Endocrinology, doi:10.1210/en.2006-0920
Endocrinology Vol. 148, No. 1 411-421
Copyright © 2007 by The Endocrine Society
Porcine Somatostatin Receptor 2 Displays Typical Pharmacological sst2 Features but Unique Dynamics of Homodimerization and Internalization
Mario Durán-Prado,
Christine Bucharles,
Bruno J. Gonzalez,
Rafael Vázquez-Martínez,
Antonio J. Martínez-Fuentes,
Socorro García-Navarro,
Simon J. Rhodes,
Hubert Vaudry,
María M. Malagón and
Justo P. Castaño
Department of Cell Biology, Physiology and Immunology (M.D.-P., R.V.-M., A.J.M.-F., S.G.-N., M.M.M., J.P.C.), University of Córdoba, E-14014 Córdoba, Spain; Laboratory of Cellular and Molecular Neuroendocrinology, European Institute for Peptide Research (C.B., B.J.G., H.V.), University of Rouen, 76821 Mont-Saint-Aignan, Cedex, France; and Department of Cellular and Integrative Physiology (S.J.R.), Indiana University School of Medicine, Indianapolis, Indiana 46202
Address all correspondence and requests for reprints to: Dr. Justo P. Castaño, Department of Cell Biology, Physiology and Immunology, Campus de Rabanales, Edificio C-6, Planta 3, University of Córdoba, E-14014 Córdoba, Spain. E-mail: justo{at}uco.es.
 |
Abstract
|
|---|
Somatostatin (SRIF) exerts its multiple actions, including inhibition of GH secretion and of tumoral growth, through a family of five receptor subtypes (sst1-sst5). We recently reported that an sst2-selective agonist markedly decreases GH release from pig somatotropes, suggesting important roles for this scarcely explored receptor, psst2. Here, functional expression of psst2 in Chinese hamster ovary-K1 and human embryonic kidney-293-AD cell lines was employed to determine its pharmacological features and functional ability to reduce cAMP, and to examine its homodimerization and internalization dynamics in real time in single living cells. Results show that psst2 is a high-affinity receptor (dissociation constant = 0.27 nM) displaying a typical sst2 profile (nM affinity for SRIF-14
SRIF-28>cortistatin>MK678>octreotide) and high selectivity (EC50 = 1.1 nM) for the sst2 agonist L-779,976, but millimolar or undetectable affinity to other sst-specific agonists (sst3>sst1>sst5
sst4). Accordingly, SRIF dose-dependently inhibited forskolin-stimulated cAMP with high potency (EC50 = 6.55 pM) and modest efficacy (maximum 29.1%) via psst2. Cotransfection of human embryonic kidney-293 and Chinese hamster ovary-K1 cells with two receptor constructs modified with distinct fluorescent tags (psst2-YFP/psst2-CFP) enabled fluorescence resonance energy transfer measurement of physical interaction between psst2 receptors and also receptor internalization in single living cells. This revealed that under basal conditions, psst2 forms constitutive homodimers/homomultimers, which dissociate immediately (11 sec) upon SRIF binding. Interestingly, contrary to human sst2, psst2 rapidly reassociates (110.5 sec) during a subsequent process that temporally overlaps with receptor internalization (half-maximal = 95.1 sec). Therefore, psst2 is a potent inhibitory receptor displaying a unique set of interrelated dynamic features of agonist-dependent dimerization, dissociation, internalization, and reassociation, a cascade of events that might be critical for receptor function.
 |
Introduction
|
|---|
SOMATOSTATIN (SRIF) EXERTS its multiple actions, including inhibition of neuroendocrine secretions, neurotransmission, and regulation of gastrointestinal and immune cell functions, through a family of receptors (sst) that belong to the superfamily of G protein-coupled receptors (GPCRs) with seven transmembrane domains (1, 2). This family comprises five distinct receptors (sst15) encoded by different, nonallelic and intronless genes (1, 2, 3, 4). In addition, alternative C-terminal spliced isoforms (sst2b) have been described in mouse and rat (4, 5) but not in human or other species. The five sst subtypes are highly similar between them (3957%) and also highly conserved across species (8198% for mouse, human, and rat) (6). Upon SRIF binding, each sst subtype can activate a cell type- and species-specific set of G proteins and downstream signals. In fact, the wide range of SRIF actions is enabled by the versatile capacities of its five sst, coupled to their broad tissue distribution and the common simultaneous presence of more than one sst subtype in a given cell type (1, 2, 4). Accordingly, SRIF effects are rarely mediated by one signal transduction pathway exclusively but are more often the result of a convergence of several cellular processes differentially regulated by each receptor (1). Moreover, recent evidence has shown that sst do not only exist as isolated entities, but that they interact to yield supramolecular structures by forming homodimers (7), and heterodimers with other sst (8, 9) and with other GPCRs, like opioid (10) and dopamine receptors (11), which alter their single, original pharmacological and functional profiles. Therefore, owing to the intrinsic complexity of SRIF actions and associated signaling in its natural target cells, most studies aimed at elucidating the characteristics of each sst have relied on individual expression of a given receptor subtype in a heterologous cell model.
Among all sst, sst2 displays the most widespread distribution and predominant abundance in normal and tumoral tissues, which confer it a major role in mediating the physiological effects of SRIF and the therapeutic actions of SRIF analogs (2, 12, 13). As an example, sst2 is thought to be the main receptor mediating SRIF-induced inhibition of GH secretion by pituitary somatotropes in humans (14), rats (15), and chickens (16). For this reason, human (hsst2) and rat sst2 (rsst2) have been extensively characterized, and it is well documented that the basic pathways mediating SRIF action via these sst2 comprise activation of pertussis toxin-sensitive Gi proteins, and subsequent inhibition of adenylate cyclase, closing of voltage-sensitive Ca2+ channels, opening of K+ channels and stimulation of phospholipase C (6, 13, 17, 18). Also, sst2a is known to form constitutive homodimers that dissociate after ligand binding, a process that is accompanied by receptor internalization (7) via clathrin-coated vesicles (13, 19, 20) and mediated by interaction with ß-arrestins (21). In fact, these properties of the hsst2 have been exploited to design ligands and radioligands able to bind the receptor and act specifically on tumor cells after internalization, with the end purposes of imaging and/or treatment of tumoral cells (22, 23, 24).
In contrast to the wealth of information on hsst2 and rsst2, little is known on the functional features of sst2 in other species, like the pig. In a recent study, we employed a set of five nonpeptidyl SRIF agonists with selective affinity for each sst to better define the role of individual receptor subtypes in the complex, unique action of SRIF on GH release from pig somatotropes (25, 26). The results obtained indicate that sst2 and sst1 would play a pivotal role in mediating the inhibitory actions of SRIF on GH release, whereas sst5 or an sst5-related mechanism would convey the stimulatory effects caused by low SRIF doses in these cells. However, unequivocal assessment of the functional and molecular features of each porcine sst would require their individual analysis. Accordingly, we have devised an experimental approach to examine porcine sst2a (psst2), a receptor originally cloned in 1994 that possesses 394 amino acids and shares high identity (96.5%) and homology (99.2%) with its human counterpart (27). Although recent studies have analyzed the regulation of psst2 in pituitary cells (26, 28), and in Leydig (29) and Sertoli cells (30, 31), its molecular and functional properties have not been described hitherto. In this study, we thoroughly characterized psst2, functionally expressed in model cell lines, by examining its binding, pharmacological, and functional profiles. Furthermore, armed with these tools, we performed a detailed study of the subcellular dynamics of psst2 in terms of homodimerization and internalization, which have revealed for the first time the unique quantitative temporal correlates of these two processes for any sst in single living cells.
 |
Materials and Methods
|
|---|
Cloning of the porcine sst2
Genomic DNA was extracted from porcine female pituitaries, using the Tripure Isolation Reagent (Roche Molecular Biochemicals, Mannheim, Germany) according the manufacturers protocol. The full length of psst2 was amplified by two PCR rounds, using a high-fidelity Taq polymerase (Ecozyme; Ecogen, Barcelona, Spain). For the first PCR round, specific primers were designed at the 5' and 3' regions of the coding sequence respectively (sense, 5'ATGGATATGGCG 3'; antisense, 5'AGATACTGGTCTGG 3'), according to the known sequence of the psst2 (GenBank accession no. D21338). The PCR product was subjected to a second amplification using the same sense and antisense primers but including HindIII (upper, HindIII; 5' TACAAGCTTGCCATGGATATGGCG 3') and EcoRI (lower, EcoRI; 5' TCAGGGAATTCAGATACTGGTCTGG 3') restriction sites. After the second PCR amplification, the psst2 full-length cDNA was subcloned into the correspondent restriction sites of the pCDNA3.1+ vector (Invitrogen, Barcelona, Spain). Identity of the cloned sequence to that of the psst2 (GenBank accession no. D21338) was confirmed by sequencing at the Central Facilities of the University of Córdoba.
psst2 Constructs for imaging and fluorescence resonance energy transfer (FRET) measurements
Enhanced cyan fluorescent protein (CFP)-C1, a variant of yellow fluorescent protein (YFP)-C1 (YFP/F46L-C1 also known as Venus) (32) and enhanced (E)-green fluorescent protein (GFP)-N1 (kindly provided by Dr. R. N. Day, University of Virginia) were used to construct N1-terminal CFP and YFP vectors. To this end, both fluorescent proteins of the CFP and YFP vectors were excised by sequential digestion with the restriction enzymes AgeI and BsrGI (New England Biolabs, Ipswich, MA) and ligated into the same sites of the previously digested backbone of the E-GPF-N1 vector. The resulting vectors were sequenced at the Biochemistry and Biotechnology Facility (Indiana University-Purdue University, IUPUI) to ensure the correct sequences of the recombinant constructs. psst2 was amplified by PCR using an sst2-pCDNA3.1 recombinant plasmid as template and a high fidelity Pfu polymerase (Pfu-Ultra; Stratagene, La Jolla, CA), and fused in frame to the NH2-terminal domain of the fluorescent proteins into the HindIII and BamHI sites, by simultaneous digestion with both enzymes and subsequent ligation with T4 DNA ligase. Primers used were S-sst2-HindIII; 5'TCAAGCTTCGATGGATATGGCGTATGAGCT3' and AS-sst2-BamHI; 5'CTGGATCCAGGATACTGGTCTGGAGGTCTC 3'. Both recombinant psst2/CFP and psst2/YFP constructs were verified by sequencing at the IUPUI core facility.
Animals and pituitary cell dispersion and culture
Pituitary glands from prepuberal (46 months old) female Large-White/Landrace pigs were obtained from a local abattoir. According to European Regulations for Animal Care, animals were killed by exanguination after electrical stunning, and immediately decapitated. Pituitary glands were removed and transferred to sterile cold (4 C) medium (MEM; Sigma, London, UK) supplemented with 0.1% BSA and antibiotic-antimycotic solution (Sigma). In the laboratory, pituitaries were washed twice with fresh medium, and the posterior lobes were discarded.
Isolated cells from the porcine anterior pituitary were obtained using a dispersion protocol as previously described (33, 34). Briefly, for each experiment, three to four anterior pituitaries were pooled, minced, and enzymatically dissociated by sequential incubation in MEM supplemented with 0.3% trypsin (type I), 0.1% collagenase (type V), 0.1% soybean trypsin inhibitor I, 2 µg/ml deoxyribonuclease I, and Ca2+/Mg2+-free salt solution with EDTA (2 and 1 mM). Finally, the tissues were mechanically dispersed using a siliconized Pasteur pipette until a homogeneous cellular suspension was obtained. After each step, the cellular suspension was centrifuged at 60 x g for 5 min. Cellular viability, as estimated by the trypan blue test, was always above 90%.
Transfection and selection of monoclonal lines
Chinese hamster ovary (CHO)-K1 cells were cultured to semiconfluence in 12-well plates using F12 medium supplemented with 1% fetal bovine serum and 0.1% antibiotic-antimycotic, and transfected with different concentrations of the recombinant plasmid, ranging 35 µg, using Lipofectamine 2000 (Life Technologies, Inc., Barcelona, Spain). Twenty-four hours after transfection, media were replaced by fresh F12 containing 1 mg/ml of geneticin (G418; Life Technologies, Inc.). One week later, surviving cells were detached, diluted to 70 cells/ml and plated on 96-well plates at 0.7 cells/well. Monoclonal cell lines expressing the psst2 were followed daily by contrast phase microscopy. Seven independent monoclonal stable cell lines were obtained after a 3-wk period of selection.
For transient transfection and imaging, CHO-K1 and human embryonic kidney (HEK)-293 AD cells (kindly provided by Dr. E. Muñoz-Blanco, University of Córdoba) were used. Cells were plated at 100,000 cells/ml onto round coverslips previously coated with poly-L-lysine (Sigma), transfected with 1 µg of plasmid 48 h after plating, and used for imaging at least 24 h after transfection. Where appropriate, cells were fixed for 5 min in 4% paraformaldehyde, rinsed twice in PBS and mounted onto a slide using Fluoromount (Molecular Probes, Eugene, OR) to reduce photobleaching.
Radioligands
[125ITyr-11]SRIF-14 was radio iodinated by the lactoperoxidase technique, as described previously (35). Radioligand was purified by reverse-phase high performance liquid chromatography on a C18 column (Adsorbosphere HS C18, 5 µm; Alltech, Lexington, KY), using a gradient of acetonitrile in trifluoroacetic acid 0.1%. [125ITyr-11]SRIF was eluted at 31% acetonitrile. The specific radioactivity of the tracer was about 2000 Ci/mmol.
Radioligand binding assays
Binding experiments were carried out as described previously (35). Saturation and competition experiments were performed in whole CHO-K1 cells, namely in monoclonal cell lines expressing the psst2, cultured onto coverslips in 12-well plates. Two different cell densities, 50,000 and 150,000 cells/ml, were used for saturation experiments. Competition assays were performed at 150,000 cells/ml.
Chemicals
S14 (Modustatin) was kindly provided by Dr. I. Fermé (Sanofi Synthélabo, Le Plessis-Robinson, France). Tyr11-SRIF-14 was purchased from Bachem (Weil am Rhein, Germany), S28 from Neosystem (Strasbourg, France), cortistatin from Peninsula (Belmont, CA), and MK678 and forskolin from Sigma. Octreotide was kindly provided by Novartis (Barcelona, Spain) and the specific nonpeptidyl sst agonists L-779,591, L-779,976, L-796,778, L-803,087, and L-817,818 were kindly provided by Dr. Susan P. Rohrer (Merck Research Co., Rahway, NJ).
cAMP measurements
To measure intracellular cAMP accumulation, transfected and nontransfected (in parallel) CHO-K1 cells were plated in six-well plates at a density of 106 cells/well, in 2 ml of F12-fetal bovine serum. After 2 h of preincubation in serum-free media, cells were incubated for 30 min with F12 containing 1 mM of the phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine (Sigma) to prevent enzymatic degradation of cAMP. Then, cells were incubated for an additional 30-min period in 1 mM 3-isobutyl-1-methylxanthine media in the presence of corresponding treatments. Cells were treated with medium alone or containing five concentrations of SRIF-14 (1013, 1011, 109, 107, and 106 M) in the presence or absence of 105 M forskolin, to assess the effect of SRIF-14 on basal and stimulated cAMP levels. The same procedure was used for porcine pituitary dispersed cells, using MEM as media and a single concentration of SRIF (107 M) or the sst2-specific agonist L-779,976 (108 M) in the presence of 105 M forskolin. The amount of cAMP was measured with a [3H]cAMP assay kit (Amersham Pharmacia Biotech, Aylesbury, UK). Data are presented as percent change of picomoles of cAMP per milligram of protein with respect to the corresponding control levels (either basal or forskolin-stimulated cAMP levels).
Measurement of free cytosolic calcium concentration ([Ca2+]i) in single cells
Transfected CHO-K1 and HEK-293 AD cells were incubated for 30 min at 37 C with 2.5 µM of the Ca2+ indicator dye Fura-2 AM (Molecular Probes, Eugene, OR) in phenol red-free DMEM containing 20 mM NaHCO3 (pH 7.4). Coverslips were washed with phenol red-free DMEM and mounted on the stage of a Nikon Eclipse TE2000 E microscope (Nikon, Tokyo, Japan) with attached back thinned-charge-coupled device cooled digital camera (ORCA II BT; Hamamatsu Photonics, Hamamatsu, Japan). Cells were examined under a 40 x oil immersion objective during exposure to alternating 340- and 380-nm light beams, and the intensity of light emission at 505 nm was measured every 5 sec. Changes in [Ca2+]i after 107 SRIF-14 administration were recorded as background subtracted ratios of the corresponding excitation wavelengths (F340/F380) using MetaFluor Software (Imaging Corp., West Chester, PA).
Cellular localization and confocal imaging
Transiently transfected HEK-293 AD cells growing onto coverslips were mounted in a chamber with 300 µl serum- and antibiotic-free MEM. Images were acquired every 30 sec with a Leica Espectral TCS-SP2-AOBS confocal scanning microscope (Leica Corp., Heidelberg, Germany) with the CFP settings. After 2 min of image acquisition, 300 µl of SRIF (107 M final) were injected with a pipette. Images were acquired for 30 min after SRIF injection, and then analyzed with ImageJ (National Institutes of Health, Bethesda, MD).
FRET measurements and internalization
Images of CHO-K1 transfected cells were acquired with an inverted Nikon Eclipse TE2000 E scope equipped with a 400 DCLP dichroic filter (Chroma, Rockingham) and recorded with an ORCA II BT digital camera, both controlled with MetaMorph software (Imaging Corp., West Chester, PA). Long-term changes in FRET efficiency were determined in fixed cells, at basal level (no treatment) and after a 30-min treatment with 107 M SRIF. Net FRET was calculated using the three filters method (36). Three sequential images at 1 sec of exposure were acquired with the suitable filters sets for the donor (E-CFP; excitation at 440 and emission at 510 nm), acceptor (E-YFP/F46L; excitation at 495 and emission at 540 nm) and FRET (excitation at 440 and emission at 540 nm) and under a 60 x oil immersion objective. Raw FRET images were corrected with the fully specified bleedthrough method, using the following equation: FRET = Raw FRET [Acceptor (DA * Donor)] * [AF] [Donor (AD* Acceptor)] * [DF], where DA is the proportion in which the donor signal contributes to the acceptor, AD is the proportion in which the acceptor signal contributes to the donor, AF is the proportion in which the acceptor contributes to the raw FRET signal, and DF is the proportion in which the donor contributes to the raw FRET signal. These coefficients were calculated from cells expressing E-CFP or E-YFP alone. To determine the FRET detection limit of the system, cells coexpressing E-CFP and E-YFP proteins were measured. FRET efficiency was calculated in relation to the positive control consisting in a vector with E-CFP and E-YFP coupled in frame, which provided the upper FRET efficiency limit (50%). Images were acquired with the MetaMorph software and analyzed with ImageJ and Microsoft Excel 2003. For image analysis and coefficient calculation, background was always subtracted in each picture. A 1:1 E-YFP/E-CFP ratio and equal E-YFP and E-CFP intensities between all samples were used for FRET measurements. Representative analyzed net FRET images were generated with MetaMorph, using the coefficients calculated previously for the analysis. Rapid, short-lived temporal changes in FRET were evaluated in living cells by using the same system described above but under the control of the MetaFluor software (Imaging Corp.). For that purpose, cotransfected HEK-293 AD cells growing onto round coverslips were mounted in a chamber as described. After at least 40 sec of the beginning of image acquisition, 300 µl of SRIF (107 M final) were added with a pipette. Images were acquired every 5 sec during at least 10 min, using the same YFP and CFP filter sets and settings as above. Changes in FRET were monitored as variation of the normalized E-YFP/E-CFP ratio as described previously (37).
Internalization was first measured employing the same equipment described above, adding the CARV (Atto Biosciences, Rockville, MD) option to the system. With this approach, the decrease of CFP fluorescence from the membrane of transiently transfected HEK 293 AD cells, was measured every 5 sec until 900 sec from SRIF-14 injection. Thus, internalization was monitored as percentage loss of membrane background-subtracted CFP fluorescence normalized to the total E-CFP content of the cell, considering the initial fluorescence as the average of the five data points before SRIF-14 injection. Images were acquired with the MetaFluor software and analyzed with ImageJ and Microsoft Excel 2003. Internalization was also monitored by confocal laser scanning microscopy, employing a Leica TCS-SP2-AOBS microscope. Images were acquired every 30 sec until 1200 sec from SRIF-14 and then processed off-line with Huygens 2.4.4. deconvolution software (Scientific Imaging Volume, Hilversum, The Netherlands).
Statistical analysis
Data are expressed as mean ± SEM obtained from at least three separate, independent experiments carried out in different days and with different cell preparations (n = 3). For single cell analysis, a minimum of 12 total cells were analyzed. Statistical analysis was carried out using non parametric one-way ANOVA (Kruskal-Wallis test) followed by a statistical test for multiple comparisons (Dunns test). Differences were considered to be significant at P < 0.05.
 |
Results
|
|---|
Binding studies
Porcine sst2 cloned into the pCDNA3.1+ expression vector was employed to generate CHO-K1 cells stably expressing this receptor. Specifically, seven monoclonal stable cell lines expressing the receptor were obtained by transfection with different, increasing quantities of the recombinant psst2 plasmid and were selected by G418 resistance and assayed by ligand binding (see Materials and Methods). Of these cell lines, which expressed different quantities of the recombinant protein, one clone (designated 4.2) that showed an intermediate level of binding sites per cell was chosen for further binding and cAMP assays. Specifically, saturation experiments with [125ITyr11]SRIF-14 showed a dissociation constant (Kd) value of 0.27 ± 0.12 nM (n = 4) and a maximal binding capacity equal to 14,900 ± 5409 sites/cell (n = 4; Fig. 1
).

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1. [125ITyr11]SRIF-14 saturation binding to psst2 stably expressed in 4.2 CHO-K1 cells. Cells were grown onto coverslips at densities of 50,000 and 150,000 cells/ml. The radioligand was used at concentrations ranging between 90 and 900 pM. The inset represents the Scatchard plot obtained from the data shown in the saturation curve. The data presented, including the indicated Kd and a maximal binding capacity values, are mean ± SEM of n = 4 separate, independent experiments.
|
|
Competition assays were carried out using the same radioligand [125ITyr11]SRIF-14 employed in saturation studies, and two distinct groups of nonlabeled competitors, of peptidyl and nonpeptidyl nature, respectively. The EC50 values obtained for the peptidyl competitors fell within a similar range, with an order of potency of SRIF-14
SRIF-28>cortistatin>MK678>octreotide (Table 1
and Fig. 2
, top and middle panels). Although SRIF-14 and SRIF-28 displayed virtually identical EC50 values, the same was not true for their Hill slopes. Thus, whereas SRIF-28, like MK 678 and octreotide, showed Hill slopes close to or slightly higher than 1 (n = 3, 5, and 6, respectively), SRIF-14 and cortistatin exhibited Hill slope values of 1.2 (n = 4 and n = 3, respectively), suggesting a slight cooperativity. Competition studies were complemented by use of a set of five nonpeptidyl compounds with reported selective affinities for the five sst subtypes (sst1-sst5) from human and murine species (henceforth referred to as sst1-sst5 agonists) (38): L-797,591 (sst1), L-779,976 (sst2), L-796,778 (sst3), L-803,087 (sst4) and L-817,818 (sst5). The order of relative displacement potency of [125ITyr11]SRIF-14 by these compounds was L-779,976
L-796,778>L-797,591>>L-817,818 (Table 1
and Fig. 2
, bottom). No measurable displacement was achieved by the sst4-specific agonist L-803,087. The EC50 value of 1.1 nM obtained for the specific sst2 agonist is approximately 600-, 900-, and 3000-fold lower than the values obtained for the specific agonists for sst1, sst3, and sst5, respectively, as expected for an sst2 receptor.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 2. Displacement potencies of [125ITyr11]SRIF-14 by peptide and nonpeptidyl agonists. The ability to displace [125ITyr11]SRIF-14 was assayed in intact, psst2-stably transfected CHO-K1 cells, using increasing concentrations (1011 to 105 M) of competitors and a fixed concentration of [125ITyr11]SRIF-14. Plotted are the means of n = 4 for SRIF-14, n = 3 for SRIF-28, n = 5 for MK 678 (top graph), n = 6 for octreotide, n = 3 for cortistatin (middle graph) and n = 3 for L-797,591, L-779,976, L-796,778, L-803,087, and L-817,818 (bottom graph). Average values obtained for each competition curve were adjusted to a sigmoidal dose-response curve, which is represented with dotted or solid lines.
|
|
cAMP measurements
To test the functionality of the psst2 expressed in CHO cells, we examined the ability of SRIF-14 to inhibit basal or forskolin (10 µM)-stimulated cAMP production in the stably transfected clonal cell line 4.2. As shown in Fig. 3A
, SRIF-14 modestly, albeit significantly diminished basal levels of cAMP by 18.7 ± 3.6% at 109 M and by 16.3 ± 1% at 107 in these cells, whereas no such effect was observed in wild-type CHO-K1 cells (not shown). As expected, the inhibitory capacity of SRIF-14 was more noticeable in stimulated cells, where 107 M of the peptide caused a maximum inhibitory effect of forskolin-induced cAMP levels of 29.1 ± 5.4% with respect to control (n = 4, P < 0.01) as shown in Fig. 3B
. Results were fitted to a sigmoidal dose-response curve, which provided an ED50 value of 6.55 pM. In line with the results observed in CHO-psst2 expressing cells, treatment of forskolin (10 µM)-stimulated porcine pituitary cell cultures with a single dose of SRIF-14 (107 M) or the selective sst2 agonist L-779,976 (108 M) comparably reduced cAMP levels by 24.7 ± 3 and 23 ± 6%, respectively (Fig. 3C
). Similar reductions were observed in response to SRIF using transiently transfected HEK-293 AD cells or other CHO-K1 cell clones with a higher psst2 expression level (not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 3. Effects of SRIF-14 treatment on the production of cAMP. The effects of various doses of SRIF-14 on cAMP levels was tested in psst2-expressing 4.2. CHO-K1 cells. A, Under basal culture conditions; B, after stimulation with 10 µM forskolin. C, Effects of a single dose of SRIF-14 (107 M) or the sst2-selective nonpeptidyl agonist L-779,976 (108 M) on forskolin-stimulated cAMP in cultures of porcine pituitary cells. cAMP levels were measured by radioassay as picomoles of cAMP per milligram of protein and are presented as the percentage of change/reduction with respect to the corresponding control level (0%, basal or forskolin induced). Results are mean ± SEM of n = 4 (**, P < 0.01 vs. corresponding control).
|
|
Measurement of [Ca2+]i in single cells
Application of a Ca2+ imaging approach further demonstrated that psst2 expressed in CHO-K1 and HEK-293 AD cells is a functional receptor, as it mediated an increase in [Ca2+]i in both cell lines in response to 107 M SRIF-14 (Fig. 4
, A and C), similar to that previously shown for sst2 from other species when transfected in cell lines (1, 2, 4). Furthermore, this approach also served to ensure that the fluorescent tagged psst2 used in subsequent FRET and internalization studies also constitute a valid, functional receptor. Indeed, when [Ca2+]i was measured in both, CHO-K1 and HEK-293 AD cells, transiently transfected with psst2-YFP or with the untagged psst2, 107 M SRIF-14 was found to evoke similar increases in terms of maximal response and time to maximal increase, and also to cause comparable kinetics (Fig. 4
). Specifically, untagged psst2 elicited [Ca2+]i increases of 263 ± 15 and 299 ± 15% over basal level, with time to maximal response of 14.6 ± 0.8 and 15 ± 1.1 sec, in CHO-K1 and HEK-293 AD cells respectively (Fig. 4
, A and C; n = 66 CHO cells and 34 HEK cells, respectively). Similarly, YFP-tagged psst2 transfected in CHO-K1 and HEK-293 AD mediated [Ca2+]i increases of 285 ± 12 and 239 ± 19%, with time to maximal response of 19 ± 0.9 and 16 ± 1.8 sec respectively (Fig. 4B
, D; n = 42 CHO cells and 25 HEK cells, respectively). These results suggest that the fusion of the E-YFP protein in frame to the C-terminal tail of the psst2 does not alter the ability of this receptor to increase [Ca2+]i, and therefore, that the modified receptor retains its functional capacity.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4. Representative profiles of changes in the concentration of free cytosolic calcium ([Ca2+]i) in transfected cell lines in response to 107 M SRIF-14 administration (arrow). A, Profile of a single CHO-K1 cell stably transfected with the untagged psst2 (n = 66 cells). B, Ca2+ kinetics of a CHO-K1 cell transiently transfected with the psst2-YFP tagged receptor (n = 42 cells). C, Representative profile of a single HEK-293 AD cell transiently transfected with the untagged psst2 (n = 34 cells). D, Kinetics of [Ca2+]i in a representative HEK-293 AD cell transiently transfected with the psst2-YFP tagged receptor (n = 25 cells).
|
|
FRET measurements and internalization
To ascertain whether, as suggested by results from binding studies, psst2 receptors interact to form dimers or multimers, recombinant forms of this receptor tagged with fluorescent proteins were transfected in CHO-K1 cells and their putative interaction was measured by use of a FRET technique (Figs. 5
and 6
; see Materials and Methods for details). FRET efficiency was calculated as percentage of FRET relative to the positive control (cells transfected with the CFP-YFP chimera), considering a maximum FRET efficiency value of 50% (Fig. 6D
), as both CFP and YPF are at the Fosters distance. With this calculation, and measuring cells expressing YFP/CFP ratios close to 1:1 (equal amounts of YFP and CFP; Fig. 5
, BD), if all the receptors were forming dimers (100%), the theoretical maximal FRET efficiency value obtained would be 16.6%, as all the pairs CFP/CFP, YFP/YFP, and CFP/YFP have the same probability to occur. This approach revealed that the recombinant receptor forms constitutive homodimers (Fig. 5A
) as shown by a FRET efficiency value of 9.3 ± 1.7%, which was more than 10-fold higher than that observed in control cells (Fig. 6C
), expressing comparable levels of CFP and YFP empty vectors (1.05 ± 0.9%; P < 0.001). However, this FRET efficiency value implies that not all the receptor molecules are interacting and precisely, that a 55 ± 10% are forming dimers. Unexpectedly, a 30-min treatment with SRIF-14 did not decrease FRET signal (6.4 ± 0.95%; P < 0.001 vs. control) compared with basal state, which indicates that a 38 ± 5.8% of the molecules are interacting. Moreover, visual inspection of images employed for FRET analysis (Fig. 6
) revealed that FRET signal was predominantly located at the cell membrane under basal culture conditions (Fig. 6E
), whereas in SRIF-treated cells fluorescent signal was located preferentially at the intracellular level (Fig. 6F
). Interestingly, simultaneous real-time measurements of YFP and CFP in single, living cells (see Materials and Methods) demonstrated that SRIF caused a rapid increase in the level of CFP signal that is accompanied by a concomitant decrease in YFP fluorescence, a rapid process that peaks at 11.0 ± 0.3 sec (Fig. 7
). Concomitantly, the normalized YFP/CFP ratio showed a mean decrease of 6.90 ± 0.66% of the signal (n = 12) as a consequence of the rapid dissociation of the dimers. Furthermore, FRET signal monitored as YFP/CFP ratio returned to basal levels, on average, 110.5 ± 7.9 sec after the peak of maximum decrease in these cells.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5. Measurements of the FRET efficiency in fixed CHO-K1 cells transfected with different YFP and CFP constructs. A, The value of FRET efficiency of cells cotransfected with psst2-YFP and psst2-CFP was calculated as described in Materials and Methods. Cells expressing YFP and CFP coupled in frame within the same plasmid construct were used as positive control (30 cells). Cells expressing YFP and CFP empty vectors were used as negative control (32 cells). FRET was measured in cells under basal culture conditions (Basal; 40 cells) as well as in cells treated for 30 min with 107 M SRIF-14 (30 cells), which did not significantly alter basal FRET efficiency. Results presented are mean of the indicated cells ± SEM (***, P < 0.001 vs. negative control). B, Only cells displaying YFP/CFP ratios close to or equal to one, and C and D, containing similar YFP and CFP signals were measured. Cells not matching these criteria were discarded.
|
|

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6. Representative images of the cells employed to measure FRET index as acquired and processed using with MetaMorph software. As indicated, the columns correspond to YFP, CFP, Raw FRET, and analyzed FRET channels, respectively. Rows correspond to: A, psst2-YFP expressing cells; B, psst2-CFP expressing cells; C, negative control (cells expressing YFP and CFP empty vectors); D, positive control (cells expressing YFP and CFP coupled in frame within the same plasmid construct); E, cells cotransfected with psst2-YFP and psst2-CFP under untreated cultured conditions; and F, after 30 min treatment with SRIF-14. See Materials and Methods for further details.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7. Dynamics of psst2 dimerization were measured by monitoring FRET (changes in YFP/CFP fluorescence ratio, top panel) over time in response to 107 M SRIF administration (80 sec; arrow) in single living HEK-293 AD cells previously cotransfected with psst2-YFP and psst2-CFP (see Materials and Methods for details). The corresponding YFP (solid line) and CFP (dashed line) signals are shown in the bottom panel. Data shown represent the average of 12 cells, collected in three different experiments, and fluorescence is normalized with respect to the first five points of each cell.
|
|
To obtain a more precise spatial resolution of the dynamics of this process, time-lapse images of the same, individual living cells were captured and analyzed by confocal laser scanning microscopy. Visual inspection of these images, for example before and after 20 min exposure to SRIF, clearly indicated that ligand activation caused rapid internalization of the receptor from plasma membrane to intracellular compartments (Fig. 8
). Furthermore, by applying a similar methodological approach to the one described above for real-time FRET, to measure psst2-CFP internalization, we were able to achieve a more detailed, quantitative evaluation of the internalization process within the same, individual living cells, thereby gaining a higher temporal resolution. Thus, although both approaches similarly indicated that, as expected, psst2 internalizes after SRIF-14 treatment, the latter method quantitatively showed that the internalization process is initiated at a high rate right after dissociation of receptor dimers (within 25 sec from injection) and continues thereafter, although at a lower rate (Fig. 9
). Specifically, the time necessary to observe half-maximal internalization was 95.1 ± 11.6 sec (n = 8) after SRIF-14 administration, i.e. only 15 sec before receptors are fully reassociated again and have recovered their initial dimeric state, as evidenced by the FRET measurements in companion cultures described above. The internalization process reached a maximum value of 24.4 ± 6% (n = 8) of the initial CFP fluorescence at 815 sec after SRIF-14 injection.

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 8. Internalization of psst2 in response to SRIF-14 treatment. Confocal images of psst2-CFP transiently transfected in HEK-293 AD cells were taken before (top) and 20 min after 107 M SRIF-14 administration (bottom). Transfected cells were treated with SRIF and pictures were taken every 30 sec after injection and analyzed as described in Materials and Methods. The cell shown is representative of eight cells, measured in three different experiments.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 9. Effects of SRIF-14 on the temporal dynamics of psst2 internalization were measured in single living cells. Receptor internalization was monitored in single living HEK 293 AD cells previously transfected with psst2-CFP, as percent decrease of normalized membrane-associated CFP fluorescence measured every 5 sec, in response to a challenge with 107 M SRIF-14 (80 sec). Data shown represent the average internalization of eight cells, collected in three different experiments, and is presented as normalized fluorescence (relative fluorescence units, RFU, after background subtraction and normalized to the total CFP content) with respect to the average of the five data points before SRIF-14 injection.
|
|
 |
Discussion
|
|---|
In this study, we describe for the first time the functional expression and pharmacological profile of porcine sst2, and unveil the unique molecular dynamics of its homologous dimerization and internalization in relation to activation by its endogenous ligand, SRIF. This was accomplished by using real-time approaches that allow the measurement of these processes in single living cells, a combined strategy that has never been used hitherto to analyze the functional dynamics of any somatostatin receptor.
Pharmacological characterization of this receptor was carried out in a clonal psst2-CHO-K1 cell line, a well-characterized model successfully used to analyze several sst subtypes from different species (2, 39, 40, 41, 42, 43, 44). Saturation analysis demonstrated that psst2 is a high-affinity receptor, with a Kd value within the range of that reported for hsst2 (43, 44), and rat sst2 (rsst2) (41, 45) in CHO-K1 cells. These similar Kd values were not unexpected, given the high degree of conservation of the amino acid sequence of psst2 with respect to hsst2 and rsst2, which only differ in 13 and 20 noncritical residues, respectively (27).
Competition assays with nonpeptidyl agonists selective to each of the five human sst subtypes (38) further substantiated the pharmacological similarities between hsst2 and psst2. Indeed, only the sst2 agonist L-779,976 was able to displace the binding sites labeled with [125ITyr11]SRIF-14 with nanomolar affinity, whereas agonists for sst1, sst3, and sst5 only displaced the radioligand with micromolar affinity, and the sst4 agonist did not show appreciable displacement. In line with this, affinity of psst2 for natural (SRIF-14, SRIF-28, cortistatin) and synthetic (MK-678, octreotide) compounds that bind with high affinity but not exclusively to this receptor subtype in other species fell within the expected range, with only minor differences (4, 45). A comparative analysis of these data with those reported previously for hsst2 (38) reveals a strict concordance with respect to the sst2-specific agonist, but the parallelism is less apparent for the other agonists, specially for the sst5-specific agonist (L-817,818), which displaced [125ITyr-11]SRIF-14 bound to the hsst2 with 52 nM affinity (38), but showed a Kd value higher than 3 µM for psst2. Likewise, the sst4-specific agonist L-803,087 did not bind psst2 but bound hsst2 with micromolar affinity (38). Thus, the small differences between amino acid sequence of psst2 and hsst2 do not seem to affect the binding efficiency of SRIF-14 or L-779,976 to their respective ligand binding domains but seem to affect the putative binding sites of ligands specifically designed to bind other sst subtypes. In fact, the present results strongly suggest that the stimulatory action of the sst5-specific agonist on GH release from cultured pig somatotropes recently reported by our group (26) does not involve a nonspecific action of this agonist on sst2, thereby reinforcing the notion that the stimulatory action of SRIF on pig GH release is mediated via a sst5-related mechanism.
Having established the basic pharmacology of psst2, we next tested its functional ability to reduce cAMP levels. This showed that, whereas basal cAMP levels were only slightly decreased by 109 and 107 M SRIF-14, forskolin-stimulated cAMP production was dose-dependently inhibited by this peptide, with 107 M SRIF-14 causing a maximum (
30%) inhibition that is in line with that found for porcine pituitary cell cultures. These results demonstrate that the expressed receptor is functional but also reveal interesting species-specific differences that may shed some light on the biology of this receptor subtype and on the response of pig somatotropes to SRIF. Thus, whereas the level of reduction of forskolin-stimulated cAMP levels mediated by psst2 compares well with that found in cultured pig pituitary cells in response to SRIF and L-779,976, it is much lower than the elevated inhibitory effects reported for sst2 from other species expressed in the same cell line (40, 45). In marked contrast, and in agreement with its high affinity in saturation assays, SRIF was considerably more potent with psst2 (ED50 = 6.55 pM) than with other sst2 [hsst2 ED50 100 pM (46) to 16 µM (47); rsst2 ED50 390 (45) to 780 pM (40)]. Accordingly, our findings on cAMP support the view that psst2 is able to mediate the inhibitory actions of SRIF with elevated potency and moderate efficiency. Moreover, when these and our previous results (26) are viewed together, it seems reasonable to propose that psst2 would be an important receptor in mediating the inhibitory action of SRIF on stimulated GH release in pigs, as in most species studied to date, although the precise physiological relevance of this receptor may also depend on the other sst subtypes, especially sst1 and sst5, present in pig somatotropes.
There is increasing evidence that the processes of dimerization and internalization are of key importance for GPCR function, and in particular for sst because they may influence sensitivity and efficacy of selective ligands, as well as receptor resistance and tachyphylaxis (23, 48, 49). It was therefore of interest to analyze in detail these processes in psst2, especially because it relates to the interrelation of the temporal dynamics of these two closely related events, which has not been clearly established as yet for this receptor. Because previous studies have shown that both human and murine sst2 form constitutive homodimers in basal conditions (7, 8), the Hill coefficient below 1 observed for SRIF-14 and CST-17 at psst2 suggested the existence of more than one type of binding site. Indeed, application of a variant of FRET to fixed cells cotransfected with psst2-YFP and psst2-CFP demonstrated that psst2 forms dimers, as its human and murine counterparts. On the other hand, evaluation of FRET in companion samples after a 30-min treatment with SRIF-14 suggested that ligand binding does not alter psst2 dimerization, an observation that would be in line with the reported for its rat homolog, in which the constitutive dimeric state is not appreciably altered by agonist binding (8) but would differ from that found for hsst2, which irreversibly dissociates in response to SRIF (7).
To further clarify this question, we measured FRET in real time in single living cells by monitoring variations of the normalized YFP/CFP ratio, after ensuring that the fluorescent protein did not affect to the psst2 functionality (Fig. 4
). Interestingly, this approach revealed that SRIF caused very rapid, opposite changes in CFP and YFP signals (Fig. 7
), reflecting a dissociation of psst2 dimers that peaks at 11 sec. Moreover, it also showed that the receptor does not remain monomeric because FRET signal recovered its basal level, and thus restored its initial dimeric state, 110 sec after maximal dissociation. In fact, this explains the lack of difference between FRET signal measured in fixed cells before and after 15 min SRIF-14 treatment. This unique dynamic pattern of receptor dimerization, dissociation, and subsequent reassociation differs markedly from that described for hsst2, which does not reassociate after agonist binding (7). Moreover, in view of our present results it seems plausible that the reported inability of rsst2 to dissociate upon agonist binding is more apparent than real, in that the methodology and duration of SRIF-14 treatment used may have not allowed for following this process in sufficient detail (8). In any case, although the precise values of receptor dimerization and internalization may be influenced by the host cell line and receptor density employed as well as other methodological factors, it is conceivable that some of the amino acid differences in the sequences of porcine, human and rat sst2 could be related to these interspecies differences (9).
These distinct, ligand-induced dynamic patterns of receptor-receptor interactions can substantially influence internalization, another key event for receptor function because it has been proposed that sst2 dimers need to dissociate before internalization (7), and this is also the case for the
-opioid receptor (50). To better understand the temporal interrelation between these closely related processes, and after confirming that sst2 internalized upon SRIF-14 binding, we applied a more precise strategy to measure the rate of receptor internalization in living cells, and compared it with the kinetics of receptor-receptor interactions in cells from companion cultures. The study of the internalization dynamics revealed that psst2 is rapidly endocytosed after stimulation with subsaturating concentrations of SRIF-14 (107 M), similar to that reported for hsst2 (13, 51) and rsst2 (52), although to a somewhat lower degree of internalization (25%) than hsst2 (
50%) (13). However, we observed that psst2 internalized faster than its human and rat homologs. Indeed, half-time for psst2 endocytosis was 95.06 sec, whereas a similar level of internalization requires up to 3 min for hsst2 (13) and up to 4 min for rsst2 (52). Of note, we found that in addition to these differences in the rate of endocytosis, psst2 displays a unique relationship between dissociation and internalization because this receptor dissociates in a temporal scale of seconds, and this dissociation always preceded internalization in a scale of minutes. Moreover, whereas monomers reassociate again, internalization is never interrupted. Interestingly, results on the SRIF-induced kinetics of [Ca2+]i in CHO-K1 and HEK-293 AD cells transiently transfected with the psst2-YFP construct, suggest that the time during which the receptor dissociates coincides with an increase in [Ca2+]i, which declines thereafter in a few minutes to recover a basal state, and that during this recovery period the receptor does not respond to a subsequent treatment with SRIF. In light of these findings, it is tempting to propose that functional desensitization of psst2 occurs at an early step in the process of activation of the receptor, which, as described previously (53) would not necessarily require internalization. Hopefully, the methodological and conceptual set of molecular tools developed herein will help us to test this possibility, as well as to assess the possible involvement of other processes such as phosphorylation of the C-terminal tail (2, 54, 55) in the relationship between this complex cascade of events including psst2 association and dissociation, internalization, and desensitization.
In summary, results from this study indicate that psst2 is a potent inhibitory receptor with high affinity and selectivity for its natural ligands, SRIF-14, CST-17, and SRIF-28, and for sst2-directed agonists, and shows a high potency and a modest efficiency to reduce forskolin-induced cAMP production. These findings fit nicely with our recent published results pointing to psst2 as a major inhibitory receptor for GH release in porcine somatotropes (26). Furthermore, application of imaging approaches that enable high temporal and spatial resolution measurements in single living cells has allowed us to discover, for the first time in a sst, that psst2 possesses a unique set of interrelated dynamic features of dimerization, dissociation, internalization, and reassociation, a cascade of events that might be of critical importance for receptor function. These results pave the way to further investigate the precise contribution of this and other sst to the response of porcine somatotropes to SRIF, but also to elucidate the complex interrelations established between psst2 and other sst and GPCRs that underlie and modulate agonist-induced activation of this receptor.
 |
Acknowledgments
|
|---|
The authors are indebted to Drs. F. Gracia-Navarro, R. M. Luque, E. Delgado, and A. Sánchez-Hormigo for their invaluable help in the initial studies on porcine sst. We thank Dr. E. Muñoz-Blanco, University of Córdoba, for providing the HEK-293 AD cell line, and Dr. R. N. Day, University of Virginia, for providing ECFP-C1, EYFP-C1, and E-GFP-N1 plasmids. We also thank M. Gilabert and M. García-Galvín from Novartis, Spain, for the generous gift of Octreotide, and Dr. S. P. Rohrer, from Merck Research Laboratories (Rahway, NJ), for kindly providing the nonpeptidyl sst agonists.
 |
Footnotes
|
|---|
This work was supported by CVI-139 (Plan Andaluz de Investigación, Junta de Andalucía, Spain) and BFU2004-03883 (Ministerio de Educación y Ciencia, Spain/FEDER) (to M.M.M. and J.P.C.); and by Institut National de la Santé et de la Recherche Médicale (Unité 413), IFRMP 23 and the Conseil Régional de Haute-Normandie, and the Bétancourt Perronet Prize (Ministerio de Educación y Ciencia, Spain) (to H.V.).
Disclosure Statement: The authors have nothing to declare.
First Published Online October 19, 2006
Abbreviations: CFP, Cyan fluorescent protein; CHO, Chinese hamster ovary; E-, enhanced-; FRET, fluorescence resonance energy transfer; GFP, green fluorescent protein; GPCRs, G protein-coupled receptors; HEK, human embryonic kidney; SRIF, somatostatin; YFP, yellow fluorescent protein.
Received July 10, 2006.
Accepted for publication October 10, 2006.
 |
References
|
|---|
- Moller LN, Stidsen CE, Hartmann B, Holst JJ 2003 Somatostatin receptors. Biochim Biophys Acta 1616:184[Medline]
- Olias G, Viollet C, Kusserow H, Epelbaum J, Meyerhof W 2004 Regulation and function of somatostatin receptors. J Neurochem 89:10571091[CrossRef][Medline]
- Yamada Y, Post SR, Wang K, Tager HS, Bell GI, Seino S 1992 Cloning and functional characterization of a family of human and mouse somatostatin receptors expressed in brain, gastrointestinal tract, and kidney. Proc Natl Acad Sci USA 89:251255[Abstract/Free Full Text]
- Patel YC 1999 Somatostatin and its receptor family. Front Neuroendocrinol 20:157198[CrossRef][Medline]
- Vanetti M, Kouba M, Wang X, Vogt G, Hollt V 1992 Cloning and expression of a novel mouse somatostatin receptor (SSTR2B). FEBS Lett 311:290294[CrossRef][Medline]
- Weckbecker G, Lewis I, Albert R, Schmid HA, Hoyer D, Bruns C 2003 Opportunities in somatostatin research: biological, chemical and therapeutic aspects. Nat Rev Drug Discov 2:9991017[CrossRef][Medline]
- Grant M, Collier B, Kumar U 2004 Agonist-dependent dissociation of human somatostatin receptor 2 dimers: a role in receptor trafficking. J Biol Chem 279:3617936183[Abstract/Free Full Text]
- Pfeiffer M, Koch T, Schroder H, Klutzny M, Kirscht S, Kreienkamp HJ, Hollt V, Schulz S 2001 Homo- and heterodimerization of somatostatin receptor subtypes. Inactivation of sst(3) receptor function by heterodimerization with sst(2A). J Biol Chem 276:1402714036[Abstract/Free Full Text]
- Grant M, Patel RC, Kumar U 2004 The role of subtype-specific ligand binding and the C-tail domain in dimer formation of human somatostatin receptors. J Biol Chem 279:3863638643[Abstract/Free Full Text]
- Pfeiffer M, Koch T, Schroder H, Laugsch M, Hollt V, Schulz S 2002 Heterodimerization of somatostatin and opioid receptors cross-modulates phosphorylation, internalization, and desensitization. J Biol Chem 277:1976219772[Abstract/Free Full Text]
- Rocheville M, Lange DC, Kumar U, Patel SC, Patel RC, Patel YC 2000 Receptors for dopamine and somatostatin: formation of hetero-oligomers with enhanced functional activity. Science 288:154157[Abstract/Free Full Text]
- Prevost G, Benamouzig R, Veber N, Fajac A, Tatoud R, Degeorges A, Eden P 1997 The somatostatin receptor subtype 2 is expressed in normal and tumoral human tissues70. Cancer Detect Prev 21:6270[Medline]
- Liu Q, Cescato R, Dewi DA, Rivier J, Reubi JC, Schonbrunn A 2005 Receptor signaling and endocytosis are differentially regulated by somatostatin analogs. Mol Pharmacol 68:90101[Abstract/Free Full Text]
- Ren SG, Taylor J, Dong J, Yu R, Culler MD, Melmed S 2003 Functional association of somatostatin receptor subtypes 2 and 5 in inhibiting human growth hormone secretion. J Clin Endocrinol Metab 88:42394245[Abstract/Free Full Text]
- Parmar RM, Chan WW, Dashkevicz M, Hayes EC, Rohrer SP, Smith RG, Schaeffer JM, Blake AD 1999 Nonpeptidyl somatostatin agonists demonstrate that sst2 and sst5 inhibit stimulated growth hormone secretion from rat anterior pituitary cells. Biochem Biophys Res Commun 263:276280[CrossRef][Medline]
- Bossis I, Porter TE 2001 Identification of the somatostatin receptor subtypes involved in regulation of growth hormone secretion in chickens. Mol Cell Endocrinol 182:203213[CrossRef][Medline]
- Schonbrunn A, Gu YZ, Dournard P, Beaudet A, Tannenbaum GS, Brown PJ 1996 Somatostatin receptor subtypes: specific expression and signaling properties. Metabolism 45:811[CrossRef][Medline]
- Chen L, Fitzpatrick VD, Vandlen RL, Tashjian Jr AH 1997 Both overlapping and distinct signaling pathways for somatostatin receptor subtypes SSTR1 and SSTR2 in pituitary cells. J Biol Chem 272:1866618672[Abstract/Free Full Text]
- Koenig JA, Kaur R, Dodgeon I, Edwardson JM, Humphrey PP 1998 Fates of endocytosed somatostatin sst2 receptors and associated agonists. Biochem J 336(Pt 2):291298
- Hipkin RW, Wang Y, Schonbrunn A 2000 Protein kinase C activation stimulates the phosphorylation and internalization of the sst2A somatostatin receptor. J Biol Chem 275:55915599[Abstract/Free Full Text]
- Tulipano G, Stumm R, Pfeiffer M, Kreienkamp HJ, Hollt V, Schulz S 2004 Differential ß-arrestin trafficking and endosomal sorting of somatostatin receptor subtypes. J Biol Chem 279:2137421382[Abstract/Free Full Text]
- Bakker WH, Krenning EP, Breeman WA, Koper JW, Kooij PP, Reubi JC, Klijn JG, Visser TJ, Docter R, Lamberts SW 1990 Receptor scintigraphy with a radioiodinated somatostatin analogue: radiolabeling, purification, biologic activity, and in vivo application in animals. J Nucl Med 31:15011509[Abstract/Free Full Text]
- Hofland LJ, Lamberts SW 2003 The pathophysiological consequences of somatostatin receptor internalization and resistance. Endocr Rev 24:2847[Abstract/Free Full Text]
- Ginj M, Chen J, Walter MA, Eltschinger V, Reubi JC, Maecke HR 2005 Preclinical evaluation of new and highly potent analogues of octreotide for predictive imaging and targeted radiotherapy. Clin Cancer Res 11:11361145[Abstract/Free Full Text]
- Castaño JP, Delgado-Niebla E, Duran-Prado M, Luque RM, Sanchez-Hormigo A, Gracia-Navarro F, Garcia-Navarro S, Kineman RD, Malagon MM 2005 New insights in the mechanism by which SRIF influences GH secretion. J Endocrinol Invest 28:1013[Medline]
- Luque RM, Duran-Prado M, Garcia-Navarro S, Gracia-Navarro F, Kineman RD, Malagon MM, Castaño JP 2006 Identification of the somatostatin receptor subtypes (sst) mediating the divergent, stimulatory/inhibitory actions of somatostatin on growth hormone secretion. Endocrinology 147:29022908[Abstract/Free Full Text]
- Matsumoto K, Yokogoshi Y, Fujinaka Y, Zhang C, Saito S 1994 Molecular cloning and sequencing of porcine somatostatin receptor 2. Biochem Biophys Res Commun 199:298305[CrossRef][Medline]
- Luque RM, Park S, Peng XD, Delgado E, Gracia-Navarro F, Kineman RD, Malagon MM, Castaño JP 2004 Homologous and heterologous in vitro regulation of pig pituitary somatostatin receptor subtypes, sst1, sst2 and sst5 mRNA. J Mol Endocrinol 32:437448[Abstract]
- Fombonne J, Csaba Z, von Boxberg Y, Valayer A, Rey C, Benahmed M, Dournaud P, Krantic S 2003 Expression of somatostatin receptor type-2 (sst2A) in immature porcine Leydig cells and a possible role in the local control of testosterone secretion. Reprod Biol Endocrinol 1:19[CrossRef][Medline]
- Goddard I, Bauer S, Gougeon A, Lopez F, Giannetti N, Susini C, Benahmed M, Krantic S 2001 Somatostatin inhibits stem cell factor messenger RNA expression by Sertoli cells and stem cell factor-induced DNA synthesis in isolated seminiferous tubules. Biol Reprod 65:17321742[Abstract/Free Full Text]
- Krantic S, Benahmed M 2000 Somatostatin inhibits follicle-stimulating hormone-induced adenylyl cyclase activity and proliferation in immature porcine Sertoli cell via sst2 receptor. Biol Reprod 62:18351843[Abstract/Free Full Text]
- Nagai T, Ibata K, Park ES, Kubota M, Mikoshiba K, Miyawaki A 2002 A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol 20:8790[CrossRef][Medline]
- Castaño JP, Torronteras R, Ramirez JL, Gribouval A, Sanchez-Hormigo A, Ruiz-Navarro A, Gracia-Navarro F 1996 Somatostatin increases growth hormone (GH) secretion in a subpopulation of porcine somatotropes: evidence for functional and morphological heterogeneity among porcine GH-producing cells. Endocrinology 137:129136[Abstract]
- Ramirez JL, Gracia-Navarro F, Garcia-Navarro S, Torronteras R, Malagon MM, Castaño JP 2002 Somatostatin stimulates GH secretion in two porcine somatotrope subpopulations through a cAMP-dependent pathway. Endocrinology 143:889897[Abstract/Free Full Text]
- Leroux P GB, Bucharles C, Vaudry H 1991 Autoradiographic study of somatostatin receptors in the rat cerebellum. In: McConn, ed. Methods in neuroscience. 5th ed. San Diego: Academic Press; 538
- Farhan H, Korkhov VM, Paulitschke V, Dorostkar MM, Scholze P, Kudlacek O, Freissmuth M, Sitte HH 2004 Two discontinuous segments in the carboxyl terminus are required for membrane targeting of the rat gamma-aminobutyric acid transporter-1 (GAT1). J Biol Chem 279:2855328563[Abstract/Free Full Text]
- Vilardaga JP, Bunemann M, Krasel C, Castro M, Lohse MJ 2003 Measurement of the millisecond activation switch of G protein-coupled receptors in living cells. Nat Biotechnol 21:807812[CrossRef][Medline]
- Rohrer SP, Birzin ET, Mosley RT, Berk SC, Hutchins SM, Shen DM, Xiong Y, Hayes EC, Parmar RM, Foor F, Mitra SW, Degrado SJ, Shu M, Klopp JM, Cai SJ, Blake A, Chan WW, Pasternak A, Yang L, Patchett AA, Smith RG, Chapman KT, Schaeffer JM 1998 Rapid identification of subtype-selective agonists of the somatostatin receptor through combinatorial chemistry. Science 282:737740[Abstract/Free Full Text]
- OCarroll AM, Raynor K, Lolait SJ, Reisine T 1994 Characterization of cloned human somatostatin receptor SSTR5. Mol Pharmacol 46:291298[Abstract]
- Hershberger RE, Newman BL, Florio T, Bunzow J, Civelli O, Li XJ, Forte M, Stork PJ 1994 The somatostatin receptors SSTR1 and SSTR2 are coupled to inhibition of adenylyl cyclase in Chinese hamster ovary cells via pertussis toxin-sensitive pathways. Endocrinology 134:12771285[Abstract/Free Full Text]
- Strnad J, Hadcock JR 1995 Identification of a critical aspartate residue in transmembrane domain three necessary for the binding of somatostatin to the somatostatin receptor SSTR2. Biochem Biophys Res Commun 216:913921[CrossRef][Medline]
- Carruthers AM, Warner AJ, Michel AD, Feniuk W, Humphrey PP 1999 Activation of adenylate cyclase by human recombinant sst5 receptors expressed in CHO-K1 cells and involvement of G
s proteins. Br J Pharmacol 126:12211229[CrossRef][Medline] - Saveanu A, Gunz G, Dufour H, Caron P, Fina F, Ouafik L, Culler MD, Moreau JP, Enjalbert A, Jaquet P 2001 Bim-23244, a somatostatin receptor subtype 2- and 5-selective analog with enhanced efficacy in suppressing growth hormone (GH) from octreotide-resistant human GH-secreting adenomas. J Clin Endocrinol Metab 86:140145[Abstract/Free Full Text]
- Bruns C, Lewis I, Briner U, Meno-Tetang G, Weckbecker G 2002 SOM230: a novel somatostatin peptidomimetic with broad somatotropin release inhibiting factor (SRIF) receptor binding and a unique antisecretory profile. Eur J Endocrinol 146:707716[Abstract]
- Strnad J, Eppler CM, Corbett M, Hadcock JR 1993 The rat SSTR2 somatostatin receptor subtype is coupled to inhibition of cyclic AMP accumulation. Biochem Biophys Res Commun 191:968976[CrossRef][Medline]
- Yang L, Berk SC, Rohrer SP, Mosley RT, Guo L, Underwood DJ, Arison BH, Birzin ET, Hayes EC, Mitra SW, Parmar RM, Cheng K, Wu TJ, Butler BS, Foor F, Pasternak A, Pan Y, Silva M, Freidinger RM, Smith RG, Chapman K, Schaeffer JM, Patchett AA 1998 Synthesis and biological activities of potent peptidomimetics selective for somatostatin receptor subtype 2. Proc Natl Acad Sci USA 95:1083610841[Abstract/Free Full Text]
- Nunn C, Langenegger D, Hurth K, Schmidt K, Fehlmann D, Hoyer D 2003 Agonist properties of putative small-molecule somatostatin sst2 receptor-selective antagonists. Eur J Pharmacol 465:211218[CrossRef][Medline]
- Beck-Peccoz P, Brucker-Davis F, Persani L, Smallridge RC, Weintraub BD 1996 Thyrotropin-secreting pituitary tumors. Endocr Rev 17:610638[Abstract/Free Full Text]
- Wahid ST, Marbach P, Stolz B, Miller M, James RA, Ball SG 2002 Partial tachyphylaxis to somatostatin (SST) analogues in a patient with acromegaly: the role of SST receptor desensitisation and circulating antibodies to SST analogues. Eur J Endocrinol 146:295302[Abstract]
- Cvejic S, Devi LA 1997 Dimerization of the delta opioid receptor: implication for a role in receptor internalization. J Biol Chem 272:2695926964[Abstract/Free Full Text]
- Cescato R, Schulz S, Waser B, Eltschinger V, Rivier JE, Wester HJ, Culler M, Ginj M, Liu Q, Schonbrunn A, Reubi JC 2006 Internalization of sst2, sst3, and sst5 receptors: effects of somatostatin agonists and antagonists. J Nucl Med 47:502511[Abstract/Free Full Text]
- Elberg G, Hipkin RW, Schonbrunn A 2002 Homologous and heterologous regulation of somatostatin receptor 2. Mol Endocrinol 16:25022514[Abstract/Free Full Text]
- Brasselet S, Guillen S, Vincent JP, Mazella J 2002 ß-Arrestin is involved in the desensitization but not in the internalization of the somatostatin receptor 2A expressed in CHO cells. FEBS Lett 516:124128[CrossRef][Medline]
- Schwartkop CP, Kreienkamp HJ, Richter D 1999 Agonist-independent internalization and activity of a C-terminally truncated somatostatin receptor subtype 2 (
349). J Neurochem 72:12751282[CrossRef][Medline] - Hipkin RW, Friedman J, Clark RB, Eppler CM, Schonbrunn A 1997 Agonist-induced desensitization, internalization, and phosphorylation of the sst2A somatostatin receptor. J Biol Chem 272:1386913876[Abstract/Free Full Text]