our data obtained with SREBP-1 siRNA, we examined the effects of the ACC inhibitor TOFA (34) on insulin secretion and insulin content. INS-1E cells have been cultured for 72 h with 2 µg/ml TOFA and then challenged with glucose and KCl. Culture of cells for 72 h with TOFA alone or in combination with T0901317 did not influence cell viability measured with the MTS assay (data not shown). Incubation of cells with TOFA produced a slight inhibition of glucose- and KCl-induced insulin secretion as well as insulin content (Fig. 7
, A and B). TOFA completely blocked T0901317-mediated increases in insulin secretion measured at 2 and 11 mM glucose (Fig. 7A
). The inhibitor also significantly reduced increase in insulin content induced by T0901317 (Fig. 7B
). Data with TOFA confirm the involvement of SREBP-1 signaling pathway in LXR-induced increase in insulin secretion.
|
| Discussion |
|---|
|
|
|---|
Mechanisms of nutrient-stimulated insulin secretion in ß-cells are fairly well characterized. A raise in the ATP/ADP ratio is considered to be a major signal coupling an increase in the rate of nutrient metabolism with the elevation in cytosolic free Ca2+ and, eventually, in insulin secretion (35). In addition to the classical pathway, Ca2+-independent mechanisms mediating stimulation of glucose-induced insulin secretion have been demonstrated and may involve cataplerosis/anaplerosis (25, 35). In ß-cells, up to 50% of glucose-derived carbon enters the Krebs cycle via pyruvate carboxylation, implying that similar amounts of carbon should leave mitochondria without being oxidized (25). Krebs cycle intermediates, which leave mitochondria, can be used via a number of pathways, one of which being the production of acetyl-CoA and then malonyl-CoA by subsequent reactions of ACL and ACC (3, 25). Malonyl-CoA is further used for de novo synthesis of fatty acids and lipids (lipogenesis) or accumulates in the cytosol, where it decreases oxidation of fatty acids and increases accumulation of long-chain acyl-CoA. Production of lipid-containing molecules, in turn, promotes insulin exocytosis by not well defined mechanisms (31). Numerous lines of evidence characterize this pathway as essential for glucose-induced insulin secretion in ß-cells. Acute exposure to glucose induces parallel elevations in cytosolic citrate, malate, malonyl-CoA, and insulin secretion (26). Long-term exposure to high glucose produces concomitant increases in insulin secretion and expression of ACL, ACC, and FAS (27). Inhibition of pyruvate carboxylase (PC) or ACC decreases glucose-induced insulin secretion (26, 36). And finally, overexpression of malonyl-CoA decarboxylase decreases malonyl-CoA levels and reduces insulin secretion (37). The results of this study suggest that one of the mechanisms for LXRß-induced insulin secretion is SREBP-1-mediated activation of cataplerosis in pancreatic ß-cells. Indeed, ACL, ACC, and FAS are all target genes of SREBP-1, and we have shown previously that LXR activation resulted in increases in PC activity as well as ACC and FAS protein levels (15). Moreover, pharmacological agents interfering with the cataplerosis pathway, such as phenylacetic acid (15) and TOFA, blunted LXR-promoted insulin secretion.
Importantly, in addition to activation of the cataplerosis pathway, SREBP-1 is involved in LXRß-induced up-regulation of PDX-1 expression. PDX-1 is a key regulator of insulin gene expression and is critical for the endocrine pancreas development and maintenance of the ß-cell phenotype and ß-cell mass (24, 38). Disruption of PDX-1 in ß-cells results in progression of diabetes in aged animals as well as reduction in insulin and Glut2 expression (39). Mice containing only half the amount of PDX-1 display glucose intolerance and increased rate of ß-cell apoptosis (39, 40). Transcriptional regulation of PDX-1 expression is rather complex and involves interaction of a number of transcription factors at the PDX-1 promoter (24). Here we propose SREBP-1 as an additional player in the regulation of PDX-1 transcription.
PDX-1 is a major transactivator of the insulin gene and mediates glucose-induced up-regulation of insulin expression (24). Induction of PDX-1 expression by SREBP-1 may suggest that the increase in insulin mRNA observed upon LXRß stimulation is mediated through the increase in PDX-1 expression. However, recently it was demonstrated that SREBP-1 can activate the insulin gene expression by binding to three sterol response elements on the insulin gene promoter as well as by serving as coactivator for BETA2/E47 (41). Interestingly, the cited study showed that SREBP-1 and PDX-1 play a redundant role in controlling insulin gene expression with SREBP-1 being more efficacious under conditions of low PDX-1. The relative contributions of direct vs. indirect effects of SREBP-1 on insulin gene transcription remain to be explored.
In the natural development of type 2 diabetes, the ß-cell passes through at least two stages: enhanced insulin secretion (hyperinsulinemia) to keep plasma glucose close to normal in the face of insulin resistance and ß-cell dysfunction at later stages of disease progression, when raised glucose and lipid levels induce ß-cell damage. Activation of SREBP-1c by elevated glucose has been implicated in the development of ß-cell dysfunction. Islets from diabetic animals display increased levels of SREBP-1 (42). Moreover, overexpression of constitutively active nuclear SREBP-1c leads to a dramatic lipid deposition, decreased glucose oxidation, and impaired glucose-induced insulin secretion (28, 43, 44, 45, 46). In contrast to overexpression studies, induction of SREBP-1 with LXRß did not impair ß-cell function within the time limits used in the current study. One of the possible explanations for the opposite effects of SREBP-1 activation is differences in the levels of active nuclear SREBP-1 as well as in the duration of SREBP-1 activation produced by the two approaches. Contrary to forced nuclear SREBP-1 overexpression, LXRß activation produces nuclear SREBP-1 in a regulated and controlled manner at milder levels close to those induced by hyperglycemia. Thus, our data together with the studies mentioned above (28, 43, 44, 45, 46) suggest that the effects of SREBP-1 induction on ß-cell function can be biphasic. Initially, mild SREBP-1 induction by hyperglycemia can be important for up-regulation of insulin secretion to adapt to the increased demand for insulin at the insulin-resistance state. However, long-term and strong SREBP-1 activation would eventually lead to ß-cell toxicity via increased lipid accumulation.
Recent data point to the plausible role of SREBP-1 in the initial adaptation of ß-cell response to insulin resistance. Islets from insulin-resistant Zucker fatty rats display elevated insulin secretion and glucose utilization as a result of the increased glucose flux through PC and activation of the anaplerosis pathway (47). Moreover, islets from SREBP-1 knockout mice fail to raise insulin secretion in respond to high-glucose treatment (48). The mechanisms of SREBP-1 induction under hyperglycemia in ß-cells have not been studied yet. Potentially, LXRß could be involved in this process and, thereby, in the adaptation response of the ß-cell to insulin resistance.
| Acknowledgments |
|---|
| Footnotes |
|---|
Disclosure Statement: W.W. and K.B. have nothing to declare; H.Z., M.B.B., S.S.,and A.E.M. hold stock in Eli Lilly; and J.G. holds stock in Novartis, Eli Lilly, and Novo Nordisk.
First Published Online April 27, 2006
Abbreviations: ACC, Acetyl-coenzyme A carboxylase; ACL, ATP citrate lyase; CoA, coenzyme A; DMSO, dimethylsulfoxide; EBSS, Earles balanced salt solution; FACS, fluorescence-activated cell sorting; FAS, fatty acid synthase; FFA, free fatty acids; GK glucokinase; GLP-1, glucagon-like peptide 1; Glut2, glucose transporter 2; Ins2, insulin gene 2; LXR, liver X receptor; LXRß/, LXRß knockout mice; MTS, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; PC, pyruvate carboxylase; PDX-1, pancreatic duodenal homeobox 1; siRNA, small interfering RNA; SREBP-1, sterol regulatory element-binding protein 1; TOFA, 5-(tetradecyloxy)-2-furoic acid.
Received November 22, 2005.
Accepted for publication April 14, 2006.
| References |
|---|
|
|
|---|
. J Biol Chem 278:4828348291
. Cell Metab 1:297308[CrossRef][Medline]
CT method. Methods 25:402408[CrossRef][Medline]This article has been cited by other articles:
![]() |
C. D. Green, D. B. Jump, and L. K. Olson Elevated Insulin Secretion from Liver X Receptor-Activated Pancreatic {beta}-Cells Involves Increased de Novo Lipid Synthesis and Triacylglyceride Turnover Endocrinology, June 1, 2009; 150(6): 2637 - 2645. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Diraison, M. A. Ravier, S. K. Richards, R. M. Smith, H. Shimano, and G. A. Rutter SREBP1 is required for the induction by glucose of pancreatic {beta}-cell genes involved in glucose sensing J. Lipid Res., April 1, 2008; 49(4): 814 - 822. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Choe, A H. Choi, J.-W. Lee, K. H. Kim, J.-J. Chung, J. Park, K.-M. Lee, K.-G. Park, I.-K. Lee, and J. B. Kim Chronic Activation of Liver X Receptor Induces {beta}-Cell Apoptosis Through Hyperactivation of Lipogenesis: Liver X Receptor-Mediated Lipotoxicity in Pancreatic {beta}-Cells Diabetes, June 1, 2007; 56(6): 1534 - 1543. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chen, P. B. Jeppesen, I. Nordentoft, and K. Hermansen Stevioside improves pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA carboxylase Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1906 - E1916. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Wente, M. B. Brenner, H. Zitzer, J. Gromada, and A. M. Efanov Activation of Liver X Receptors and Retinoid X Receptors Induces Growth Arrest and Apoptosis in Insulin-Secreting Cells Endocrinology, April 1, 2007; 148(4): 1843 - 1849. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |