help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1070
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
148/1/103    most recent
Author Manuscript (PDF)
Right arrow Purchase Article
Right arrow View Shopping Cart
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Baudet, M.-L.
Right arrow Articles by Harvey, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Baudet, M.-L.
Right arrow Articles by Harvey, S.
Endocrinology Vol. 148, No. 1 103-115
Copyright © 2007 by The Endocrine Society

Expression, Translation, and Localization of a Novel, Small Growth Hormone Variant

M.-L. Baudet, B. Martin, Z. Hassanali, E. Parker, E. J. Sanders and S. Harvey

Department of Physiology, University of Alberta, Edmonton, Alberta, Canada T6G 2H7

Address all correspondence and requests for reprints to: S. Harvey, Department of Physiology, 7-55 Medical Sciences Building, University of Alberta, Edmonton, Alberta, Canada T6G 2H7. E-mail: steve.harvey{at}ualberta.ca.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A novel transcript of the GH gene has been identified in ocular tissues of chick embryos. It is, however, unknown whether this transcript (small chicken GH, scGH) is translated. This possibility was therefore assessed. The expression of scGH mRNA was confirmed by RT-PCR, using primers that amplified a 426-bp cDNA of its coding sequence. This cDNA was inserted into an expression plasmid to transfect HEK 293 cells, and its translation was shown by specific scGH immunoreactivity in extracts of these cells. This immunoreactivity was directed against the unique N terminus of scGH and was associated with a protein of 16 kDa, comparable with its predicted size. Most of the immunoreactivity detected was, however, associated with a 31-kDa moiety, suggesting scGH is normally dimerized. Neither protein was, however, present in media of the transfected HEK cells, consistent with scGH’s lack of a signal sequence. Similar moieties of 16 and 31 kDa were also found in proteins extracted from ocular tissues (neural retina, pigmented epithelium, lens, cornea, choroid) of embryos, although they were not consistently present in vitreous humor. Specific scGH immunoreactivity was also detected in these tissues by immunocytochemistry but not in axons in the optic fiber layer or the optic nerve head, which were immunoreactive for full-length GH. In summary, we have established that scGH expression and translation occurs in ocular tissues of chick embryos, in which its localization in the neural retina and the optic nerve head is distinct from that of the full-length protein.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN HIGHER VERTEBRATES, the GH gene is comprised of five exons (1, 2, 3, 4, 5) and four introns (A–D). Full-length GH mRNA is formed from the five spliced exons and is translated into a 22-kDa protein (1). Alternative exon splicing does, however, result in a heterogeneity of GH transcripts (2). A 45-bp deletion at the 5' end of exon 3 is, for instance, present in the GH mRNA from human (3, 4) and rat (5) pituitary glands, and the resulting transcript codes for a 20-kDa protein. Alternative splicing within exon 3, at a different site, similarly results in a transcript with a 73-bp deletion (6). Similar variants are also present in GH mRNA (hGH-V) in the human placenta and testis (7, 8, 9). Alternative splicing of GH mRNA in the placenta results in a transcript with a 4-bp deletion at the end of exon 4 and codes for a different protein (hGH-V3) (7, 8, 9, 10, 11). Human GH (hGH) mRNA may also have deletion of exon 3, deletions of exons 3 and 4, or deletions of exons 2, 3, and 4 (12, 13). An exon 3-deleted GH variant has also shown to be translated in vitro (13).

Other GH variants have also been described that result from intron retentions. For instance, an intron D retaining variant is present in human (13) and bovine (14) pituitary glands. The retention of this intron results in a shift in the reading frame and is likely to produce an isohormone with a C terminus that differs from that in full-length GH (14). As this isoform exists in polysomes (14), it is likely to be translated. Similarly hGH-V mRNA retains intron D and likely encodes a 26-kDa protein with a different C terminus to 22-kDa hGH-V (4, 10).

Another GH transcript has also been identified in mRNA from the eye and heart of embryonic chicks (15). This transcript is not, however, the product of alternative splicing per se but the product of an alternate promoter. This novel transcript, small chicken GH (scGH) (15), is severely truncated in that it lacks exons 1–3 of the full-length chicken GH gene and retains part of intron C. If translated, it is thought to code for a 16.5-kDa protein.

Besides pituitary 20-kDa GH, no GH variants have, however, been clearly shown to be translated and/or to have biological activities. As Takeuchi et al. (15) provided no evidence for the presence of scGH in chick embryos, the possible translation of this novel transcript was investigated in the present study.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissues
Since Takeuchi et al. (15) identified scGH mRNA in the eye and heart of early embryos by 5' rapid amplification of cDNA ends, whole eyes, the dissected neural retina (NR), the heart, and the heartless bodies of chick embryos at embryonic day (ED) 7 of the 21-d incubation period were rapidly fixed for immunohistochemistry or placed into RNA later for subsequent RNA extraction (Ambion, Austin, TX). For comparison, whole pituitary glands from slaughterhouse fowl were similarly collected.

RT-PCR
Total RNA was extracted from tissues using RNeasy mini- or midikits (QIAGEN, Burlington, Ontario, Canada) and mRNA obtained using Oligotex mRNA minikits (QIAGEN). Total RNA (0.1–5 µg) or mRNA (0.165 µg) were reverse transcribed (for 50 min at 50 C) into cDNA using 10 U/µl SuperScript III RNase H, 0.025 µg/µl oligo (dT)12–18 or 0.1 µg/µl anchored oligo (dT)20, 5 mM dithiothreitol, 1x first-strand buffer and 1 mM each deoxynucleotide triphosphates (dNTPs) (all from Invitrogen, Burlington, Ontario, Canada). RNA templates were digested (20 min at 37 C) using RNase H, and cDNA was amplified with 0.1 U/µl platinum Taq DNA polymerase high fidelity, 2 mM MgSO4, 1x high-fidelity PCR buffer, 0.2 mM each dNTPs (all from Invitrogen) in the presence of 0.2 µM each forward and reverse oligonucleotide primers designed to amplify a 426-bp fragment covering the entire coding sequence of scGH mRNA (forward primer, scGH-F3: 5'-ggcatgcagcagcactgcag-3'; reverse primer, scGH-R2: 5'-agagagcaactgcaccatctga-3') (Fig. 1AGo). The primers were designed using OligoPerfect software (Invitrogen) and synthesized by Sigma Genosys (Oakville, Ontario, Canada). The initial denaturation was at 94 C for 2 min and was followed by 38 cycles of PCR (94 C for 30 sec, annealing at 60 C for 30 sec, extension at 68 C for 30 sec) and a final extension for 10 min. PCR products were visualized on 0.4 µg/ml ethidium bromide gels.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
FIG. 1. A, Schematic representation of scGH exons that transcribe 569-bp scGH mRNA, in comparison with intron C and exons 4 and 5 of the full-length chicken GH gene. The 426-bp coding region of the transcript can be amplified by RT-PCR using the oligonucleotide primer set scGH-F3 and scGH-R2. B, Schematic representation of the scGH-expressing plasmid. The PCR product of the scGH coding sequence is inserted into a pcDNA3.1/V5-His-TOPO plasmid vector. The expression of scGH is driven by a cytomegalovirus promoter and is terminated at the bovine GH polyadenylation sequence (BGH pA). Because scGH coding sequence encodes for a stop codon (stop), the V5 epitope and polyhistidine tag (V5/His) are not translated. C, Schematic representation of the 20 N-terminal amino acids coded by exon 1 of scGH. D, The complete amino acid sequence of the full-length cGH protein (GeneBank AAQ 81586.1) is shown. Amino acids that are homologous to those in scGH (GeneBank BAB 62262.1) are shown in bold.

 
Cloning
Each PCR fragment was gel extracted using QiaQuick gel extraction kits (QIAGEN). Extracted PCR products (4 µl) were then ligated with 10 ng pCR-II TOPO vector (Invitrogen) in 1.2 µmol NaCl and 0.06 µmol MgCl2 (5 min at room temperature). Then 2 µl of this solution were mixed with One Shot TOP10 (Invitrogen) chemically competent cells and incubated (30 min on ice). The transformed cells were then heat shocked (42 C for 30 sec) and incubated (37 C for 1 h) with SOC medium (2% tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose). The transformed cells were then streaked on Luria Bertani (LB) [1% tryptone, 0.5% yeast extract, 1% NaCl (pH 7.0)] agar (15 g/liter) plates that had been coated with 1.6 mg X-gal (Rose Scientific, Edmonton, Alberta, Canada) containing ampicillin (100 µg/ml) or kanamycin (50 µg/ml). The streaked plates were then incubated (37 C, overnight) to obtain individual colonies. Six colonies were selected and grown (37 C overnight) in 20 ml LB medium containing ampicillin (100 µg/ml) or kanamycin (50 µg/ml). Plasmids were then extracted using QiaPrep spin miniprep kits (QIAGEN). The ligation of the PCR products was checked by gel electrophoresis of 1 µg plasmid after digestion with 20 U EcoR1 restriction endonuclease, in 1x EcoRI buffer (New England Biolabs, Pickering, Ontario, Canada) and its orientation verified after amplification of 0.1 µg plasmid in a PCR (0.02 U/µl platinum Taq DNA polymerase, 2 mM MgCl2, 1x PCR buffer, 0.2 mM each dNTPs, in the presence of 0.2 µM each forward scGH-F3 and reverse [M13F (–20), gtaaaacgacggccagt] primers. The PCR consisted of 2 min of denaturation at 94 C and then 38 cycles of denaturation (94 C for 30 sec), annealing (60 C for 30 sec), and extension (72 C for 30 sec), followed by a final period (10 min) of extension (at 72 C).

Sequencing
Gel-extracted plasmids were sequenced commercially (Macrogen Inc., Seoul, Korea).

scGH expression
Plasmid synthesis.
scGH cDNA was obtained from whole eyes of ED 7 embryos, as described above. The PCR fragment was gel extracted and 4 µl of the pure product was ligated (5 min at room temperature) to 10 ng pcDNA 3.1/V5-His TOPO TA Vector (Invitrogen) in 1.2 µmol NaCl and 0.06 µmol MgCl2. As the last three bases of the reverse primer correspond to a stop codon, the V5 epitope and polyhistidine tag are not expressed. The plasmid was then transfected and subcloned, as described above. Ampicillin LB plates and medium was used to grow colonies. The ligation and orientation was validated by PCR analysis, using forward T7 (taatacgactcactataggg) and reverse scGH-R2 primers. One hundred percent homology with the published sequence of scGH (15) was found.

Expression.
The scGH expression plasmid (Fig. 1BGo) was transfected into human embryonic kidney (HEK) 293 cells (kindly donated by Dr. J. R. Casey, Department of Physiology, University of Alberta, Edmonton, Canada), using lipofectamine 2000 (Invitrogen). In brief, HEK 293 cells were cultured onto 10 µg/ml poly-D-lysine (Sigma) coated 24 wells. After a 24-h incubation period (37 C, 5% CO2), transfection was performed; 1.6 µg of expression plasmid and 4 µl of lipofectamine 2000 were mixed with Opti-MEM I, according to manufacturer’s instructions, and then the complex was added to each well containing cells at 85% confluence in 500 µl DMEM (catalog no. 11960), 5% fetal bovine serum, 5% calf serum, 2 mM L-glutamine (all Invitrogen), without antibiotics. After a 48-h culture, the cells and medium were collected separately. Cells were scraped from the wells, centrifuged (200 x g, 5 min) to remove any residual medium and then lysed by sonication in 100 µl of a protease inhibitor cocktail (Roche Applied Science, Laval, Québec, Canada). The medium was similarly centrifuged twice (200 x g, 5 min) to remove any contaminating cells and the cell-free medium was concentrated 25-fold using a centrifugal filter unit (Amicon ultra-15; Millipore, Cambridge, Ontario, Canada). Protein content in the media and lysates were determined by the Bio-Rad method (Bio-Rad Laboratories, Mississauga, Ontario, Canada), and aliquots of the samples were analyzed by Western blotting.

scGH antisera
The unique N terminus of scGH, encoded by the nucleotides derived from intron C of the full-length GH gene (Fig. 1CGo), was synthesized commercially (Washington Biotechnology Inc., Columbia, MD) (to > 96% purity). This 20-amino acid peptide (MQQHCRTPHLHSSEIPLSFQ) was conjugated with keyhole limpet hemocyanin and the conjugate was then used to raise antisera in New Zealand White Rabbits (Washington Biotechnology). Three months after initial immunization and 10 d after the last of three booster injections of the conjugate, terminal blood samples were collected from the rabbits and serum was stored at –80 C. The titer of the antiserum (SH-1) was determined by ELISA (Washington Biotechnology) using the unconjugated peptide as the ligand. At 50% inhibition of binding, unpurified serum had a titer of approximately 1:8000 (Fig. 2Go).


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 2. Dilution curve for SH-1 determined by calorimetric ELISA (Washington Biochemicals). The scGH antibody (in a volume of 100 µl) was incubated for 60 min at room temperature with unconjugated N-terminal scGH (at 2 µg/ml), which was absorbed to the wells of a microtiter plate. After aspiration, a goat antirabbit antibody conjugated to horseradish peroxidase was added to the wells and incubated for 60 min. After aspiration and washing, an enzyme substrate, 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid), was added to each well, and the color developed after 30 min was measured at 405 nm.

 
Western blotting
Tissues were collected into a protease inhibitor solution [HEPES, MgCl2, EDTA, EGTA, aprotinin, leupeptin and pepstatin in 1% (wt/vol) phenylmethylsulfonylfluoride] and homogenized. After centrifugation and protein determination by the Bradford dye-binding procedure (Bio-Rad Laboratories), the supernatants were stored at –20 C before Western analysis. Samples (containing 20–100 µg protein) were analyzed by one-dimensional SDS-PAGE (16). The samples were added to loading buffer [10% (wt/vol) glycerol, 0.5% (wt/vol) 2-ß-mercaptoethanol, 2% sodium dodecyl sulfate, 0.001% (wt/vol) bromphenolblue (pH 6.8)] and denatured at 100 C for 4 min and the proteins separated by electrophoresis in 12% gels. After electrophoresis, the proteins were equilibrated in transfer buffer [25 mM Tris, 192 mM glycine, 20% (wt/vol) methanol) and transferred electrophoretically (100 V for 1 h at 4 C] to nitrocellulose paper (Bio-Rad Laboratories). After transfer, nonspecific binding sites were blocked with 5% (wt/vol) nonfat dry milk in Tris-buffered saline [20 mM Tris HCl, 0.5 M NaCl (pH 7.6)], containing Tween 20 for 1 h at room temperature. scGH immunoreactivity was detected using SH-1, diluted 1:1000 in Tris-buffered saline/5% (wt/vol) nonfat dry milk. After an overnight incubation at room temperature, the membranes were washed with Tris-buffered saline containing Tween 20 (3 x 10 min) and then incubated for 1 h at room temperature with a biotinylated goat antirabbit IgG (Vector Laboratories, Burlingame, CA; 1:5000). Antibody binding was then visualized using avidin biotin complex (ABC) reagents (Vector Laboratories) 1 h at room temperature, and after washing, the blots were developed with an enhanced chemiluminescence detection system (enhanced chemiluminescence kit, Amersham, Piscataway, NJ) and exposed to X-AR film (Kodak, Rochester, NY). The specificity of labeling was determined by preincubating (3 h at room temperature) the primary antibody with excess (100 µg/ml) N-terminal scGH (Washington Biotechnology) or purified chicken pituitary GH [National Hormone and Peptide Program (NHPP), Torrance, CA; 100 µg/ml]. Preimmune rabbit serum [normal rabbit serum (NRS)] was also used as a negative control.

Immunocytochemistry
Fixation.
Tissues were fixed in freshly prepared Carnoy’s fixative (60% ethanol, 30% chloroform, 10% glacial acetic acid) overnight at 4 C. They were then washed in PBS (2 x 15 min) and dehydrated in a graded series of ethanol (50%, 2 x 15 min; 70%, 30 min; 95%, 30 min; 100%, 2 x 30 min) and cleared with Hemo-De (Fisher Scientific, Edmonton, Alberta, Canada, NJ) for 30 min. Tissues were then infiltrated with paraffin wax overnight at 60 C under normal atmospheric pressure. Serial transverse (6 µM) sections were taken using a microtome and mounted onto charged slides (Fisher Scientific).

Bright-field microscopy
Immunocytochemical staining was performed with commercial reagents (Vector Laboratories) using the ABC method (17). Sections were cleared in Hemo-De (2 x 5 min), rehydrated in a graded series ethanol (100%, 2 x 5 min; 95%, 2 min; 70%, 2 min; 50%, 2 min; distilled water, 2 min), equilibrated in PBS (2 min), and then incubated in H2O2 (1% in 50% methanol) to block endogenous peroxidase. The sections were washed in PBS (3 x 5 min) and then incubated in PBS containing 10% normal goat serum (Sigma Chemical Co., Oakville, Ontario, Canada) and 0.4% Tween 20 for 1 h. The slides were subsequently incubated overnight at 4 C with the scGH antibody (SH-1), diluted 1:4000 in 1% goat serum. After incubation, the slides were washed (3 x 5 min) in PBS and incubated for 1 h at room temperature in biotinylated goat antirabbit IgG (Sigma; 1:500). The slides were then washed in PBS (3 x 5 min) and incubated in ABC reagent for 1 h at room temperature and washed again. Staining was visualized using the chromogenic substrate diaminobenzidine tetrahydrochloride (Sigma), which resulted in a brown coloration. For comparison adjacent sections were also stained using a specific polyclonal antibody raised in rabbits against native chicken (c) GH ({alpha}cGH-1) (18), diluted 1:1000 in PBS. Preabsorption of the primary antibodies, using excess (100 µg/ml) N-terminal scGH (Washington Biotechnology) or purified cGH (NHPP) provided negative controls. Other controls included the omission of the secondary antibody and the replacement of the primary antibodies with PBS.

Confocal microscopy
The sections were similarly dehydrated, blocked with 10% normal goat serum (in PBS containing 0.4% Tween 20) for 1 h and incubated overnight at 4 C with the primary antibodies (SH-1 at 1:4000; {alpha}cGH-1 at 1:1000) for the colocalization of scGH and cGH, respectively. An anti-islet 1 mouse monoclonal antibody (39.4D5, undiluted; Developmental Studies Hybridoma Bank, University of Iowa, Ames, IA) was also used for the localization of retinal ganglion cells (RGCs) (16). Glial progenitor cells were labeled using a monoclonal antibody against vimentin (H5, at 1:20 dilution; Developmental Studies Hybridoma Bank, University of Iowa) (19, 20). A mouse monoclonal antibody against chick neurofilament-associated antigen (3A10, at 1:500 dilution; Developmental Studies hybridoma Bank, University of Iowa) was also used to detect neural fibers (21, 22). The possibility that scGH might be localized within the nucleolus of RGCs was also examined using a specific marker (SYTO RNA Select; Invitrogen; at 500 mM in PBS dilution) (23). After incubation with the rabbit antibodies, the sections were incubated for 1 h at room temperature in goat antirabbit IgG conjugated to Alexa Fluor 488 [F(ab')2 fragment; Invitrogen] at a dilution of 1:500. The sections were then washed (3 x 10 min) and mounted with Gel mount (Biomeda, Foster City, CA). For colocalization studies with monoclonal antibodies, an additional 1-h incubation was performed before mounting with goat antimouse IgG conjugated to Alexa Fluor 555 [F(ab')2 fragment; Invitrogen] at a dilution of 1:500, followed by PBS washes (3 x 5 min). The labeled sections were examined using a LSM 510 confocal microscope (Carl Zeiss, Gottingen, Germany) equipped with appropriate lasers.

RGC immunopanning
RGC immunopanning.
To confirm the presence of scGH in RGCs, these were isolated by an immunopanning technique, using a monoclonal antibody to the chick Thy-1 antigen (24). Immunopanning substrata were prepared by incubating coverslips with 50 µg/ml goat antimouse IgG in sterile Tris buffer (pH 9.5) for 12 h at 4 C. Coverslips were washed three times with 0.25% BSA in PBS and incubated with 55 µg/ml antichick Thy-1 antibody (gift of Dr. P. L. Jeffrey, University of Sydney, Sydney, Australia) for 2 h at room temperature. Coverslips were then washed three times with PBS, blocked with 0.25% BSA in PBS for 15 min at room temperature, and then washed again three times with PBS.

Retinas from four embryos at ED 8 were dissected and placed in an Eppendorf tube in calcium- and magnesium-free Tyrode’s solution. The tissue was centrifuged and 600 µl of 0.1% trypsin (Sigma; T-4977) were added to the tube at 37 C for 10 min. Inactivation of the trypsin was accomplished by adding fetal bovine serum (FBS; Invitrogen; 16000-036) to a final concentration of 10%, together with 1% BSA, and the mixture was gently pipetted to dissociate the cells. Ten units of DNase I (Sigma; D-5025) were added, and the cells were centrifuged at 15,000 rpm for 2 min. The pellet was washed with 10% FBS in Tyrode’s solution and the cells were centrifuged again. The supernatant was then removed and the cells were resuspended in Medium 199 (Invitrogen) with 10% FBS and gentamicin. The cell suspension was incubated on anti-Thy-1-coated coverslips for 1.5 h at room temperature. The coverslips were washed five times with Tyrode’s solution to remove nonadherent cells. We have previously shown than more than 90% of the adherent cells resulting from this procedure are RGCs (24, 25).

For immunocytochemistry, the adherent cells were first dislodged from the anti-Thy-1-coated coverslips and replated on coverslips coated with poly-L-lysine (Sigma; P-4832) in petri dishes (26). Cells were released from the anti-Thy-1 coating by incubating them with 2.5% trypsin (Sigma; T-9935) in Earle’s balanced salt solution, containing bicarbonate and phenol red but without calcium and magnesium (Sigma; E-6267) for 10 min at 37 C. The trypsin was then inactivated by adding 1 ml Medium 199 containing 30% FBS, and the cells were removed from the coverslip using fine jets of medium from a pulled pipette. When all the cells had been removed, the suspension was transferred to an Eppendorf tube containing 100 µl of 100% FBS. The cell suspension was then centrifuged at 15,000 rpm for 2 min, the supernatant was discarded, and the resulting pellet was resuspended in Medium 199 containing 30% FBS. This suspension was placed in drops onto coverslips coated with polylysine. Coverslips bearing the cultures were washed with warm Medium 199 and fixed with 4% phosphate buffered paraformaldehyde. Cultures were then permeabilized with acetone at –20 C, and nonspecific immunoreactivity was blocked with 4% BSA in PBS. The cells were then labeled with the scGH antiserum and mounted in Vectashield (Vector Laboratories). Negative controls were carried out by replacing the scGH antibody with NRS. The labeled cells were examined using a Zeiss LSM 510 confocal microscope equipped with appropriate lasers.

scGH Immunoneutralization
The possibility that scGH in immunopanned RGCs might have local actions in cell survival, similar to the antiapoptotic actions of full-length cGH (24, 25), was investigated by its immunoneutralization. Immunopanned RGCs were resuspended in 150 µl Medium 199 containing 30% FBS. This suspension was placed in drops onto coverslips coated with polylysine in petri dishes and incubated in a humid chamber overnight at 37 C in the presence or absence of the scGH antiserum at a final dilution of 1:100.

Apoptosis in the RGC-enriched cultures was assessed as before (24, 25) by labeling cells with 4', 6-diamidino-2-phenylindole (DAPI; Molecular Probes, Eugene, OR) to show shrunken and fragmented apoptotic nuclei and counting the number of apoptotic nuclei in random microscope fields of nine control and nine experimental cultures. Statistical differences in the data were determined by Student’s t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
RT-PCR
In the presence of oligonucleotide primers scGH-F3 and scGH-R2, a 426-bp cDNA of expected length was amplified from reverse-transcribed mRNA extracted from the whole eye and heart of ED 7 embryos (Fig. 3AGo). This fragment was also amplified from reverse-transcribed mRNA from the heartless bodies of these embryos and the dissected NR of ED 7 eyes (Fig. 3AGo). When amplified with scGH-F3 and scGH-R2, this 426-bp fragment was also abundantly generated from reverse-transcribed mRNA from the pituitaries of slaughterhouse fowl (Fig. 3AGo). In contrast, this fragment was not amplified from any tissue when mRNA was used as the template or in nontemplate controls, in which DNA was replaced by RNase/DNase-free water (Fig. 3AGo). When sequenced (Fig. 3BGo), each amplicon had 100% homology to the published coding sequence for scGH (15).


Figure 3
View larger version (42K):
[in this window]
[in a new window]

 
FIG. 3. A, scGH mRNA detection by RT-PCR. Using the oligonucleotide primers scGH-F3 and scGH-R2, an ethidium bromide-stained 426-bp fragment was amplified from reverse-transcribed total mRNA extracted from the whole eye, heart, heartless body, and NR of ED 7 chick embryos and the anterior pituitary glands (Pit) of slaughterhouse chickens. No signal was detected in negative controls (–) or in nontemplate controls, in which cDNA was replaced with RNase/DNase-free water. B, Each amplified cDNA was sequenced (Query) and had 100% homology with the published scGH sequence [Takeuchi et al. (15 )].

 
scGH Western blotting
Western blotting of proteins extracted from the whole retina [NR and the retinal pigmented epithelium (RPE)] using the scGH antibody (SH-1) detected immunoreactivity associated with a protein of 31 kDa and, to a lesser extent, a protein of 16 kDa (Fig. 4Go). Another protein of approximately 29 kDa was also detected with weaker immunoreactivity (Fig. 4Go). Similar immunoreactive bands of 31 kDa were detected (Fig. 5AGo) in proteins from the whole eye (lane 1), NR (lane 2), RPE (lane 3), cornea (lane 5), and lens (lane 6), although not in some samples of vitreous humor (Fig. 5AGo, lane 4). When the blots were overexposed (Fig. 5BGo), immunoreactivity for a 16-kDa protein was also present in all ocular tissues. The scGH immunoreactivity in the whole eye and the NR was completely lost after the preabsorption of the primary antibody with excess N-terminal scGH (Fig. 5AGo, lane 7, and Fig 5BGo, lane 6). In addition to ocular tissues, scGH immunoreactivity was also detected in the pituitary glands of slaughterhouse chickens, in which proteins of 31 kDa (Figs. 5BGo, lane 5, and 6AGo, lane l), and 16 kDa (Fig. 5BGo, lane 5) were readily detected.


Figure 4
View larger version (56K):
[in this window]
[in a new window]

 
FIG. 4. Western blotting of proteins extracted from whole retina of ED 7 chick embryos. Most of the immunoreactivity detected was associated with a 31 kDa protein, although proteins of 16 and 29 kDa were also immunoreactive. Figure is representative of at least six retinal extracts.

 

Figure 5
View larger version (74K):
[in this window]
[in a new window]

 
FIG. 5. A and B, Western blotting with the scGH antibody of proteins extracted from the whole eye, NR, RPE, vitreous, cornea, and lens of ED 7 chick embryos and from the anterior pituitary glands of slaughterhouse chickens. In A the blots were developed after an exposure period of 15 sec, whereas in B the exposure period was 2 min. The scGH immunoreactivity in the whole eye (A, lane 7) and NR (B, lane 6) was completely lost after the preabsorption of the primary antibody with excess N-terminal scGH. Twenty micrograms of protein were loaded in each lane. Figure is representative of at least four similar blots.

 

Figure 6
View larger version (58K):
[in this window]
[in a new window]

 
FIG. 6. A, Western blotting with the scGH antibody of proteins extracted from the choroid (lane 2), RPE (lane 3), NR (lane 4), vitreous (lane 5), and lens (lane 6) of ED 7 chick embryos, in comparison with proteins extracted from the anterior pituitary glands of slaughterhouse chickens (lane 1) (20 µg protein loaded in each lane). A negative control, using NRS rather than the primary antibody is shown in lane 7. B, Western blotting of the same tissue extracts with an antibody raised against native chicken pituitary GH, which primarily detects a 25-kDa moiety in the pituitary gland (lane 1, 1 µg protein). C, Western blotting with the scGH antibody of proteins extracted from the NR of ED 7 chick embryos (lanes 1, 3, and 5; 20 µg/lane) in comparison with purified chicken pituitary GH (lanes 2, 4, and 6; 10 µg/lane). In lanes 3 and 4, the primary antibody was preabsorbed with an excess of native pituitary GH (100 µg/ml for 2 h at room temperature) before use, whereas in lanes 5 and 6, the primary antibody was preabsorbed with an excess of N-terminal scGH (100 µg/ml for 2 h at room temperature) before use. Figure is representative of at least three similar blots.

 
This 31-kDa protein was similarly detected in different samples of the pituitary, RPE, NR, and lens (Fig. 6AGo, lanes 1, 3, 4, and 6) and was additionally present in the choroid (Fig. 6AGo, lane 2) and a different sample of vitreous (Fig. 6AGo, lane 5). This protein was not, however, detected when the same ocular tissue extracts were probed with NRS (Fig. 6AGo, lane 7) or the antibody raised against pituitary GH ({alpha}cGH-1), which detected a moiety of approximately 25 kDa in the RPE, vitreous, and lens (Fig. 6BGo, lanes 3, 5, and 6). This protein is the most abundant GH moiety in the pituitary gland (Fig. 6BGo, lane 1), although smaller proteins, including 15- and 16-kDa moieties, were additionally detected in pituitary extracts (Fig. 6BGo, lane 1) and the choroid, RPE, NR, and lens (Fig. 6BGo, lanes 2, 3, 4, and 6). Interestingly, whereas a 15-kDa moiety in the vitreous was immunoreactive with {alpha}cGH-1 (Fig. 6BGo, lane 5), the 16-kDa moiety was not detected in vitreous humor (Fig. 6BGo, lane 5). Proteins of 15 and 25 kDa are therefore specifically labeled by {alpha}cGH-1, whereas SH-1 specifically detects a 31-kDa moiety and, when the blots are overexposed, a 16-kDa protein. The differential specificity of these antisera is also shown in Fig. 6CGo, in which the scGH antibody does not detect the full-length (25 kDa) GH protein. Moreover, preincubation of the scGH antibody with excess cGH (100 µg/ml) does not impair its labeling of the 31-kDa protein in the NR of ED 7 chick embryo eyes, which is completely blocked when the antibody is preabsorbed with excess (100 µg/ml) N-terminal scGH.

The specificity of the scGH antibody is also demonstrated by its ability to label N-terminal scGH applied to 8% acrylamide gels (Fig. 7AGo, lanes 1 and 2), although under the conditions used, the apparent molecular size of this peptide (<5 kDa) could not be determined accurately. This immunoreactivity was completely lost after the preabsorption of the scGH antibody with excess (100 µg/ml) N-terminal scGH (Fig. 7AGo, lane 5). Figure 7Go also shows translation of the scGH transcript in HEK cells transfected with the scGH expression plasmid because 31 and 16 kDa scGH-immunoreactivity is present in lysates of these cells (Fig. 7AGo, lane 3). The scGH immunoreactivity of both of these proteins was completely lost when the scGH antibody was preabsorbed with excess N-terminal scGH (Fig. 7AGo, lane 6). In contrast with the cell lysates, scGH immunoreactivity was not seen in the medium in which the transfected HEK cells were cultured (Fig. 7AGo, lane 4). Figure 7BGo also shows that the scGH immunoreactivity in lysates of the transfected HEK cells (lane2) was identical in size to that in the NR of ED 7 embryos (lane 2).


Figure 7
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 7. A, Western blotting with the scGH antibody of proteins expressed in HEK 293 cells transfected with the scGH-expressing plasmid (lane 3) in comparison with proteins present in the incubation medium (lane 4). The specificity of the antiserum is shown by its ability to detect N-terminal scGH (10 µg/ml, lane 1; and 5 µg/ml, lane 2) and the complete loss of immunoreactivity when the antiserum was preabsorbed with N-terminal scGH (100 µg/ml for 2 h at room temperature) before use (lanes 5 and 6). B, Western blotting with the scGH antibody of proteins expressed in HEK 293 cells transfected with the scGH expressing plasmid (lane 2) in comparison with proteins present in an extract of the NR of ED 8 chick embryos (lane 1).

 
Immunocytochemistry
ED 7 chick eye.
scGH immunoreactivity was readily detectable in the anterior eye (Fig. 8AGo), notably in the cytoplasm of cells in the corneal epithelium (Fig. 8Go, C, E, and F), the developing ciliary body (Fig. 8Go A), and the lens epithelium (Fig. 8Go, D, G, and H). This immunoreactivity was lost when the primary antibody was preabsorbed with excess N-terminal scGH (Fig. 8BGo) or replaced with NRS (Fig. 8IGo).


Figure 8
View larger version (73K):
[in this window]
[in a new window]

 
FIG. 8. scGH immunocytochemistry of the anterior eye of ED 7 chick embryos. A, Bright-field microscopy of scGH immunoreactivity (brown staining) in the cornea (front of the lens), lens epithelium, and ciliary body (CB). Magnification, x400). B, The specificity of this staining is shown using the same antibody after it had been preabsorbed with excess N-terminal scGH (100 g/ml for 2 h at room temperature). Only the pigmented NR is visible after preabsorption. Magnification, x400. C, scGH immunoreactivity in the inner and outer epithelial layers of the cornea. Magnification, x1000. D, scGH immunoreactivity in the lens epithelium. Magnification, x1000. Fluorescence microscopy of scGH immunoreactivity in the cytoplasm of cells (arrows) in the corneal epithelium [magnification, x400 (E), x1800 (F)] and lens epithelium [magnification, x400 (F), x1800 (G)]. No signal is present when the primary antibody is replaced with NRS [magnification, x400 (I)]. Figure is representative of similar sections from at least five embryos.

 
scGH immunoreactivity was also present at the back of the eye (Fig. 9AGo), particularly in the NR in which it was widespread, but also in the endothelium of blood vessels in the choroid (Fig. 9BGo). It was not, however, present in the optic fiber layer (OFL) or the optic nerve head (ONH) (Fig. 9Go, A–C). The specificity of the staining in the NR is indicated by its absence when the primary antibody was replaced with NRS (Fig. 9DGo). As expected (16), immunoreactivity for full-length GH was present in the NR but primarily in the OFL (Fig. 9Go, E and F), comprised of axons from underlying RGCs. This immunoreactivity was also intense in the ONH (Fig. 9Go, F and G), in which axons from the RGC’s fasciculate to form the optic nerve. The absence of scGH immunoreactivity in the OFL was clearly shown by confocal microscopy with a neurofilament antibody (Fig. 10Go). Neurofilaments were abundantly present in the fibers comprising the OFL (Fig. 10BGo), and confocal imaging demonstrated that scGH (Fig. 10AGo) and neurofilaments were not colocalized in this structure (Fig. 10CGo). Confocal microscopy localized scGH immunoreactivity within the nucleus and cytoplasm of cells in the NR (Fig. 10Go, A and E). Some of these cells were identified as RGCs, using a RGC nuclear marker (39.4D5) (Fig. 10FGo). The localization of scGH in the nucleus of RGCs was indicated by the resulting yellow orange coloration (Fig. 10GGo). Staining within the nuclei of many RGCs indicated the presence of scGH immunoreactivity in a discrete nuclear organelle This organelle was not the nucleolus because scGH immunoreactivity was not colocalized with a nucleolus-specific marker (data not shown). The specificity of staining for scGH and the RGC marker was shown by the absence of fluorescence in NRS-treated control sections (Fig. 10Go, D and H). The presence of scGH immunoreactivity in the cytoplasm and nucleus of RGCs was also demonstrated by the labeling of Thy-1 immunopanned ED 8 RGCs (Fig. 11AGo), whereas NRS controls had no specific fluorescence (Fig. 11BGo).


Figure 9
View larger version (66K):
[in this window]
[in a new window]

 
FIG. 9. scGH immunocytochemistry of the posterior eye of ED 7 chick embryos. A–C, Bright-field microscopy of diffuse scGH immunoreactivity (brown staining) in the NR. Note the absence of staining in the OFL (A–C) and ONH (C). scGH immunoreactivity is also present in endothelial cells of blood vessels in the choroid (arrows) (A and B). D, A control section treated with NRS to show the specificity of staining. Immunoreactivity for native (full-length) pituitary GH is also shown for comparison (E–G). Note the intense labeling of the OFL (E and F) and ONH (F and G) (magnification, x100 in each case).

 

Figure 10
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 10. Confocal microscopy of scGH immunoreactivity in the NR of ED 7 chick embryos. A, scGH immunoreactivity (arrows) is seen in the cytoplasm of cells in the retinal ganglion cell layer (RGCL). No scGH immunoreactivity is present in the OFL. Staining for neurofilament immunoreactivity is shown (B) and is confined to the OFL. The image overlay (C) clearly shows that scGH immunoreactivity and neurofilament immunoreactivity are discrete. The specificity of detection is shown in a control, NRS section (D). The immunoreactivity for scGH in the NR (E) is also compared with immunoreactivity for a RGC marker (F). The yellow orange coloration in the image overlay (G) demonstrates the presence of scGH in RGC cytoplasm and nuclei. The specificity of detection is shown in a control NRS-treated section (H). Bars, 20 µm.

 

Figure 11
View larger version (6K):
[in this window]
[in a new window]

 
FIG. 11. A, scGH immunoreactivity in the cytoplasm and nuclei of cultured Thy-1 immunopanned RGCs in comparison with controls treated with NRS (B).

 
Fluorescence microscopy of the ONH clearly showed the presence of full-length GH immunoreactivity in discrete fiber tracts (Fig. 12BGo), which lacked scGH immunoreactivity (Fig. 12AGo). This finding was confirmed by the observation that scGH immunoreactivity in the ONH (Fig. 12CGo) was not colocalized in the fiber tracts (Fig. 12EGo) that were strongly immunoreactive for the neurofilament antibody (Fig. 12DGo). Control sections treated with NRS had no fluorescence (Fig. 12FGo). Transverse sections through the ONH (Fig. 13Go) demonstrated scGH fluorescence in concentric tissue layers of the sheath surrounding the optic nerve (Fig. 13AGo), which was immunoreactive for neurofilament (Fig. 13BGo). Confocal imaging clearly showed that the immunoreactivity for scGH was largely confined to this sheath and not present in the ensheathed nerve (Fig. 13CGo). In similar sections, the scGH immunoreactivity detected (Fig. 13EGo) was in cells that were also stained with the vimentin antibody (Fig 13FGo), as revealed by the yellow orange coloration in these presumptive progenitor glial cells when the images were overlaid (Fig. 13GGo). Control sections (Fig. 13Go, D and H) treated with NRS showed no fluorescence.


Figure 12
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 12. A, scGH immunoreactivity in the ONH and NR of ED 7 chick embryos in comparison with immunoreactivity for native pituitary (full length) GH (B). scGH immunoreactive cells are indicated by arrows (C). Confocal labeling of scGH immunoreactivity in the ONH and NR in comparison with neurofilament labeling (D) is shown. The overlay (E) indicates that the neurofilament fibers have little scGH immunoreactivity. A NRS control (F) is shown for comparison. Bars, 50 µm.

 

Figure 13
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 13. A and E, scGH immunoreactivity in a transverse section of the optic nerve (ON), compared with neurofilament immunoreactivity (B) and vimentin immunoreactivity (F). Confocal imaging demonstrates that most of the scGH immunoreactivity is not colocalized with neurofilament (C), although scGH and vimentin are colocalized (G). NRS controls are shown for comparison (D and H). Bars, 50 µm.

 
In extraocular tissues, scGH immunoreactivity was also abundant in the anterior pituitary gland of slaughterhouse chickens, in which it was present in both the caudal and cephalic lobes (Fig. 14Go, A and D). In marked contrast, immunoreactivity for full-length GH was, as expected, predominantly located in the caudal lobe (Fig. 14CGo).


Figure 14
View larger version (41K):
[in this window]
[in a new window]

 
FIG. 14. A, scGH immunoreactivity in the caudal (Ca) and cephalic (Ce) (D) lobes of the chicken pituitary gland in comparison with immunoreactivity for native pituitary (full-length) GH in caudal (B) and cephalic (E) lobes. C and F, NRS controls for the caudal and cephalic lobes, respectively. Bars, 20 µm.

 
In preliminary studies, the immunoneutralization of endogenous scGH in immunopanned RGCs increased (P < 0.05) the number of DAPI-labeled apoptotic nuclei in comparison with untreated controls (Fig. 15Go).


Figure 15
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 15. Immunoneutralization of scGH increases cell death in immunopanned RGCs. RGC cultures were incubated overnight at 37 C in the presence (solid bar) or absence (open bar) of a scGH antibody at a final dilution of 1:100. Apoptotic cells were identified by DAPI labeling. Means ± SEM (n = 9). The asterisk indicates that the difference between the groups is significantly different, P < 0.05.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These results confirm the presence of a novel scGH transcript in the heart and eyes of embryonic chicks, in agreement with Takeuchi et al. (15), and show that it is particularly abundant in the NR. We also show that it is expressed in the pituitary glands of 6- to 7-wk old (slaughterhouse) birds. This transcript is therefore expressed in tissues that also express the full-length GH gene (16, 27, 28).

The cGH gene has only one TATA box, in the 5' untranslated region, and scGH transcription starts downstream of this, within intron C of the full-length cGH gene. It is therefore likely that scGH transcription is initiated by a different promoter to that regulating the transcription of the full-length gene. This possibility is supported by the presence of four different transcription initiator elements (tcagtccc, tactttt, tcacaccc, tcatattc) in intron C, upstream of the scGH transcription start site (15). This possibility has yet to be assessed, but it would be a novel discovery because only one promoter has previously been associated with GH gene transcription (29). An alternative TATA-less promoter located within a downstream intron that induces the transcription of 5' truncated (hCATL B) variant has, however, been discovered for the human cathepsin L gene (30). Similarly, ptd-FGFR4 is a truncated isoform of the fibroblast growth factor receptor 4 gene, which is transcribed by an alternate TATA box-containing promoter located within its intron 5 (31). Alternate promoters within intron sequences have also been described for the human sodium bicarbonate cotransporter-1 gene (32) and the human {alpha}-fetoprotein gene (33).

Our finding of scGH mRNA in the NR suggests that it is a source of scGH in ocular tissues. In contrast, Takeuchi et al. (15) could not detect this transcript in dissected ocular tissues (choroid, NR, pigmented retinal epithelium, sclera, recten, lens, vitreous body, iris, ciliary body, and cornea) and therefore hypothesized that the scGH mRNA they detected in the whole eye was derived from nonocular tissues, such as peripheral blood cells or extraocular muscle. This difference may, however, reflect our use of a different oligonucleotide primer set for PCR.

Expression of the scGH transcript was achieved in HEK-transfected cells, as demonstrated by the presence of scGH immunoreactivity in cell lysates. Most of the scGH immunoreactivity detected was associated with a protein of approximately 31 kDa, although a protein of approximately 16 kDa was also present. The predicted size of scGH is 16.5 kDa (15), which strongly suggests that monomer scGH is predominantly dimerized by bonds that are resistant to sodium dodecyl sulfate and ß-mercaptoethanol disruption. It is therefore of interest that a 45-kDa dimer of 22-kDa GH has been described that is held together by interchain disulfide bonds that are exceptionally resistant to reducing agents and thus confers extreme stability to the homodimer (34). Similar bonds may hold the scGH homodimer together because scGH retains the four cysteine residues of monomeric (25 kDa) cGH (at positions 5, 113, 130, and 138 of scGH), which also exists in sodium dodecyl sulfate- and ß-mercaptoethanol-resistant dimerized isoforms of pituitary GHs (35).

Dimerization through the linkage of intermolecular cysteine residues by disulfide bonds is thought to protect GH from proteolytic degradation, without impairing its ability to bind membrane GH receptors (GHRs) (34). Although scGH lacks many of the residues thought to be required for binding to membrane GHRs, it is predicted to have the same C-terminal sequence and secondary structure as full-length GH (15) and may bind to the chicken GHR. This possibility is supported by the presence of GH immunoreactivity in the chicken eye with the molecular size of a putative scGH-GH binding protein complex (15). The possibility that scGH has biological activity is also supported by our preliminary studies that show that endogenous scGH immunoneutralization in cultured RGCs promotes cell death, similar to that induced by the immunoneutralization of the full-length molecule (24, 25). Functional studies on the roles of scGH are, however, precluded by the current unavailability of the purified protein.

Although scGH immunoreactivity was present in the lysates of scGH-transfected HEK cells, it was not present in the incubation medium. This is consistent with the lack of a signal peptide in the predicted scGH sequence (15), indicating that it is not a secreted protein. Furthermore, the hydropathy profile of scGH indicates it has a hydrophilic N terminus that is also unlikely to serve as a signal peptide (15). If it has biological activity, it must therefore act as an intracrine within the cytosol or within nuclear compartments. It is therefore relevant that in the third helical domain of scGH, leucine residues are arranged every seven amino acids, which is a characteristic of leucine zipper transcription factors with nuclear action (15).

In contrast to ocular tissues, 31 kDa scGH immunoreactivity was mostly absent from vitreous humor. This further indicates that it is not a secretory protein. Its presence in some samples of vitreous likely reflects its cellular compartment and contamination with cells from the retina, lens, cornea, or ciliary body. The absence of scGH in the vitreous humor contrasts with the abundance of immunoreactivity detected by the antibody raised against native pituitary GH (16, 18). This immunoreactivity detected by {alpha}cGH-1 is associated with monomer (25 kDa) GH and with a 15-kDa moiety, which is likely to be a proteolytic fragment (36). It is also of interest that this antibody did not detect the 16-kDa moiety in vitreous humor that was detected in other ocular tissues and the pituitary gland. This finding is consistent with previous observations (16, 18), which led to speculation that this 16-kDa moiety might be scGH. However, because {alpha}cGH-1 does not detect a 31-kDa protein, which is likely to be dimerized scGH and more abundant than monomer scGH, the 16-kDa protein detected by this antibody is unlikely to be scGH.

The presence of scGH immunoreactivity in the transfected HEK cells demonstrates the translation of this novel GH transcript. The translation of this variant likely occurs in frame with the full-length monomer. The truncated GH variant has five atg (start) codons, of which four are in frame with full-length cGH. The other atg codon in the scGH sequence would encode a peptide of only 19 amino acids, much smaller in size than scGH and the proteins detected by Western blotting. Taken together, this suggests that scGH and cGH are translated in frame.

The translation of the variant was similarly demonstrated by the widespread presence of scGH immunoreactivity in ocular tissues of chick embryos. This is the first time the scGH protein has been localized because previous immunocytochemical studies have used specific antibodies against full-length chicken GH (16, 18) or rat GH (15). The antibody that we generated (SH-1) was instead directed against the unique N terminus of scGH, which is not present in any other protein in the National Center for Biotechnology Information protein database. The specificity of the antibody is also demonstrated by its inability to detect full-length chicken GH and the complete loss of immunological staining after the preincubation of the primary antibody with N-terminal scGH and its ability to detect the predicted 16.5-kDa protein.

Within the ED 7 eye, immunoreactivity for scGH was detected in the lens and corneal epithelium, presumptive ciliary body, and NR, particularly within RGCs. Immunoreactivity for full-length chicken GH is also present in these tissues, as previously reported using {alpha}cGH-1 as the primary antibody (16, 18). This suggests both GH transcripts are expressed and translated in these ocular tissues. However, whereas scGH immunoreactivity is clearly present in the RGCs of the NR, it was not present in RGC axons in the OFL or in the fiber tracts in the ONH. This is in marked contrast to the distribution of GH immunoreactivity detected by {alpha}cGH-1. This finding suggests the different GH moieties may undergo differential intracellular trafficking. This is of interest, especially because the absence of scGH in neural fibers further suggests it does not enter into secretory pathways for release from nerve terminals. This finding is therefore similar to the differential intracellular trafficking, secretion, and endosomal localization of two IL-15 isoforms (37), one of which (a truncated variant) remains in cytoplasm and is not secreted. The intracellular location and organelle association of scGH should therefore be further determined.

Within the retina, immunoreactivity for scGH was present in both the cytoplasmic and nuclear compartments of the RGCs. Indeed, it was particularly prominent within a nuclear subcompartment that was not labeled by the nuclear RGC marker or a marker of the nucleolus. The identity of this compartment and the role of scGH in the nucleus is, however, unknown. GH immunoreactivity has previously been localized in the nucleus of chick (16) and rat (38) RGCs, although full-length GH immunoreactivity in the embryonic chick RPE was thought to be primarily cytoplasmic (39). In other tissues, GH immunoreactivity has also been found in nuclear compartments, specifically in the nucleoplasm (in the eu-heterochromatin junction) as well as in the inner and outer nuclear membranes (40, 41, 42, 43). The presence of GH and scGH in the nucleus is consistent with their putative roles as intracrines and may reflect the nuclear localization of GHRs (40, 41, 43, 44) and nuclear GH-binding sites (45, 46). Although the sequence of scGH does not have a classical nuclear localization signal (as determined by PSORTII and Predict NLS software) (47, 48), it could enter the nucleus through passive diffusion because it is smaller than 50 kDa or bind to a chaperone protein that has a classical nuclear localization signal (49, 50).

In addition to the RGCs of the NR, scGH immunoreactivity was found in vimentin-labeled progenitor glial cells ensheathing the optic nerve. Immunoreactivity for full-length GH has not been detected in this tissue, which suggests GH gene transcription may undergo tissue-specific regulation within the embryonic chick eye. Similarly, in extraocular tissues, scGH mRNA and protein were detected in the adenohypophysis of slaughterhouse chickens. However, whereas full-length GH is confined to somatotrophs in the caudal lobe (16, 51, 52, 53), scGH immunoreactivity was abundantly present in both the caudal and cephalic lobes. scGH is unlikely to be secreted and therefore sequestered by cephalic lobe cells, which suggests that cell-specific regulation of GH gene transcription also occurs in the adenohypophysis. Cell-specific regulation of GH transcripts has similarly been seen for members of the hGH gene family in the pituitary gland, placenta, testis, and blood mononuclear cells (7, 10, 54), although it has yet to be described for any nonprimate species. This cell specificity may reflect cell-specific transcription factors like Pit-1 that regulate full-length GH gene expression (55), although specific factors that regulate scGH expression have yet to be determined. The demonstration of two, translated, GH transcripts in the avian hypophysis is therefore a highly novel and exciting finding.

In summary, these results demonstrate, for the first time, that the transcript for the small GH variant is translated and document its distribution within ocular and extraocular tissues of chick embryos.


    Footnotes
 
This work was supported by the National Science and Engineering Research Council (NSERC) of Canada. M.-L.B. is in receipt of Fu-Shiang Chia (University of Alberta) and Alberta Heritage Foundation for Medical Research Studentships. B.M. is in receipt of an NSERC studentship.

Disclosure Statement: The authors have nothing to disclose.

First Published Online September 28, 2006

Abbreviations: ABC, Avidin biotin complex; c, chicken; DAPI, 4', 6-diamidino-2-phenylindole; dNTP, deoxynucleotide triphosphate; ED, embryonic day; FBS, fetal bovine serum; GHR, GH receptor; HEK, human embryonic kidney; hGH, human GH; LB, Luria Bertani; NR, neural retina; NRS, normal rabbit serum; OFL, optic fiber layer; ONH, optic nerve head; RGC, retinal ganglion cell; RPE, retinal pigmented epithelium.

Received August 4, 2006.

Accepted for publication September 20, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Harvey S 1995 Growth hormone synthesis. In: Harvey S, Scanes CG, Daughday WH, eds. Growth hormone. Boca Raton, FL: CRC Press; 55–78
  2. Baumann G 1999 Growth hormone heterogeneity in human pituitary and plasma. Horm Res 51:2–6
  3. DeNoto FM, Moore DD, Goodman HM 1981 Human growth hormone DNA sequence and mRNA structure: possible alternative splicing. Nucleic Acids Res 9:3719–3730[Abstract/Free Full Text]
  4. Cooke NE, Ray J, Watson MA, Estes PA, Kuo BA, Liebhaber SA 1988 Human growth hormone gene and the highly homologous growth hormone variant gene display different splicing patterns. J Clin Invest 82:270–275[Medline]
  5. Howland DS, Farrington MA, Taylor WD, Hymer WC 1987 Alternative splicing model for the synthesis and secretion of the 20 kilodalton form of rat growth hormone. Biochem Biophys Res Commun 147:650–657[CrossRef][Medline]
  6. Hattori N, Kitagawa K, Inagaki C 1999 Human lymphocytes express hGH-N gene transcripts of 22kDa, 20 kDa and minor forms of GH, but not the hGH-V gene. Eur J Endocrionol 141:413–418
  7. Boguszewski CL, Svensson PS, Jansson T, Clark R, Carlsson LM, Carlsson B 1998 Cloning of two novel growth hormone transcripts expressed in human placenta. J Clin Endocrinol Metab 83:2878–2885[Abstract/Free Full Text]
  8. Berger P, Untergasser G, Hermann M, Hittmair A, Madersbacher S, Dirnhofer S 1999 The testis-specific expression pattern of the growth hormone/placental lactogen GH/PL gene cluster changes with malignancy. Hum Pathol 30:1201–1206[CrossRef][Medline]
  9. Cooke NW, Ray J, Emery JG, Liebhaber SA 1988 Two distinct species of human growth hormone-variant mRNA in the human placenta predict the expression of novel growth hormone proteins. J Biol Chem 263:9001–9006[Abstract/Free Full Text]
  10. Untergasser G, Kranewitter W, Schwarzler P, Madersbacher S, Dirnhofer S, Berger P 1997 Organ-specific expression pattern of the human growth hormone/placental lactogen gene-cluster in the testis. Mol Cell Endocrinol 130:53–60[CrossRef][Medline]
  11. Untergasser G, Hermann M, Rumpold H, Berger P 1998 Complex alternative splicing of the GH-V gene in the human testis. Eur J Endocrinol 139:424–427[Abstract]
  12. Lecomte CM, Renard A, Martial JA 1987 A new natural hGH variant—17.5 kd—produced by alternative splicing. An additional consensus sequence which might play a role in branchpoint selection. Nucleic Acids Res 15:6331–6348[Abstract/Free Full Text]
  13. Palmetshofer A, Zechner D, Luger TA, Barta A 1995 Splicing variants of the human growth hormone mRNA: detection in pituitary, mononuclear cells and dermal fibroblasts. Mol Cell Endocrinol 113:225–234[CrossRef][Medline]
  14. Hampson RK, Rottman FM 1987 Alternative processing of bovine growth hormone mRNA: nonsplicing of the final intron predicts a high molecular weight variant of bovine growth hormone. Proc Natl Acad Sci USA 84:2673–2677[Abstract/Free Full Text]
  15. Takeuchi S, Haneda M, Teshigawara K, Takahashi S 2001 Identification of a novel GH isoform: a possible link between GH and melanocortin systems in the developing chicken eye. Endocrinology 142:5158–5166[Abstract/Free Full Text]
  16. Baudet M-L, Sanders EJ, Harvey S 2003 Retinal growth hormone in the chick embryo. Endocrinology 144:5459–5468[Abstract/Free Full Text]
  17. Hsu SM, Raine L, Fanger H 1981 Use of avidin-biotin-peroxidase complex ABC in immunoperoxidase techniques: a comparison between ABC and unlabeled antibody PAP procedures. J Histochem Cytochem 29:577–580[Abstract]
  18. Harvey S, Kakebeeke M, Murphy AE, Sanders EJ 2003 Growth hormone in the nervous system: autocrine or paracrine roles in retinal function? Can J Physiol Pharmacol 81:371–384[CrossRef][Medline]
  19. Raff MC, Williams BP, Miller RH 1984 The in vitro differentiation of a bipotential glial progenitor. EMBO J 3:1857–1864[Medline]
  20. Winkler C, Fricker RA, Gates MA, Olsson M, Hammang JP, Carpenter MK, Bjorklund A 1996 Incorporation and glial differentiation of mouse EGF-responsive neural progenitor cells after transplantation into the embryonic rat brain. Mol Cell Neurosci 11:99–116
  21. Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington, Skarnes WC, Tessier-Lavigne M 1996 Netin-1 is required for commissural axon guidance in developing vertebrate nervous system. Cell 87:1001–1014[CrossRef][Medline]
  22. Perez S E, Rebelo S, Anderson DJ 1999 Early specification of sensory neuron fate revealed by expression and function of neurogenins in the chick embryo. Development 126:1715–1729[Abstract]
  23. Pandya S, Yu Y, Parker D 2006 Engineering emissive europium and terbium complexes for molecular imaging and sensing. Dalton Trans 2006:2757–2766[CrossRef]
  24. Sanders EJ, Parker E, Aramburo C, Harvey S 2005 Retinal growth hormone is an anti-apoptotic factor in embryonic retinal ganglion cell differentiation. Exp Eye Res 81:551–560[CrossRef][Medline]
  25. Sanders EJ, Parker E, Harvey S 2006 Retinal ganglion cells survival in development: mechanisms of retinal growth hormone action. Exp Eye Res 83:1205–1214[CrossRef][Medline]
  26. Brocco MA, Panzetta P 1999 Survival and process regrowth of purified chick retinal ganglion cells cultured in a growth factor lacking medium at low density. Modulation by extracellular matrix proteins. Brain Res Dev Brain Res 118:23–32[CrossRef][Medline]
  27. Harvey S, Johnson CD, Sanders EJ 2000 Extra-pituitary growth hormone in peripheral tissues of early chick embryos. J Endocrinol 166:489–502[Abstract]
  28. Harvey S, Johnson CD, Sanders EJ 2001 Growth hormone in neural tissues of the chick embryo. J Endocrinol 169:487–498[Abstract]
  29. Rohn WM, Weigent DA 1995 Cloning and nucleotide sequencing of rat lymphocyte growth hormone cDNA. Neuroimmunomodulation 2:108–114[CrossRef][Medline]
  30. Seth P, Mahajan VS, Chauhan SS 2003 Transcription of human cathepsin L mRNA species hCATL B from a novel alternative promoter in the first intron of its gene. Gene 321:83–91[CrossRef][Medline]
  31. Yu S, Asa SL, Weigel RJ, Ezzat S 2003 Pituitary tumor AP-2{alpha} recognizes a cryptic promoter in intron 4 of fibroblast growth factor receptor 4. J Biol Chem 278:19597–19602[Abstract/Free Full Text]
  32. Abuladze N, Song M, Pushkin A, Newman D, Lee I, Nicholas S, Kurtz I 2000 Structural organization of the human NBC1 gene: kNBC1 is transcribed from an alternative promoter in intron 3. Gene 251:109–122[CrossRef][Medline]
  33. Scohy S, Gabant P, Szpirer C, Szpirer J 2000 Identification of an enhancer and an alternative promoter in the first intron of the {alpha}-fetoprotein gene. Nucleic Acids Res 28:3743–3751[Abstract/Free Full Text]
  34. Grigorian AL, Bustamante JJ, Hernandez P, Martinez AO, Haro LS 2005 Extraordinarily stable disulfide-linked homodimer of human growth hormone. Protein Sci 14:902–913[Abstract/Free Full Text]
  35. Aramburo C, Luna M, Carranza M, Reyes M, Martinez-Coria H, Scanes CG 2000 Growth hormone size variants: changes in the pituitary during development of the chicken. Proc Soc Exp Biol Med 223:67–74[Abstract/Free Full Text]
  36. Aramburo C, Carranza M, Reyes M, Luna M, Martinez-Coria H, Berumen L, Scanes CG 2001 Characterization of a bioactive 15 kDa fragment produced by proteolytic cleavage of chicken growth hormone. Endocrine 15:231–240[CrossRef][Medline]
  37. Gaggero A, Azzarone B, Andrei C, Mishal Z, Meazza R, Zappia E, Rubartelli A, Ferrini S 1999 Differential intracellular trafficking, secretion and endosomal localization of two IL-15 isoforms. Eur J Immunol 29:1265–1274[CrossRef][Medline]
  38. Harvey S, Baudet M-L, Sanders EJ 2006 Retinal growth hormone in perinatal and adult rats. J Mol Neurosci 28:257–264[CrossRef][Medline]
  39. Harvey S, Kakebeeke M, Sanders EJ 2004 Growth hormone localization in the neural retina and retinal pigmented epithelium of embryonic chicks. J Mol Neurosci 22:139–145[CrossRef][Medline]
  40. Lobie PE, Mertani H, Morel G, Morales-Bustos O, Norstedt G, Waters MJ 1994 Receptor-mediated nuclear translocation of growth hormone. J Bio