| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Second Department of Internal Medicine (I.C., M.Sh., N.H., N.T.), Department of Clinical Pharmacology and Therapeutics (K.Y., S.U.), and Department of Pharmacology (T.M., K.N., M.Sa.), Faculty of Medicine, University of the Ryukyus, Okinawa 903-0215, Japan
Address all correspondence and requests for reprints to: Michio Shimabukuro, M.D., Second Department of Internal Medicine, Faculty of Medicine, University of the Ryukyus 207 Uehara, Nishihara, Okinawa 903-0215, Japan. E-mail: mshimabukuro-ur{at}umin.ac.jp or me447945{at}members.interq.or.jp.
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Although direct inhibitory effects of FFA on endothelial function have already been shown in humans (2, 3, 7), the mechanism by which FFA cause such inhibition has not been clear. Several in vitro studies reported that FFA can enhance production of reactive oxygen species (ROS) (8, 9), but a functional link of circulating FFA to endothelial function through ROS production has not been evaluated. It has been reported that 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statin) improve endothelial function and also reduce vascular superoxide production via inhibition of vascular NADPH oxidase activation (10, 11). Thus, statin might attenuate FFA-induced endothelial dysfunction via inhibition of vascular superoxide production.
In the present study, we examined 1) the role of FFA and the oxidases responsible for ROS production in vascular reactivity and 2) effects of statin on vascular ROS production in a rodent model of visceral fat obesity, Zucker diabetic fatty (ZDF) rat, which shows hyperphagia and obesity-related diabetes, dyslipidemia, and hypertension resulting from a loss-of-function mutation in the leptin receptor (12).
| Materials and Methods |
|---|
|
|
|---|
Biochemical measurements
Plasma glucose levels were measured by the glucose oxidase method with the Glucose Analyzer II (Beckman Coulter Inc., Fullerton, CA). Plasma insulin levels were assessed using an insulin ELISA kit. Serum levels of cholesterol and triglyceride, and FFA were measured using routine enzymatic assays. Plasma levels of lipid peroxidation were measured as thiobarbituric acid reactive substance (TBARS) using the LPO test (Wako Pure Chemical Industries, Osaka, Japan) (13). Plasma and urinary 8-epi-prostaglandin-F2
(8-epi-PGF2
) was extracted on C-18 SPE cartridges (Waters Corp., Milford, MA) and assayed by competitive immunoassay using a Cayman Chemical 8-epi-PGF2
EIA kit (Ann Arbor, MI) (13). Plasma levels of adiponectin (Otsuka Pharmaceutical Co., Ltd, Tokyo, Japan) and TNF-
(JIMRO Co., Ltd., Takasaki, Gunma, Japan) were measured by sandwich ELISA as previously described (3).
Vascular reactivity
After a midlaparotomy under pentobarbital sodium anesthesia, the aorta was rapidly excised for vascular reactivity measurements (14), and nonfasting blood samples were obtained from the inferior vena cava. A portion of aorta was frozen in liquid nitrogen and stored at 70 C. Fresh aorta were cleared of periadventitial tissue and cut transversely into rings 1.52.0 mm in diameter. Vascular rings, handled carefully to avoid damage to the inner surface, were mounted on wires in the chambers of a multivessel myograph (J.P. Trading, Tokyo, Japan) and bathed in Krebs buffer. The medium was gassed with 95% O2 and 5% CO2 and maintained at 37 C (pH 7.4). After equilibration (30 min), the rings were set to an isometric force-displacement transducer (TB-611T; Nihon Kohden, Tokyo, Japan) for measurement of changes in tension and allowed to stabilize for another 30 min. The rings were then depolarized with potassium chloride (60 mmol/liter) to evaluate maximal contraction. After washing with a Krebs buffer, the vascular preparations were contracted with phenylephrine (106 mol/liter), and when the contractile response was stabilized (steady-state phase, 15 min), vasorelaxing responses to cumulative increments in the concentration of acetylcholine or sodium nitroprusside were examined. The resting tension of the rings was adjusted to 1.0 g. Changes in vascular tension were recorded on a pen-writing recorder (WT-645G; Nihon Kohden).
Human umbilical vein endothelial cells (HUVEC) study
HUVEC are plated in a 100-mm culture dish at the density of 2.0 x 106 cells per dish. After 1624 h, the cells were incubated with 0.11 mM palmitate, a major fraction of saturated FFA in plasma, with a 1-h prior incubation each of vehicle, 1 mmol/liter pitavastatin, 10 µmol/liter diphenyleneiodium (DPI), 20 mmol/liter N-acetyl-L-cysteine (NAC). After treatment of indicated conditions, cells were harvested from the dish with 0.5x Trypsin-EDTA and then immediately subjected to cytoplasmic mRNA extraction by RNA-Easy kit (QIAGEN GmbH, Hilden, Germany).
ROS signals
The intracellular ROS formation in HUVEC was detected using the fluorescent probe 5-(and 6)-chloromethyl-2',7'-dichlorodihydrofluorescein diacetate, acetyl ester (Molecular Probes, Inc., Eugene, OR) according to the manufacturers protocol. Preliminarily, we confirmed the satisfactory efficacy of this probe to detect intracellular ROS signal induced by H2O2 in several cell lines including HUVEC.
Immunoprecipitations and Western blotting
Western blot analysis was performed as described previously (15). Protein samples (50 µg) were prepared from thoracic aortas of four groups of mice and denatured and run on polyacrylamide gels. After transfer onto polyvinylidene difluoride transfer membranes, the membranes were blocked for 90 min in 5% nonfat milk solution. For immunoprecipitation, the primary antibodies [endothelial nitric oxide synthase (eNOS) or p47phox] were used at a 1:1000 dilution in 5% nonfat milk solution for 12 h at 4 C (16, 17). Bound antibodies were detected with horseradish-peroxidase-conjugated antimouse IgG and visualized with an enhanced chemiluminescence detection system (SuperSignal West Pico Chemiluminescent Substrate; Pierce, Rockford, IL). For anti-phosphotyrosine or anti-phosphoserine blots, nitrocellulose membranes were blocked by incubation in Tris-buffered saline/Tween 20 containing 1% BSA for 2 h, followed by a 20-min incubation in anti-phosphotyrosine (eNOS) or anti-phosphoserine (p47phox) antibody diluted in blocking buffer. The membranes were washed extensively in Tris-buffered saline/Tween 20 and developed by using the above system. Band intensity was quantified by NIH ImageJ 1.32j, and the ratio of anti-phosphotyrosine or anti-phosphoserine blot intensity to those of eNOS or p47phox blot intensity was used to represent the enzyme catalytic activities. Lipid peroxidation level of aorta was determined using the TBARS assay kit (ZeptoMetrix Corp., Buffalo, NY).
Real-time RT-PCR
RT-PCR was done with SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen Japan K.K., Tokyo, Japan) and SYBR green on an ABI PRISM 7000 real-time PCR system (Applied Biosystems Japan Ltd., Tokyo, Japan) (13). Primers used were as follows: p22phox (GenBank NM_000101) forward, ATTACTATGTTCGGGCCGTCCT, and reverse, GGTAGATGCCGCTCGCAAT; p40phox (NM_000631) forward, ATGCGGATACCTGCCCTCAA, and reverse, CTCTGAGTCATAGGGCGACTGGTAA; p47phox (NM_000265) forward, GATGCCCAAAGATGGCAAGAGTA, and reverse, GCTTTCATCTGACAGAACCACCAA; p67phox (NM_000433) forward, AGCTCCGGCTGGAACACACTA, and reverse, GGCACCAGCTCATTGCTGTC; gp91phox (NM_000397) forward, AAATGGATCGCATCTGTGTGAC, and reverse, TGGCCACACTAACAGTGATTTAGAG; and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (NM_002046) forward, GGCCTCCAAGGAGTAAGACC, and reverse, AGGGGTCTACATGGCAACTG. Results are expressed as fold change in gene expression by determining the ratio of copy number of the gene of interest corrected for expression of GAPDH in the samples.
Statistical analysis
Values are expressed as the mean ± SE. Two-tailed unpaired Students t test or one-way factorial ANOVA, followed by Bonferronis post hoc comparisons, was used to compare group means. Comparisons of dose-response curves were made by two-factor repeated-measures ANOVA. A P value < 0.05 was considered statistically significant. Analyses were processed using StatView J-5.0 software package (SAS Institute Inc., Cary, NC) or InStat 3 for Macintosh version 3.0b (GraphPad Software, Inc., San Diego, CA).
| Results |
|---|
|
|
|---|
|
|
|
were increased in ZDF rats (Table 1
in ZDF rats. The level of eNOS phosphorylation was not different between +/+ and ZDF rats (Fig. 2
|
|
| Discussion |
|---|
|
|
|---|
Vascular reactivity and vascular ROS
Using a rodent model of visceral fat obesity, the ZDF (fa/fa) rat (4, 5), we measured the vascular response to vasodilatory and vasoconstrictive agents. The vasodilator response to acetylcholine, but not to sodium nitroprusside, was impaired in ZDF rats. This indicates that endothelium-dependent vasodilatation, frequently represented by the response to acetylcholine, was impaired, but endothelium-independent vasodilatation, represented usually by the response to sodium nitroprusside, was preserved in ZDF rats. Levels of plasma TBARS and urinary 8-epi-PGF2
were increased in ZDF rats, indicating an increase in circulating ROS. Because accumulated fat is possibly a principal source of circulating ROS in obesity (13), the circulating ROS might be coming mainly from accumulated fat. However, the level of vascular ROS production was also increased in ZDF rats. Serine phosphorylation of p47phox, which is a critical step for cytoplasmic complex formation of NADPH oxidase and serves as NADPH oxidase activation (17), was enhanced in ZDF aorta, indicating that ROS production was also locally amplified. Increased ROS, regardless of whether it was locally produced or fat-derived remote ROS (13), may be associated with endothelial dysfunction (18).
Under normal conditions, NO released by eNOS stimulates soluble guanylyl cyclase, increasing cGMP, activating cGMP-dependent protein kinase 1, and finally eliciting vasodilation (18). When vascular ROS is in excess, it can react with NO, thereby generating peroxynitrite, the most stable and potent oxidant. Peroxynitrite uncouples eNOS, switching the NO-producing process to a ROS reproduction process (18). In ZDF rats, excess vascular ROS can come from increased activity of NADPH oxidase and normal activity of eNOS. A 2-wk treatment with a NADPH oxidase inhibitor, apocynin (13), almost completely recovered the vascular response to acetylcholine in ZDF rats, supporting the notion that vascular ROS is the major cause of endothelial dysfunction.
Hyperglycemia is the other possible mechanism of vascular endothelial dysfunction in visceral obesity. Our ZDF rats at 9 wk of age were at the phase of glucose intolerance, showing mild hyperglycemia (nonfasting was 7.9 mmol/liter vs. age-matched control was 10.3 mmol/liter), hyperinsulinemia (9.6 vs. 83.3 pmol/liter) and hyperlipacidemia (0.33 vs. 0.92 mmol/liter) (4, 5, 6). We confirmed that this level of mild hyperglycemia did not impair vascular reactivity to acetylcholine and did not increase ROS production (data not shown). Although we cannot completely exclude the role of hyperglycemia in impairing vascular reactivity, it is likely that mild hyperglycemia is not the primary cause of ROS-associated endothelial dysfunction in prediabetic ZDF rats.
It had been shown that 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitors (statin) reduce ROS production (10, 11). In our study, pitavastatin did not change levels of plasma TBARS and urinary 8-epi-PGF2
in ZDF rats but improved the vasodilator response to acetylcholine. The level of vascular ROS was decreased by pitavastatin simultaneously with a decrease of vascular p47phox serine phosphorylation, indicating that pitavastatin somehow inhibited the activation process of NADPH oxidase (10, 11). Pitavastatin did not change the plasma levels of adipocyte-derived cytokines such as TNF-
(vehicle 4.00 ± 0.75 vs. pitavastatin 4.77 ± 1.69 pg/ml) and adiponectin (8.75 ± 0.95 vs. 7.27 ± 0.48 µg/ml) in ZDF rats (19, 20) (see also IDF Worldwide Definition of the Metabolic Syndrome at http://www.idf.org/home/). Collectively, pitavastatin did not affect circulating ROS level but decreased vascular ROS production, suggesting direct vascular effects.
FFA and vascular NADPH oxidase activity
A common feature of visceral fat obesity is an oversupply of FFA to the bloodstream from adipose tissues, and FFA can enhance vascular production of ROS (8, 9). We thus tested whether FFA do directly activate vascular ROS production and, if so, whether it can be through NADPH oxidase activation.
First we confirmed that palmitate, a major fraction of saturated FFA in plasma, directly increased intracellular ROS signals dose dependently and time dependently (data not shown) (8). The palmitate-induced increases in vascular ROS signals were inhibited completely by pitavastatin and a general antioxidant, NAC, and partially by DPI, a NADPH oxidase inhibitor.
The major source of superoxide anion in the vasculature is the NADPH oxidase family of enzymes (21, 22). Vascular NADPH oxidase is a multisubunit enzyme complex that includes the membrane-bound flavocytochrome b558 formed by gp91phox and p22phox and the cytosolic proteins p47phox, p67phox, and Rac. We thus determined the effects of palmitate on the expression levels of the vascular NADPH oxidase subunit gene. Palmitate increased expression levels of p22phox, p40phox, p47phox, p67phox, and gp91phox. A prior treatment with pitavastatin inhibited the palmitate-induced increases in p22phox, p40phox, and p47phox mRNA but did not change p67phox and gp91phox.
Two general mechanisms underlying activation of NADPH oxidase are either an acute increase in oxidase complex formation secondary to posttranslational modification of regulatory subunits (p47phox and Rac) or a chronic increase in the expression and abundance of component subunits (18, 21, 22). As we and others reported previously (5, 8), palmitate directly increases diacylglycerol levels and protein kinase C activation, which is the well-known signal for activation of NADPH oxidase. A key mechanism of acute activation by palmitate can be that protein kinase C-dependent phosphorylation of the p47phox regulatory subunit and its translocation to the Nox2/p22phox heterodimer to form fully assembled complexes. Increased expression of NADPH oxidase subunits might be the mechanism of chronic NADPH activation by palmitate.
As recently reported, mitochondrial uncoupling could be another source of ROS production in FFA-treated endothelial cells (23). Adenoviral overexpression of uncoupling protein 1 (UCP-1) or inhibition of mitochondrial FFA oxidation by carnitine palmitoyltransferase I (CPT-I) inhibitor (etomoxir) could inhibit such FFA-induced ROS production. NADPH oxidase and mitochondrial uncoupling could independently contribute to FFA-induced ROS production in vascular system.
Activated Rac in its GTP-bound state binds to the cytosolic p67phox subunit and activates the oxidase. Pitavastatin may inhibit palmitate-induced activation of NADPH oxidase through Rac inactivation, because Rac activation requires its posttranslational modification by isoprenylation, a process that is inhibited by statin (10, 11). Inhibition of palmitate-induced up-regulation of NADPH oxidase subunits may be another mechanism of NADPH inactivation by pitavastatin.
Conclusion
Endothelial dysfunction and NADPH oxidase activation were concomitantly observed in obese ZDF rats, but those were improved by pitavastatin and apocynin treatment. It is suggested that pitavastatin might inhibit FFA-induced NADPH oxidase subunit gene expression and ROS production in endothelial cells and then protect the endothelial dysfunction seen in obese ZDF rats. Visceral fat obesity is the essential component of the metabolic syndrome including hypertension, dyslipidemia, and glucose intolerance (Ref. 19 and http://www.idf.org/home/). Endothelial dysfunction, which is a systemic disorder and a key variable in the initiation and progression of atherosclerosis and its complications (20), occurs frequently in subjects with visceral fat obesity (1, 2, 3). As shown in Fig. 4
, we suggest that FFA-induced ROS overproduction might be a possible underlying mechanism(s) for the impaired endothelial function in visceral fat obesity, vascular lipotoxicity (Fig. 4
).
|
| Footnotes |
|---|
Disclosure Summary: The authors have nothing to declare.
First Published Online October 5, 2006
Abbreviations: DPI, Diphenyleneiodonium; eNOS, endothelial nitric oxide synthase; 8-epi-PGF2
, 8-epi-prostaglandin-F2
; FFA, free fatty acids; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; HDL, high-density lipoprotein; HUVEC, human umbilical vein endothelial cells; NAC, N-acetyl-L-cysteine; ROS, reactive oxygen species; TBARS, thiobarbituric acid reactive substance; ZDF, Zucker diabetic fatty.
Received August 18, 2006.
Accepted for publication September 26, 2006.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. M. Brennan, E. N. Terry, J. J. Michal, R. L. Kincaid, and K. A. Johnson Body weight loss in beef cows: II. Increased antioxidant messenger ribonucleic acid levels in skeletal muscle but not erythrocyte antioxidant activity J Anim Sci, September 1, 2009; 87(9): 2867 - 2873. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nagae, M. Fujita, H. Kawarazaki, H. Matsui, K. Ando, and T. Fujita Sympathoexcitation by Oxidative Stress in the Brain Mediates Arterial Pressure Elevation in Obesity-Induced Hypertension Circulation, February 24, 2009; 119(7): 978 - 986. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bashan, J. Kovsan, I. Kachko, H. Ovadia, and A. Rudich Positive and Negative Regulation of Insulin Signaling by Reactive Oxygen and Nitrogen Species Physiol Rev, January 1, 2009; 89(1): 27 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Anderson and J. Borlak Molecular Mechanisms and Therapeutic Targets in Steatosis and Steatohepatitis Pharmacol. Rev., September 1, 2008; 60(3): 311 - 357. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. G. Maier Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Diabetes: Vascular Implications Vascular and Endovascular Surgery, August 1, 2008; 42(4): 305 - 313. [Abstract] [PDF] |
||||
![]() |
J. C. Russell, S. D. Proctor, S. E. Kelly, and D. N. Brindley Pair feeding-mediated changes in metabolism: stress response and pathophysiology in insulin-resistant, atherosclerosis-prone JCR:LA-cp rats Am J Physiol Endocrinol Metab, June 1, 2008; 294(6): E1078 - E1087. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Dumont, F. Pinaud, A.-L. Guihot, C. Baufreton, L. Loufrani, and D. Henrion Alteration in flow (shear stress)-induced remodelling in rat resistance arteries with aging: improvement by a treatment with hydralazine Cardiovasc Res, February 1, 2008; 77(3): 600 - 608. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shimabukuro, I. Chinen, N. Higa, N. Takasu, K. Yamakawa, and S. Ueda Effects of dietary composition on postprandial endothelial function and adiponectin concentrations in healthy humans: a crossover controlled study Am. J. Clinical Nutrition, October 1, 2007; 86(4): 923 - 928. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. M. Wahba and R. H. Mak Obesity and Obesity-Initiated Metabolic Syndrome: Mechanistic Links to Chronic Kidney Disease Clin. J. Am. Soc. Nephrol., May 1, 2007; 2(3): 550 - 562. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |