help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0460
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latchoumanin, O.
Right arrow Articles by Catelli, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latchoumanin, O.
Right arrow Articles by Catelli, M. G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE
Medline Plus Health Information
*Steroids
Endocrinology Vol. 148, No. 1 422-432
Copyright © 2007 by The Endocrine Society

Reversal of Glucocorticoids-Dependent Proopiomelanocortin Gene Inhibition by Leukemia Inhibitory Factor

Olivier Latchoumanin, Vanessa Mynard, Jocelyne Devin-Leclerc, Marie-Annick Dugué, Xavier Bertagna and Maria Grazia Catelli

Département d’Endocrinologie, Métabolisme et Cancer (O.L., V.M., J.D.-L., X.B., M.G.C.), Institut Cochin, F-75014 Paris, France; Institut National de la Santé et de la Recherche Médicale (O.L., V.M., J.D.-L., X.B., M.G.C.), Unité 567, F-75014 Paris, France; Centre National de la Recherche Scientifique (O.L., V.M., J.D.-L., X.B., M.G.C.), Unité Mixte de Recherche 8104, F-75014 Paris, France; and Faculté de Médecine René Descartes (O.L., V.M., J.D.-L., M.-A.D., X.B., M.G.C.), Université Paris 5, F-75014 Paris, France

Address all correspondence and requests for reprints to: Maria Grazia Catelli, Département d’Endocrinologie, Métabolisme et Cancer, Institut Cochin, 24 rue du faubourg Saint Jacques, F-75014 Paris, France. E-mail: catelli{at}cochin.inserm.fr.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We previously have described molecular mechanisms converging at the Nur response element-signal transducer and activator of transcription (STAT) composite site responsible for synergistic activation of the proopiomelanocortin (POMC) gene promoter by leukemia inhibitory factor (LIF) and CRH. In this study, we asked how glucocorticoids (GC), the physiological negative regulators of POMC gene expression, modulate this synergism. In the corticotroph cell line AtT-20, the response of the wild-type promoter to LIF+CRH was barely inhibited by GC, whereas a distal promoter subregion (–414/–293) encompassing the Nur response element-STAT site and devoid of the negative GC-responsive element located in the proximal domain, displayed a cooperative response to LIF + dexamethasone (DEX) and LIF+CRH+DEX treatments. LIF+CRH-stimulated ACTH secretion was also inefficiently inhibited by DEX in the same cell line. This study was focused thereafter on LIF+DEX cooperativity, which may be responsible, on the wild-type promoter, for lack of negative regulation by DEX of the LIF+CRH synergy. The STAT1–3 low-affinity site, in the context of the (–414/–293) subregion of the POMC promoter, was found necessary and sufficient for transcriptional synergism between activated GC receptor (GR) and STAT1–3. Moreover the activities of reporters specific for STAT1–3 or GR were reciprocally enhanced by DEX or LIF. Single and sequential chromatin immunoprecipitations revealed 1) a STAT-dependent corecruitment of coactivators after LIF and LIF+DEX stimulation and 2) a more lasting recruitment of both STAT3 and GR in the same enhanceosome on the endogenous POMC promoter after LIF+DEX joint stimulation than after the single one. Such events may be responsible for a lack of repressive property of GR unmasked on the whole POMC promoter during LIF+CRH stimulation and may contribute to the tonicity of the hypothalamic-pituitary-adrenal axis during inflammatory-infectious diseases.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IN THE CORTICOTROPH cell of the anterior pituitary, the ACTH precursor polypeptide proopiomelanocortin (POMC) is expressed in a basal and corticotroph-specific manner (1, 2). Most of the basal activity of the POMC gene promoter (–480/+63) is accounted for by its proximal domain with some contribution of the central one. The corticotroph-specific activity resides within a fragment encompassing in part the distal and central domains and bearing regulatory elements for the basic helix-loop-helix heterodimer NeuroD1/BETA2, for the homeobox protein paired-like homeodomain transcription factor 1 (Pitx1) and for Tpit, a Tbox factor restricted to pituitary POMC-expressing cells, the necessary partner of Pitx1 for developmental activation of POMC gene (3, 4, 5, 6, 7).

The physiological regulation of the POMC gene promoter activity is accomplished by the stimulatory action of the hypothalamic peptide CRH and by the inhibitory action of glucocorticoids (GC). Moreover, corticotroph cells are able to respond rapidly to stressful inflammatory and/or infectious stimuli by an increased POMC gene transcription (8, 9). In this context, the cytokine leukemia inhibitory factor (LIF) (10, 11), a potent stimulator of POMC gene transcription (12), through its action at both hypothalamic and pituitary levels, is an important mediator of the neuroendocrine-immunoinflammatory interface (13).

In corticotroph cells, CRH, by increasing cAMP level and activating protein kinase A, that, in turn, modulates L-type Ca2+ channels (14, 15), positively regulates both POMC gene transcription and ACTH secretion. The regulation of POMC gene transcription by CRH seems to be dependent on the induction of expression of members of the Nur family of orphan nuclear receptors (16, 17, 18). However, the early induction of POMC gene transcription by CRH is rapid and does not require de novo protein synthesis (19, 20). Indeed, it has been recently reported that CRH, via protein kinase A and MAPK, regulates the phosphorylation/dephosphorylation state of Nur77, thus increasing its DNA-binding properties, recruitment of coactivators, and transcriptional activity (21, 22, 23). Two Nur targets have been identified in the POMC gene promoter, a proximal Nur77-binding response element (NBRE) (–68/–61), which binds Nur77 or Nur1 monomers (18), and a distal one, the Nur response element (NurRE) (–404/–382), constituted of two everted NBRE-related sites separated by six nucleotides, which binds Nur77/Nurr1 homodimers or heterodimers and was proposed to play a dominant role in mediating stimulation by CRH (16, 17, 22, 23). However, it was recently reported that mutation of the NurRE does not abolish the response to CRH, because this response is poly-scattered in the whole promoter (24).

LIF, a pleiotropic cytokine involved in the inflammatory response and playing fundamental roles in central nervous system (10, 11, 25), also activates hypothalamic-pituitary-adrenal (HPA) axis (13). Indeed LIF, gp190 LIF receptor, and gp130 subunit are all expressed in pituitary corticotroph cells and in murine AtT-20 corticotroph cell line (12, 26, 27). LIF acts via the Janus kinase-signal transducer and activator of transcription (STAT) 1–3 pathway to potently stimulate POMC gene transcription and ACTH secretion (12, 28, 29, 30). A predominant role for STAT3 in the activation of the POMC promoter by LIF was suggested by the inhibition of the response after expression of dominant-negative forms of STAT3 or overexpression of suppressor of cytokine signaling 3 (28, 31).

We have already delimited two LIF-responsive subregions in the POMC gene promoter. The LIF-responsiveness of the distal one (–414/–293) depends on a low-affinity STAT1–3-binding site (–387/–379), overlapping in part the NurRE. This subregion, starting just before the NurRE and ending after the Pitx1 site, includes all the elements important for the POMC gene promoter corticotroph-specific regulation. The second LIF-responsive subregion (–166/–96), lacks elements able to bind STAT proteins, which here may regulate transcription via binding to some constitutively DNA-bound factors.

In the last decade, increasing amounts of evidence have been accumulated on a potent synergy between CRH and LIF at the level of POMC promoter activity (12, 31, 32). We have found that this synergistic response is targeted in large part to the NurRE-STAT composite element where the synergy depends on the formation of a complex including Nur77 and STAT1–3 bound to DNA as well as phosphorylated cAMP response element binding protein (CREB), which participates to transcriptional enhancement in a DNA binding-independent manner (33). Concerning the proximal LIF-responsive subregion (–166/–96), no significant cooperation between LIF and CRH has been found (our unpublished data).

Pathophysiological effects of GC are mediated by their binding to intracellular GC receptor (GR), which functions as a ligand-dependent transcriptional regulator, like the other members of the steroid/thyroid receptors family. GR can activate transcription by binding as homodimer with high affinity to the GC-responsive element (GRE), concomitant with the recruitment of coactivators and contacts with the basal transcription machinery (34, 35). Transcriptional enhancement may also be accomplished by activated GR in a DNA binding-independent way through contacts with transcription factors like STAT3 or STAT5 (36, 37, 38). Transcriptional repression by GR, independent from direct DNA binding, implies direct interaction with transcription factors like AP1 and nuclear factor {kappa}B, which are activated during inflammatory response (39). GR can also repress gene expression by binding to negative response elements (nGRE) which, however, are less characterized compared with their positive counterpart (GRE) (18, 40, 41, 42).

In the HPA axis, GC and GR accomplish an essential repression at the transcription and secretion levels of both CRH and ACTH, providing a negative feedback in basal and stressful conditions (18, 19, 20, 40, 41, 42, 43, 44). Different mechanisms have been proposed for transcriptional repression by GC of CRH and POMC genes. After targeted gene replacement in mice, a mutant GR (GRdim/dim) (45), unable to dimerize and to bind DNA, disrupted the negative feedback in the anterior pituitary at the POMC transcription level, but not in the hypothalamus at the CRH gene level, where targeting of GRnul alleles was necessary to up-regulate CRH expression (46). Thus, concerning the negative regulation of POMC transcription, the previously described nGRE (–69/–55) (40, 42) may account for the negative regulation of the POMC promoter by GR in a DNA-binding-dependent manner. However, the sole nGRE sequence of the POMC promoter is unable to confer dexamethasone (DEX) sensitivity (40, 42), and GC repression may concern other targets on this promoter. Indeed the inactivation of nGRE still maintained the negative regulation by GC of basal and CRH-induced activities (17), and the NurRE was found to be the major site responsible for repression by GC of CRH/Nur stimulatory effects (24). However, activated GR did not repress the basal transcriptional activity of the NurRE reporter (17, 24), suggesting some role for the nGRE region in down-regulation of basal transcription.

Concerning the NurRE as a major target of GC repression, the three members of the Nur family (Nur77, Nurr1, and Nor1) bind the NurRE as homodimers or heterodimers to enhance POMC expression after CRH stimulation, and GC antagonize the response elicited by all Nur factors (23, 24). Reciprocal transcriptional antagonism between GR and Nur factors is based on direct interaction at the level of their DNA-binding domains and seems quite similar to the mechanisms evoked for transcriptional transrepression of AP1 and nuclear factor {kappa}B (47, 48, 49), albeit precise contacts between GR and Nur factors are not yet identified (23, 24).

Whatever the mechanism for transrepression by GR on POMC promoter, here we investigated the ability of GC to counteract the potent transcriptional synergy elicited by the combined LIF+CRH treatment. Surprisingly, we found a synergism between LIF and GC abolishing transrepressive properties of GR.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture
AtT-20/D16v cells were grown in DMEM/nutrient HAM’s F12 mixture (1/1) (Sigma, St. Louis, MO) supplemented with 10% Fetal Clone III (Hyclone, Logan, UT) and 10% Nu Serum (Becton Dickinson, Franklin Lakes, NJ), 2 mM glutamine, and 0.5 mg/ml gentamicin, at 37 C in an atmosphere of 5% CO2.

Plasmids, transfection, luciferase activity, and cell treatment
The NurRE-STAT composite site of the rat POMC gene promoter is given in the following sequence: TAGTGATATTTACCTCCAAATGCCAGGAAGGC where NurRE is underlined and STAT site is in bold. Reporters containing the (–480/–34) rat POMC promoter or its wild-type (–414/–293) or mutated subregion (–414/–293mut) at the NurRE-STAT, as indicated by lowercase letters: TAGcagcgcccACCTCCgggcctCAGcggGGC, as well as reporters constituted of three repeats of NurRE-STAT, NurRE, STAT sequences of the POMC promoter or Sis-inducible element (SIE) sequence, all fused to the minimal (–34/+63) POMC promoter into the pXP1-luciferase vector giving (NurRE-STAT)x3, (NurRE)x3, (STAT)x3, and (SIE)x3, have been already described (16, 33). A reporter with three repeats of the optimized STAT POMC site (catTGCAGGAAGGC) and one with four mutations in the same STAT site (AAAcGCCAGcggGGC, indicated by lower case letters), were also obtained giving (STATopt)x3 and (NurRE-STATMut)x3. TK-Luc and TK(GRE)x2-Luc, PFC31-Luc and 3xTAT-TATA-Luc were already described (50, 51, 52).

Transfection in AtT-20 cells and measurement of luciferase activity were performed as described (33). Cells treatments were as follows: DEX (10–8 M) and RU486 (10–7 M) were added 16 h before and during treatment (6 h) with LIF (2 nM) and/or CRH (50 nM). In our experimental conditions, the previous treatment with DEX was necessary to ensure a reproducible negative regulation of basal and CRH-induced POMC promoter activities.

ACTH assay
AtT-20 cells were serum deprived for 24 h and treated or not, after medium change, with LIF, CRH, and LIF+CRH in the absence or presence of DEX (10–7 M). Twenty-four hours later, ACTH released in the medium was measured using an immunoradiometric assay (Shering BP 32 91192, Gif sur Yvette, France).

Antibodies
We used polyclonal antibody against GR (sc-1004, from Santa Cruz Biotechnology Inc., Santa Cruz, CA) for immunoprecipitation, and polyclonal antibody against STAT1-YP (06–657, from Upstate Biotechnology Inc., Lake Placid, NY) for Western blot revelation. For chromatin immunoprecipitation (ChIP) experiments, antibodies against STAT3 (sc-482), GR (sc-1004), CREB-binding protein (CBP) (sc-369), and steroid receptor coactivator (SRC1) (sc-8995) were from Santa Cruz Biotechnologies Inc.

Immunoprecipitation
Immunoprecipitation experiments were performed with nuclear extracts (30) from AtT-20 cells treated or not with LIF (2 nM), DEX (10–8 M), or LIF+DEX during 20 min. A total of 500 µg nuclear proteins were incubated with 2 µg anti-GR antibody, in twice diluted nuclear extracts preparation buffer, plus 0.3 µg/ml BSA 1 h 30 min at 4 C. Immunoprecipitated complexes were isolated with 25 µl of protein-A Sepharose coupled to magnetic beads (New England Biolabs Inc., Beverly, MA) during 1 h 30 min at 4 C. After four washes with the immunoprecipitation buffer, proteins eluted by 5 min boiling in 100 µl of 1x Laemmli buffer were submitted to SDS-PAGE and Western blotting and revealed with anti-GR and anti-STAT1-YP antibodies. Control experiments for nonspecific immunoprecipitation were performed using unrelated IgG.

ChIP
AtT-20 cells were plated in 15 cm diameter Petri dishes and grown to approximately 90% confluence (~4 x 107 cells, sufficient for three ChIP experimental points), then serum-deprived 16–20 h before treatment or not (control) with LIF (2 nM) or DEX (2 x 10–8 M) or the combined treatment LIF+DEX, during 20 min at 37 C. Methods already described (53, 54) were followed with some modifications.

Cells were washed twice with PBS before cross-linking was achieved in 10 min at room temperature with 1% formaldehyde and quenched with glycine (0.5 M final concentration) during 5 min at room temperature. After two washes with PBS, cells were centrifuged then resuspended in 0.5 ml of lysis buffer (50 mM Tris-HCl, pH 8.1; 10 mM EDTA; 1% SDS) containing protease inhibitors cocktail (Complete; Roche Diagnostics, Indianapolis, IN) and phosphatase inhibitors (5 mM sodium vanadate, 0.05 µM okadaic acid, 5 mM sodium fluoride) before sonication. Supernatants containing sheared soluble chromatin were recovered by centrifugation at 13,000 x g for 10 min at 4 C. DNA fragments from soluble chromatin preparations were approximately 400–500 bp in length. Sonicated extracts diluted twice with dilution buffer (20 mM Tris-HCl, pH 8.1; 2 mM EDTA; 150 mM NaCl; 1% Triton X-100) containing proteases and phosphatases inhibitors as above were precleared by incubation 2 h at 4 C with 2 µg of sheared salmon sperm DNA, 2.5 µg of control IGg, and 20 µl of protein-A Sepharose (Sigma) followed by centrifugation. An aliquot of each supernatant, constituting the input, was removed. Immunoprecipitation was carried out overnight at 4 C with specific antibodies and then, after addition of 20 µl of protein-A Sepharose (in the presence of 2 µg of sheared salmon sperm DNA and of 1% Igepal) and incubation 1 h at 4 C, complexes were isolated by centrifugation. Immunoprecipitates were washed sequentially for 10 min in TSE1 buffer (20 mM Tris-HCl, pH 8.1; 2 mM EDTA; 150 mM NaCl; 1% Triton X-100; 0.1% SDS), TSE2 buffer (20 mM Tris-HCl, pH 8.1; 2 mM EDTA; 500 mM NaCl; 1% Triton X-100; 0.1% SDS), TP3 buffer (10 mM Tris-HCl, pH 8.1; 1 mM EDTA; 1% deoxycholate; 1% Igepal; 0.25 M LiCl), and TE buffer (10 mM Tris-HCl, pH 8.0; 1 mM EDTA). Precipitated complexes were eluted with elution buffer (0.1 M NaHCO3; 1% SDS) three times for 30 min (three times 150 µl) for single ChIP. For sequential ChIP, complexes were eluted twice (two times 50 µl), and then four homologous complexes were pooled, diluted four times with dilution buffer (described above in this paragraph), and adjusted to pH 8 before the second ChIP. At this point, one fourth of the eluates was removed to quantify the first ChIP. Single ChIP eluates were incubated overnight at 65 C to reverse the formaldehyde cross-linking and treated with proteinase K (80 µg each) for 1 h at 45 C. DNA was extracted and precipitated using classical procedure, then resuspended in a final volume of 60 µl of water for the single ChIP experiments, 40 µl for the single ChIP step of the sequential one, and 120 µl for the inputs. For sequential ChIP, the remaining three fourths of the extracts were incubated with the second antibody in the presence of BSA (0.5 mg/ml) and sheared salmon sperm DNA (2 µg), overnight at 4 C. Isolation of the complexes on protein-A Sepharose, washes, elution, reversal of cross-linking, proteinase K treatment, DNA extraction, and precipitation were carried out exactly as described above for single ChIP. At the end, DNA of each sample was resuspended in 30 µl of water.

Quantitative PCR (PCRq) in real time
PCRq of the DNA samples described above was used to assess the extent of specific factors occupancy or co-occupancy at two different locations of the POMC gene. Primers were designed with MacVector 6.5.3 and tested using Oligo 6.0 to minimize primer dimers and to avoid secondary structures. They had calculated Tm of 55 C. Specific primers (forward, AATCTGCGACATAACAAATCCCC and reverse, AGAACTGGACAGAGGCTTAGCGT) amplified a fragment 155 bp long encompassing the NurRE-STAT site of the POMC promoter, whereas control primers (forward, GCTCTTCAAGAACGCCATC and reverse, TGAAGATCAGAGCCGACTGT) amplified a fragment 176 bp long in the exon 3 of the POMC gene, constituting the experimental background.

Each PCR contained 2.5 µl of template DNA, either immunoprecipitated or input, 0.5 µM of each primer (NurRE-STAT or exon 3), 4 mM of MgCl2, and 0.75 µl of 10x Light Cycler Fast Start DNA Master SYBR Green I mix (Roche Diagnostics) in a total volume of 10 µl. Quantitative PCR was performed in glass capillaries on a Light Cycler 2.0 instrument (Roche Diagnostics), using 10 min heating at 95 C followed by 42 cycles of 5 sec at 95 C, 5 sec at 55 C, and 10 sec at 72 C. Each sample was tested in duplicate. Threshold cycles were determined as recommended by the manufacturer’s software using arithmetic baseline adjustment, and analysis was performed following the second derivative maximum calculation. For each PCRq experiment, known quantities of DNA prepared from control cells (input) were used as standard curve from 37.5–2.34 ng of DNA. The threshold cycle of each sample was reported to the standard curve and the relative DNA quantities were calculated by the manufacturer’s software. For each PCRq, the specificity of the amplicon was controlled using the melting temperature profiles of the final product; dissociation curves were automatically measured by the Light Cycler 2.0 instrument. For the calculations of copy numbers, the efficacy of each PCR was taken into account.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GC do not hamper LIF+CRH synergy and enhance LIF-induced transcription
It already has been reported that LIF and CRH synergize in inducing the POMC gene transcription and ACTH secretion (12, 33). Although GC inhibit basal as well as CRH-induced transcriptional activities of the POMC gene promoter, it is not known whether they also negatively regulate the synergistic response to LIF+CRH treatment, which is mediated in large part by the NurRE-STAT composite site located in the (–414/–293) subregion of the promoter (33). Therefore, after transfection in AtT-20 cells of two reporter constructs, the (–480/–34) promoter and the (–414/–293) subregion, each fused to the minimal (–33/+63) POMC promoter, the effects of DEX on basal and stimulated conditions (i.e. no treatment or treatment by LIF, CRH, and LIF+CRH) were studied.

Figure 1AGo is a schematic representation of the POMC promoter and the (–414/–293) subregion. In the whole promoter, the NurRE-STAT site and the nGRE, overlapping in part the NBRE, are represented. The (–414/–293) subregion partially encompasses distal and central domains of the promoter extending from the Nur-RE to Pitx1 site, thus containing all the elements responsible for the corticotroph-specific expression of the POMC gene. Moreover, the Nur-RE is a known target of CRH responsiveness (16, 17, 23, 24), the partially overlapping STAT 1–3 site responds to LIF (30), and the whole composite site is a significant target for LIF+CRH synergy (33). Results shown in Fig. 1BGo confirmed that, on the entire promoter, DEX inhibited by 50% the basal and the 2- to 3-fold CRH-induced activities (17). However, it did not display any effect on LIF responsiveness and barely inhibited the synergistic response to LIF+CRH treatment. The low inhibitory effect of DEX on LIF+CRH transcriptional synergy was unexpected. To understand whether the loss of negative regulation by DEX in the presence of LIF concerns the nGRE and proximal surrounding sequences (40, 42), the inhibition by DEX was analyzed on the (–414/–293) subregion (Fig. 1CGo) containing the NurRE-STAT composite element, the NurRE being the major site for transrepression by GC (24). Aside from the already described inductions by LIF and CRH and their synergistic effect (33), in the presence of DEX, an unexpected 2-fold induction over the control value, an absence of negative effect on the CRH mediated response, and a more than additive induction, when DEX was combined to LIF or to LIF+CRH, were found. These results indicated that this subregion, out of the context of the entire promoter, supports, instead of a negative, a weak positive regulation by DEX. The apparent contradiction with previous literature demonstrating a persistence of negative regulation by DEX after disruption of the nGRE in the entire promoter (17) possibly is due to differences between the reporters used because here the reporter lacks a large nGRE containing region. The 2-fold positive regulation by DEX alone seems to depend on the time of DEX pretreatment (see Materials and Methods). Indeed, when DEX treatment was shorter (6 h) no response was recorded, whereas the positive cooperativity with LIF and LIF+CRH was maintained (data not shown). To understand how DEX enhanced the response to LIF and to LIF+CRH, we tested the (–414/–293) reporter bearing multiple mutations on the NurRE-STAT inhibiting the responses to LIF, to CRH, and the LIF+CRH synergism (33). We found an inhibition of both LIF+DEX and LIF+CRH+DEX responses (Fig. 1DGo), the most striking result being the suppression of triple cooperativity between LIF, CRH, and DEX (Fig. 1CGo), indicating that the NurRE-STAT site is concerned.


Figure 1
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 1. DEX effects on basal and induced activities of the POMC promoter and (–414/–293) subregion. A, Schematic representation of the POMC promoter, the (–414/–239), and the major regulatory sites. AtT-20 cells were transfected with reporter plasmids bearing the POMC promoter (B), the (–414/–293) subregion (C), and the (–414/–293) mutated at the NurRE-STAT site (D), treated or not by DEX, LIF, and/or CRH as described in Materials and Methods. Results, expressed as fold induction over the untreated control (white bars) arbitrarily taken as 1, LIF (hatched bars), CRH (gray bars), and LIF-CRH (black bars), are the means of three independent experiments, each performed in triplicate ± SEM. For each reporter and in the absence of DEX, dots indicate statistically significant differences between induced and control values, whereas, in the right part of the figure, stars indicate differences between minus or plus DEX (one dot/star, P < 0.05; two dots/stars, P < 0.01; three dots/stars, P < 0.001).

 
Because LIF stimulation counteracted the inhibitory effect of DEX on CRH-induced promoter activity, we investigated whether similar effects were also present at the level of ACTH secretion. AtT-20 cells were serum deprived for 24 h and treated, as indicated in Fig. 2Go, after medium change. ACTH level, measured in the medium after 24 h, was increased by LIF and CRH and further augmented by the combined treatment. DEX significantly decreased only the CRH-induced secretion. In conclusion, a lack of inhibitory effect of DEX on LIF+CRH response was recorded, to some extent, at ACTH secretion level.


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
FIG. 2. ACTH secretion. AtT-20 cells were serum deprived for 24 h and treated or not, after medium change, with LIF, CRH, LIF+CRH in the presence or absence of DEX (10–7 M). Twenty-four hours later, ACTH released in the medium was quantified. Values are the means of three independent experiments each performed in duplicate ± SEM. Dots and stars are used as in Fig. 1Go.

 
The STAT site of the POMC promoter is necessary and sufficient for transcriptional cooperation between LIF and GC
To further understand the surprising enhancing effect of DEX on LIF response, we focused on effects of DEX alone or combined with LIF at the level of the NurRE-STAT site using the following constructs: (NurRE-STAT)x3, (NurRE)x3, and (NurRE-STATMut)x3, the last one containing four mutations in the STAT site, the more distal one being included in the proximal part of the Nur-RE. Figure 3AGo shows a 2-fold increase by DEX of the control value, the already described response to LIF (~6-fold) and a potent synergy between LIF and DEX (~33-fold). The synthetic anti-GC RU486 (55) did not change the control and LIF-induced stimulation, and, as expected, inhibited by approximately 100% the low stimulation by DEX of the control value and by 70% the enhancement by DEX of LIF-induced stimulation. By contrast, when using the (NurRE)x3 and the (NurRE-STATMut)x3 constructs, insensitive to LIF, responses to LIF+DEX were lowered to approximately 8- and 6-fold, respectively (Fig. 3Go, B and C). Like the (NurRE-STAT)x3 construct, their basal level was barely induced by DEX, and the overall RU486 inhibitory effect was also similar. In conclusion, the LIF+DEX enhancement observed with the (–414/–293) construct became clearly synergistic with the (NurRE-STAT)x3 and was inhibited by approximately 80% when the STAT site was in part deleted, (NurRE)x3, or mutated, (NurRE-STATMut)x3, suggesting a necessary role for the STAT site of the POMC promoter in the cooperative communication between GC and LIF pathways. Therefore, we asked whether the STAT site of the POMC promoter is sufficient for LIF+DEX cooperation. Two reporters were used, the (STAT)x3 of the POMC promoter and an equivalent construct where mutations in the proximal part of the NurRE sequence were introduced (AAATGCCAGGAA->catTGCCAGGAA), possibly optimizing the STAT site (STATopt)x3. Figure 3Go, D and E, shows that both constructs were barely stimulated by DEX, the LIF response was as expected (33), and the synergy between LIF and DEX was strong and even was increased (~30%) with the optimized STAT site. Thus, the STAT site of the POMC promoter, albeit showing low affinity for activated STAT1–3, is sufficient for LIF+DEX synergy. Moreover, all the reporters displaying LIF+DEX synergy, (NurRE-STAT)x3, (STAT)x3, and (STATopt)x3, showed a further increased response to LIF+CRH+DEX stimulation (data not shown). The low positive response to DEX of all the constructs, including the minimal POMC promoter (see Fig. 4AGo), further increased approximately 2-fold by LIF even in the absence of STAT site, may depend on the effect of activated GR and/or STAT on basal transcription machinery.


Figure 3
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 3. Synergy between DEX and LIF on NurRE-STAT and STAT reporters. AtT-20 cells transfected with the indicated reporter plasmids, (NurRE-STAT)x3 (A), (NurRE)x3 (B), (NurRE-STATmut)x3 (C), (STAT)x3 (D), and (STATopt)x3 (E) were treated or not by LIF, DEX, and/or RU486, as indicated. Results, expressed as fold induction over the control, arbitrarily taken as 1, in the absence (white bars) or in the presence of LIF (gray bars), are the means of at least three independent experiments ± SEM.

 

Figure 4
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 4. Reciprocal cooperation between LIF and DEX in AtT-20 cells on GR and STAT1–3 reporters in AtT-20 cells. AtT-20 cells transfected with the reporters plasmids minimal promoter (–34/+63) (A), (SIE)x3 (B), TK-Luc (C), and (GRE)x2-TK-Luc (D) were treated or not by LIF, DEX, and/or RU486, as indicated. Results, expressed as fold induction over the control, arbitrarily taken as 1, in the absence (white bars) or in the presence of LIF (gray bars), are the means of three independent experiments ± SEM.

 
Reciprocal enhancement by DEX and LIF of STAT1–3- and GR-dependent transcription
Because the behavior of the STAT POMC site is reminiscent of the acute phase response element of the {alpha}2-macroglobulin promoter, the possibility that activated GR and STAT1–3 cooperate in AtT-20 cells at two different enhancer elements, i.e. a STAT site and a GRE, was tested. The (SIE)x3 construct, bearing three copies of the SIE, a reference high-affinity binding site for STAT1–3 (56, 57) fused to the minimal POMC promoter, and the synthetic (GRE)x2 construct, fused to the TK promoter (50) were used (Fig. 4Go). The (SIE)x3 was responsive to DEX and LIF (4- and 9-fold, respectively), displaying a strong LIF+DEX synergy. (GRE)x2 showed a 30-fold induction by DEX treatment, and the response to LIF+DEX was enhanced to 48-fold. Other GRE reporters were tested for enhancement of the Dex response by LIF: a natural GREx3 from tyrosine amino transferase promoter, TAT3-TATA-luc (52), the MMTV promoter pFC31-luc (51), and the whole POMC promoter where the nGRE was converted into GRE (42). Responses to DEX treatment of approximately 11-, 300-, and 21-fold, respectively, were enhanced by LIF to 22-, 510-, and 68-fold (data not shown). Thus, LIF+DEX cooperation takes place in the corticotroph cell line independently of which transcription factor (GR or STAT) is bound to its own enhancer, further suggesting that, upon LIF+DEX treatment, activated GR may act at the STAT1–3 site of the POMC promoter.

Interaction between STAT and GR
The LIF+DEX synergy may result from protein-protein contacts between activated STAT1–3 and ligand-bound GR. Indeed, because activated STAT 1–3 bind to STAT POMC site (30), activated GR may act as a "coactivator." Such an interaction was detected in nuclear extracts from LIF+DEX-treated AtT-20 cells using immunoprecipitation and Western blotting. Figure 5Go shows that STAT1-YP was coimmunoprecipitated by anti-GR antibodies after stimulation with LIF+DEX indicating that this interaction takes place only after activation of both transcription factors. As for STAT3, because it is a sticky protein, either it was contaminating specific and nonspecific immunoprecipitates or it was not detected when using more stringent washing conditions. It should be noted that, after LIF stimulation, the most abundant dimers found in AtT-20 cells are STAT3–3 and STAT1–3 (30). Moreover, interactions between STAT3 and GR have been reported already in other experimental cell systems (37, 38).


Figure 5
View larger version (68K):
[in this window]
[in a new window]

 
FIG. 5. Interaction between STAT1 and GR. Nuclear extracts of AtT-20 cells treated or not by LIF, DEX, or LIF+DEX were immunoprecipitated with anti-GR antibody as described in Materials and Methods. Precipitated proteins were revealed after PAGE and Western blotting with anti-GR and anti-STAT1-YP antibodies. Controls (ns) consisted in immunoprecipitation with unrelated IgG. At least three identical experiments have been performed with similar results.

 
STAT 3 and GR are corecruited at the POMC promoter after LIF+DEX stimulation
ChIP experiments at the level of the endogenous mouse POMC promoter were undertaken in order, first, to examine how activated STAT1–3 and ligand-bound GR contribute to LIF+DEX synergistic response and, second, to study differences in qualitative and quantitative recruitment of both transcription factors and coactivators during single and combined stimulations. It is known that rat and mouse promoters display a high level of sequence identity (~80%) and all the regulatory elements are conserved. After 20 min of LIF, DEX, and LIF+DEX treatments of AtT-20 cells, data of ChIP experiments using anti-STAT3 and anti-GR antibodies (Fig. 6Go) showed that STAT3 was bound to POMC promoter after LIF, and this binding was maintained by the combined LIF+DEX treatment. Recruitment of GR to the promoter was detected after DEX and LIF+DEX treatments. GR binding may occur at nGRE and/or, via Nur, at NurRE, even though results of transfection experiments described above are in favor, after LIF+DEX stimulation, of a simultaneous presence of GR and STAT at the STAT site of the POMC promoter, STAT being directly bound to DNA. By ChIP and analysis of the amplified fragments on agarose gel, we were unable, in the absence of LIF treatment, to detect a signal for STAT3 above the IgG signal.


Figure 6
View larger version (50K):
[in this window]
[in a new window]

 
FIG. 6. STAT3 and GR recruitment at the POMC promoter. AtT-20 cells were untreated or treated during 20 min with LIF, DEX, or LIF+DEX. ChIPs were performed as described in Materials and Methods using antibodies against STAT3, GR, or unrelated IgGs. A, Schematic representation of the amplified specific promoter fragment encompassing the NurRE-STAT composite site. B, Analysis of the amplified fragment in agarose gel. At least three identical experiments have been performed with similar results.

 
To investigate whether activated STAT3 and GR are recruited to the same enhanceosome complex on the POMC gene promoter after the combined LIF+DEX stimulation, quantitative PCR in real time was performed after simple and sequential ChIP using anti-STAT3 or anti-GR as first antibodies and, as control, PCR primers derived from the exon 3 of the POMC gene. Results shown in Fig. 7Go confirmed those obtained by agarose gel analysis after simple ChIP (Fig. 6Go). As expected, STAT3 and GR loading onto the promoter was specifically increased by LIF or DEX treatment, respectively, and both were present after the combined stimulation. Double ChIP with anti-STAT3 or anti-GR demonstrated that both transcription factors were specifically corecruited only after LIF+DEX stimulation. Thus, STAT3 and GR participate to the same complex regulating the POMC gene transcription, GR being devoid of transrepressive property.


Figure 7
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 7. Co-occupancy by STAT3 and GR of the POMC promoter after LIF+DEX treatment. AtT-20 cells were untreated or treated during 20 min with LIF, DEX, or LIF+DEX. Simple and sequential ChIPs were performed, and extracted DNA fragments were quantified by PCRq as described in Materials and Methods. Results are expressed as copy numbers obtained with the NurRE-STAT-specific primers, immunoprecipitated with anti-STAT3 (white bars), anti-GR (gray bars), anti-STAT3 followed by anti-GR (hatched bars), and anti-GR followed by anti-STAT3 (black bars). Results obtained with the exon 3 control primers in the same experiment are represented in the bottom graph. At least three identical experiments have been performed with similar results.

 
Coactivators recruitment
The activation of the POMC gene promoter by LIF+DEX, compared with LIF alone, may differ in qualitative or quantitative recruitment of in coactivators. Thus the presence of SRC1 and CBP, both known as coactivators of STAT3 and steroid receptors (58, 59, 60), was tested by sequential ChIP in control, LIF-, and LIF+DEX-treated AtT-20 cells. The same pattern of STAT recruitment was found (Fig. 8Go) after the first ChIP with anti-STAT3. The sequential ChIP with anti-SRC1 and anti-CBP, while showing a 8- to 9-fold increased recruitment of both coactivators, compared with control cells, did not show different recruitment between LIF and LIF+DEX stimulation. These results do not exclude that other coactivators may be recruited in a differential manner.


Figure 8
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 8. SRC1 and CBP recruitment at the POMC promoter after LIF and LIF+DEX stimulation. AtT-20 cells were untreated or treated during 20min with LIF or LIF+DEX. Simple and sequential ChIPs were performed and extracted DNA fragments were quantified by PCRq as described in Materials and Methods. Results are expressed as fold induction of copy numbers obtained with the NurRE-STAT-specific primers, after immunoprecipitation with anti-STAT3 (white bars), anti-STAT3 followed by anti-CBP (black bars), and anti-STAT3 followed by anti-SRC (hatched bars). Values obtained with the exon 3 control primers in the same experiment are represented in the bottom graph. At least three identical experiments have been performed with similar results.

 
Kinetics of STAT3 and GR recruitment
Then, we hypothesized that kinetics of STAT3 and GR recruitment may differ between simple (LIF or DEX) and combined (LIF+DEX) stimulation. Thus, we compared by ChIP analysis the loading of each factor onto the POMC promoter after different times of treatment. Figure 9Go shows that the increased levels of STAT3 and GR after 20 min of LIF or DEX treatment were back to control values after 60 min, whereas, after LIF+DEX stimulation, STAT3 decrease was less pronounced at twice the control value at 60 min, and GR level remained the same as at 20 min. Therefore, the chromatin complex of the POMC promoter containing activated STAT3 and GR seems more stable than those containing only STAT3 or GR. It is known that the rate "on and off" of transcription factors at specific sites in the chromatin is very rapid (61, 62). Thus, the apparent increased stability of the enhanceosome containing STAT3 and GR is better explained by a more persistent recruitment of both transcription factors.


Figure 9
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 9. Kinetics of STAT and GR recruitment at the POMC promoter after single (LIF or DEX) or combined (LIF+DEX) stimulations. AtT-20 cells were untreated or treated during the indicated times with LIF or LIF+DEX. Simple ChIPs were performed, and extracted DNA fragments were quantified by PCRq as described in Materials and Methods. Results are expressed as fold induction compared with control (no treatment), arbitrarily represented as 1, obtained with the NurRE-STAT-specific primers, after immunoprecipitation with anti-STAT3 and anti-GR, as indicated. At least three identical experiments have been performed with similar results.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pathophysiological regulators of the POMC promoter include, beside GR and CRH, a large number of proinflammatory cytokines (8, 9) cooperating with CRH and/or being, per se, like LIF and other members of the IL-6 family, potent stimulators of the POMC gene transcription (12). Molecular mechanisms involved in transcriptional enhancement of the POMC promoter activity by LIF, as well as in the potent synergy between LIF and CRH, have been in large part described (12, 30, 31, 32, 33); however, it was not known how GC modulate such transcriptional events.

Here, on the whole POMC promoter activity, we report the expected stimulation by CRH and the negative regulation by DEX. However, in the presence of LIF, the negative regulation by DEX is absent and the inhibition of the LIF+CRH synergy is inefficient, suggesting that stimulation by LIF precludes most of DEX inhibitory effect. In parallel with the low transcriptional inhibition by GC of the LIF+CRH effect, DEX does not inhibit completely the secretion of ACTH induced by LIF+CRH in AtT-20 cells.

The inefficient inhibition by DEX of LIF+CRH synergy is highlighted by data obtained with the (–414/–293) reporter, unmasking a transcriptional cooperation between LIF and DEX that was not evident with the entire promoter. This construct contains the NurRE-STAT composite site, target for LIF+CRH synergy, the NurRE being the major target for inhibition by GC of CRH/Nur-dependent stimulation, albeit unable on its own to sustain negative regulation by GC (17, 24). Data of Fig. 1BGo bring evidence for a weak stimulation by DEX (absent, however, when the treatment was short), for synergy between LIF and DEX, as well as for a triple cooperation between LIF+CRH+DEX that was further increased compared with (–414/–293), when using (NurRE-STAT)x3 and (STAT)x3 reporters (data not shown). Moreover, in the context of our experimental conditions, the negative regulation by GC seems to require the entire promoter, suggesting a role for the nGRE region. All DEX-dependent responses are reversed by the anti-GC RU486, including the negative regulation of the entire promoter (data not shown). Mutation of the composite site is in favor of its involvement in the combined LIF+CRH+DEX effects. Thus, a LIF+DEX cooperativity, evident when using the (–414/–293) reporter and cryptic when using the whole POMC promoter, may be crucial to understand the response of this promoter to LIF+CRH+DEX and prompted us to investigate the underlining molecular mechanisms of LIF+DEX, leaving aside those involved in the triple stimulation.

Concerning the sequence necessary and sufficient for LIF+DEX synergy, our results point to the low-affinity STAT1–3-binding site (–387/–379) of the POMC promoter. This is reminiscent of what has been observed in other promoters lacking a GRE: a positive cooperation between STAT5 and GR on the ß-casein gene promoter (36) and of STAT3 and GR on the {alpha}2-macroglobulin and fibrinogen gene promoter (37, 38). Indeed, a reciprocal cooperation between LIF and DEX takes place in AtT-20 cell line, as demonstrated using two reporters, the first one, (SIE)x3, specific for STAT1–3-dependent activation, and the second, (GRE)x2, specific for GR-dependent activation. Thus, in the corticotroph cell line AtT-20, the STAT site of the POMC gene promoter is able to sustain an "acute phase-like transcriptional response", based on the positive cooperation between LIF and GC pathways. Protein-protein interactions between activated GR and STAT5 or STAT3 have been documented (36, 37, 38). Even though we were unable to demonstrate coimmunoprecipitation between GR and STAT3, we have found an interaction between GR and STAT1-YP, and we know that STAT3–3 and STAT1–3 are the most abundant STAT site-binding dimers in AtT-20 cells after LIF activation (30).

After LIF+DEX treatment, the formation of an "enhanceosome" at the endogenous mouse POMC promoter, to which activated STAT3 and GR may participate, was substantiated using ChIP approach. The POMC gene promoter displays a nonnegligible basal activity, and this study, concerning enhancements of basal POMC gene transcription, is limited to two transcription factors of interest, STAT3 and GR, and candidate coactivators of SRC and CBP/p300 families, known to interact with STAT proteins and steroid receptors (58, 59, 60). Results derived from the application of simple and sequential ChIP to the POMC gene promoter, after LIF and DEX stimulations, demonstrate, beside the co-occupancy of the promoter by STAT3 and GR during LIF+DEX treatment, a more sustained recruitment upon time of both factors. In this complex, the interaction of GR with putative corepressors may be lost, thus accounting for positive LIF+DEX communication responsible for lack of negative regulation by DEX of LIF+CRH-induced transcriptional synergism and increased ACTH secretion.

Results of ChIP experiments can be summarized and discussed following Fig. 10Go. 1) In baseline conditions, low levels of Nur77 are able to bind their cognate element (22, 33). 2) After LIF stimulation, STAT3 is fully recruited to its low-affinity site together with SRC1 and CBP. 3) After DEX treatment, GR is recruited on the POMC promoter. It may be tethered to NurRE, via Nur (22), without excluding recruitment at the nGRE. Putative corepressors involved in negative regulation remain unknown. 4) The joint LIF+DEX stimulation results in a simultaneous presence of STAT and GR into the same enhanceosomal structure, as demonstrated by sequential ChIP, concomitant with the recruitment of SRC1 and CBP. Indeed, SRC1 and CBP were equally recruited after LIF and LIF+DEX, and not after DEX alone (data not shown) and, by participating to an increased occupancy by GR and STAT of the POMC promoter chromatin, may contribute to dissociation of putative corepressors from GR and to attenuation of DEX-negative effects. Corecruitment of GR and STAT3 is similar to that described for the {alpha}2-macroglobulin gene (38) where GR, per se, has no major role in transcriptional activation, even if it is detected after 5 min of DEX treatment, whereas STAT3 appears only after 10 min of IL-6 stimulation. The IL-6+DEX combined stimulation leads to quantitative and temporal increased recruitment of both transcription factors, in turn responsible for the maximal activation of the promoter (38).


Figure 10
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 10. Schematic representation of proposed LIF+DEX-induced interactions at POMC gene promoter. A, In baseline conditions, Nur77 is bound at NurRE (22 ). B, After LIF, STAT3 and coactivators (SRC1/CBP) are recruited at the STAT site (this work). C, DEX tethers GR and a putative corepressor at NurRE, via Nur77 (22 24 ), and some communication (double arrow) may exist with the nGRE-bound GR. D, After LIF+DEX, via interaction with STAT3 and coactivators (this work), GR may lose a putative corepressor.

 
Because LIF+CRH synergism induces formation, at the NurRE-STAT composite site, of a complex containing Nur77, STAT1–3, CREB (33), and presumably coactivators, it is reasonable to propose that, upon LIF+CRH+DEX stimulation, the transrepression function of GR is abrogated or shifted to transactivation, explaining the high level of transcriptional activity of the whole POMC promoter. Protein composition of the POMC promoter enhanceosome formed during LIF+CRH+DEX stimulation, and interactions between transcription factors and coregulators are under current investigation. The human POMC promoter is also a target of LIF+CRH synergy (27) and even though the responsive elements have not been identified yet, we can predict that it will be also a target of LIF+DEX cooperation.

During infectious or immunoinflammatory stress, LIF, by attenuating the negative regulation by DEX at POMC gene transcription and ACTH secretion levels, may burst the tonicity of the HPA axis. We have shown that, in AtT-20 cells, DEX poorly inhibits the LIF+CRH-induced ACTH secretion. This result is in agreement with studies of the HPA axis functioning in mice with LIF-KO or overexpressing LIF in the anterior pituitary. LIF-KO mice display a reduced responsiveness of the HPA axis to inflammatory or restraint stress, with reduced increases of POMC mRNA, circulating ACTH, and corticosterone (63). When LIF overexpression is targeted to the anterior pituitary, the gland development is affected, with predominance of corticotroph cells leading to a Cushing’s-like syndrome with somatotroph and gonadotroph partial deficiencies (64).

In conclusion, we have demonstrated that, when the LIF pathway is activated, GC-GR loses its repressive property participating to POMC gene promoter regulation using mechanisms similar to those described for the positive cooperation between GC and IL-6 in the induction of some acute phase genes expression.


    Acknowledgments
 
This work is dedicated to the memory of Susanne Nicouleau. S.N. actively sustained the Ligue contre le Cancer (Indre, France) until her last days. We thank Dr. Maria Angeles Ventura for critical reading of the manuscript and Franck Letourneur for help with PCRq.


    Footnotes
 
This work was supported by the Institut National de la Santé et de la Recherche Médicale, the Centre National de la Recherche Scientifique, and Ligue National contre le Cancer (grant to M.G.C.). O.L. was a fellow of Ligue contre le Cancer (Indre) and V.M. was a fellow of Association pour la Recherche sur le Cancer.

Disclosure Statement: All of the authors have nothing to disclose.

First Published Online October 12, 2006

Abbreviations: CBP, cAMP response element binding protein-binding protein; ChIP, chromatin immunoprecipitation; CREB, cAMP response element binding protein; DEX, dexamethasone; GC, glucocorticoid; GR, GC receptor; GRE, GC-responsive element; HPA, hypothalamic-pituitary-adrenal; LIF, leukemia inhibitory factor; NBRE, Nur77-binding response element; nGRE, negative GRE; NurRE, Nur response element; PCRq, quantitative PCR; POMC, proopiomelanocortin; SIE, Sis-inducible element; SRC1, steroid receptor coactivator; STAT, signal transducer and activator of transcription.

Received April 10, 2006.

Accepted for publication October 4, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Jeannotte L, Trifiro MA, Plante RK, Chamberland M, Drouin J 1987 Tissue-specific activity of the pro-opiomelanocortin gene promoter. Mol Cell Biol 7:4058–4064[Abstract/Free Full Text]
  2. Tremblay Y, Tretjakoff I, Peterson A, Antakly T, Zhang CX, Drouin J 1988 Pituitary-specific expression and glucocorticoid regulation of a proopiomelanocortin fusion gene in transgenic mice. Proc Natl Acad Sci USA 85:8890–8894[Abstract/Free Full Text]
  3. Lamolet B, Pulichino AM, Lamonerie T, Gauthier Y, Brue T, Enjalbert A, Drouin J 2001 A pituitary cell-restricted T box factor, Tpit, activates POMC transcription in cooperation with Pitx homeoproteins. Cell 104:849–859[CrossRef][Medline]
  4. Lamonerie T, Tremblay JJ, Lanctot C, Therrien M, Gauthier Y, Drouin J 1996 Ptx1, a bicoid-related homeo box transcription factor involved in transcription of the pro-opiomelanocortin gene. Genes Dev 10:1284–1295[Abstract/Free Full Text]
  5. Poulin G, Turgeon B, Drouin J 1997 NeuroD1/ß2 contributes to cell-specific transcription of the proopiomelanocortin gene. Mol Cell Biol 17:6673–6682[Abstract]
  6. Therrien M, Drouin J 1991 Pituitary pro-opiomelanocortin gene expression requires synergistic interactions of several regulatory elements. Mol Cell Biol 11:3492–3503[Abstract/Free Full Text]
  7. Therrien M, Drouin J 1993 Molecular determinants for cell specificity and glucocorticoid repression of the proopiomelanocortin gene. Ann NY Acad Sci 680:663–671[Medline]
  8. Chrousos GP 1995 The hypothalamic-pituitary-adrenal axis and immune-mediated inflammation. N Engl J Med 332:1351–1362[Free Full Text]
  9. Turnbull AV, Rivier CL 1999 Regulation of the hypothalamic-pituitary-adrenal axis by cytokines: actions and mechanisms of action. Physiol Rev 79:1–71[Abstract/Free Full Text]
  10. Gearing DP 1993 The leukemia inhibitory factor and its receptor. Adv Immunol 53:31–58[Medline]
  11. Metcalf D 1992 Leukemia inhibitory factor—a puzzling polyfunctional regulator. Growth Factors 7:169–173[Medline]
  12. Ray DW, Ren SG, Melmed S 1996 Leukemia inhibitory factor (LIF) stimulates proopiomelanocortin (POMC) expression in a corticotroph cell line. Role of STAT pathway. J Clin Invest 97:1852–1859[Medline]
  13. Ray D, Melmed S 1997 Pituitary cytokine and growth factor expression and action. Endocr Rev 18:206–228[Abstract/Free Full Text]
  14. Kovalovsky D, Refojo D, Liberman AC, Hochbaum D, Pereda MP, Coso OA, Stalla GK, Holsboer F, Arzt E 2002 Activation and induction of NUR77/NURR1 in corticotrophs by CRH/cAMP: involvement of calcium, protein kinase A, and MAPK pathways. Mol Endocrinol 16:1638–1651[Abstract/Free Full Text]
  15. von Dreden G, Loeffler JP, Grimm C, Hollt V 1988 Influence of calcium ions on proopiomelanocortin mRNA levels in clonal anterior pituitary cells. Neuroendocrinology 47:32–37[CrossRef][Medline]
  16. Philips A, Lesage S, Gingras R, Maira MH, Gauthier Y, Hugo P, Drouin J 1997 Novel dimeric Nur77 signaling mechanism in endocrine and lymphoid cells. Mol Cell Biol 17:5946–5951[Abstract]
  17. Philips A, Maira M, Mullick A, Chamberland M, Lesage S, Hugo P, Drouin J 1997 Antagonism between Nur77 and glucocorticoid receptor for control of transcription. Mol Cell Biol 17:5952–5959[Abstract]
  18. Murphy EP, Conneely OM 1997 Neuroendocrine regulation of the hypothalamic pituitary adrenal axis by the nurr1/nur77 subfamily of nuclear receptors. Mol Endocrinol 11:39–47[Abstract/Free Full Text]
  19. Gagner JP, Drouin J 1985 Opposite regulation of pro-opiomelanocortin gene transcription by glucocorticoids and CRH. Mol Cell Endocrinol 40:25–32[CrossRef][Medline]
  20. Gagner JP, Drouin J 1987 Tissue-specific regulation of pituitary proopiomelanocortin gene transcription by corticotropin-releasing hormone, 3',5'-cyclic adenosine monophosphate, and glucocorticoids. Mol Endocrinol 1:677–682[Abstract/Free Full Text]
  21. Maira M, Couture C, Le Martelot G, Pulichino AM, Bilodeau S, Drouin J 2003 The T-box factor Tpit recruits SRC/p160 co-activators and mediates hormone action. J Biol Chem 278:46523–46532[Abstract/Free Full Text]
  22. Maira M, Martens C, Batsche E, Gauthier Y, Drouin J 2003 Dimer-specific potentiation of NGFI-B (Nur77) transcriptional activity by the protein kinase A pathway and AF-1-dependent coactivator recruitment. Mol Cell Biol 23:763–776[Abstract/Free Full Text]
  23. Maira M, Martens C, Philips A, Drouin J 1999 Heterodimerization between members of the Nur subfamily of orphan nuclear receptors as a novel mechanism for gene activation. Mol Cell Biol 19:7549–7557[Abstract/Free Full Text]
  24. Martens C, Bilodeau S, Maira M, Gauthier Y, Drouin J 2005 Protein-protein interactions and transcriptional antagonism between the subfamily of NGFI-B/Nur77 orphan nuclear receptors and glucocorticoid receptor. Mol Endocrinol 19:885–897[Abstract/Free Full Text]
  25. Butzkueven H, Zhang JG, Soilu-Hanninen M, Hochrein H, Chionh F, Shipham KA, Emery B, Turnley AM, Petratos S, Ernst M, Bartlett PF, Kilpatrick TJ 2002 LIF receptor signaling limits immune-mediated demyelination by enhancing oligodendrocyte survival. Nat Med 8:613–619[CrossRef][Medline]
  26. Akita S, Webster J, Ren SG, Takino H, Said J, Zand O, Melmed S 1995 Human and murine pituitary expression of leukemia inhibitory factor. Novel intrapituitary regulation of adrenocorticotropin hormone synthesis and secretion. J Clin Invest 95:1288–1298[Medline]
  27. Shimon I, Yan X, Ray DW, Melmed S 1997 Cytokine-dependent gp130 receptor subunit regulates human fetal pituitary adrenocorticotropin hormone and growth hormone secretion. J Clin Invest 100:357–363[Medline]
  28. Bousquet C, Melmed S 1999 Critical role for STAT3 in murine pituitary adrenocorticotropin hormone leukemia inhibitory factor signaling. J Biol Chem 274:10723–10730[Abstract/Free Full Text]
  29. Chesnokova V, Melmed S 2002 Minireview: neuro-immuno-endocrine modulation of the hypothalamic-pituitary-adrenal (HPA) axis by gp130 signaling molecules. Endocrinology 143:1571–1574[Abstract/Free Full Text]
  30. Mynard V, Guignat L, Devin-Leclerc J, Bertagna X, Catelli MG 2002 Different mechanisms for leukemia inhibitory factor-dependent activation of two proopiomelanocortin promoter regions. Endocrinology 143:3916–3924[Abstract/Free Full Text]
  31. Bousquet C, Zatelli MC, Melmed S 2000 Direct regulation of pituitary proopiomelanocortin by STAT3 provides a novel mechanism for immuno-neuroendocrine interfacing. J Clin Invest 106:1417–1425[Medline]
  32. Bousquet C, Ray DW, Melmed S 1997 A common pro-opiomelanocortin-binding element mediates leukemia inhibitory factor and corticotropin-releasing hormone transcriptional synergy. J Biol Chem 272:10551–10557[Abstract/Free Full Text]
  33. Mynard V, Latchoumanin O, Guignat L, Devin-Leclerc J, Bertagna X, Barre B, Fagart J, Coqueret O, Catelli MG 2004 Synergistic signaling by corticotropin-releasing hormone and leukemia inhibitory factor bridged by phosphorylated 3',5'-cyclic adenosine monophosphate response element binding protein at the Nur response element (NurRE)-signal transducers and activators of transcription (STAT) element of the proopiomelanocortin promoter. Mol Endocrinol 18:2997–3010[Abstract/Free Full Text]
  34. Mangelsdorf DJ, Thummel C, Beato M, Herrlich P, Schutz G, Umesono K, Blumberg B, Kastner P, Mark M, Chambon P, Evans RM 1995 The nuclear receptor superfamily: the second decade. Cell 83:835–839[CrossRef][Medline]
  35. Schaaf MJ, Cidlowski JA 2002 Molecular mechanisms of glucocorticoid action and resistance. J Steroid Biochem Mol Biol 83:37–48[CrossRef][Medline]
  36. Stocklin E, Wissler M, Gouilleux F, Groner B 1996 Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383:726–728[CrossRef][Medline]
  37. Zhang Z, Jones S, Hagood JS, Fuentes NL, Fuller GM 1997 STAT3 acts as a co-activator of glucocorticoid receptor signaling. J Biol Chem 272:30607–30610[Abstract/Free Full Text]
  38. Lerner L, Henriksen MA, Zhang X, Darnell Jr JE 2003 STAT3-dependent enhanceosome assembly and disassembly: synergy with GR for full transcriptional increase of the {alpha}2-macroglobulin gene. Genes Dev 17:2564–2577[Abstract/Free Full Text]
  39. De Bosscher K, Vanden Berghe W, Haegeman G 2003 The interplay between the glucocorticoid receptor and nuclear factor-{kappa}B or activator protein-1: molecular mechanisms for gene repression. Endocr Rev 24:488–522[Abstract/Free Full Text]
  40. Drouin J, Trifiro MA, Plante RK, Nemer M, Eriksson P, Wrange O 1989 Glucocorticoid receptor binding to a specific DNA sequence is required for hormone-dependent repression of pro-opiomelanocortin gene transcription. Mol Cell Biol 9:5305–5314[Abstract/Free Full Text]
  41. Malkoski SP, Dorin RI 1999 Composite glucocorticoid regulation at a functionally defined negative glucocorticoid response element of the human corticotropin-releasing hormone gene. Mol Endocrinol 13:1629–1644[Abstract/Free Full Text]
  42. Drouin J, Sun YL, Chamberland M, Gauthier Y, De Lean A, Nemer M, Schmidt TJ 1993 Novel glucocorticoid receptor complex with DNA element of the hormone-repressed POMC gene. EMBO J 12:145–156[Medline]
  43. Cole TJ, Blendy JA, Monaghan AP, Krieglstein K, Schmid W, Aguzzi A, Fantuzzi G, Hummler E, Unsicker K, Schutz G 1995 Targeted disruption of the glucocorticoid receptor gene blocks adrenergic chromaffin cell development and severely retards lung maturation. Genes Dev 9:1608–1621[Abstract/Free Full Text]
  44. Raber J 1998 Detrimental effects of chronic hypothalamic-pituitary-adrenal axis activation. From obesity to memory deficits. Mol Neurobiol 18:1–22[CrossRef][Medline]
  45. Reichardt HM, Kaestner KH, Tuckermann J, Kretz O, Wessely O, Bock R, Gass P, Schmid W, Herrlich P, Angel P, Schutz G 1998 DNA binding of the glucocorticoid receptor is not essential for survival. Cell 93:531–541[CrossRef][Medline]
  46. Tronche F, Kellendonk C, Kretz O, Gass P, Anlag K, Orban PC, Bock R, Klein R, Schutz G 1999 Disruption of the glucocorticoid receptor gene in the nervous system results in reduced anxiety. Nat Genet 23:99–103[CrossRef][Medline]
  47. Meyer T, Starr DB, Carlstedt-Duke J 1997 The rat glucocorticoid receptor mutant K461A differentiates between two different mechanisms of transrepression. J Biol Chem 272:21090–21095[Abstract/Free Full Text]
  48. Nissen RM, Yamamoto KR 2000 The glucocorticoid receptor inhibits NF{kappa}B by interfering with serine-2 phosphorylation of the RNA polymerase II carboxy-terminal domain. Genes Dev 14:2314–2329[Abstract/Free Full Text]
  49. Starr DB, Matsui W, Thomas JR, Yamamoto KR 1996 Intracellular receptors use a common mechanism to interpret signaling information at response elements. Genes Dev 10:1271–1283[Abstract/Free Full Text]
  50. Beato M, Herrlich P, Schutz G 1995 Steroid hormone receptors: many actors in search of a plot. Cell 83:851–857[CrossRef][Medline]
  51. Gouilleux F, Sola B, Couette B, Richard-Foy H 1991 Cooperation between structural elements in hormono-regulated transcription from the mouse mammary tumor virus promoter. Nucleic Acids Res 19:1563–1569[Abstract/Free Full Text]
  52. Liu W, Wang J, Sauter NK, Pearce D 1995 Steroid receptor heterodimerization demonstrated in vitro and in vivo. Proc Natl Acad Sci USA 92:12480–12484[Abstract/Free Full Text]
  53. Barre B, Vigneron A, Coqueret O 2005 The STAT3 transcription factor is a target for the Myc and riboblastoma proteins on the Cdc25A promoter. J Biol Chem 280:15673–15681[Abstract/Free Full Text]
  54. Shang Y, Hu X, DiRenzo J, Lazar MA, Brown M 2000 Cofactor dynamics and sufficiency in estrogen receptor-regulated transcription. Cell 103:843–852[CrossRef][Medline]
  55. Ulmann A, Teutsch G, Philibert D 1990 Ru 486. Sci Am 262:42–48[Medline]
  56. Ehret GB, Reichenbach P, Schindler U, Horvath CM, Fritz S, Nabholz M, Bucher P 2001 DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites. J Biol Chem 276:6675–6688[Abstract/Free Full Text]
  57. Horvath CM, Wen Z, Darnell Jr JE 1995 A STAT protein domain that determines DNA sequence recognition suggests a novel DNA-binding domain. Genes Dev 9:984–994[Abstract/Free Full Text]
  58. Giraud S, Bienvenu F, Avril S, Gascan H, Heery DM, Coqueret O 2002 Functional interaction of STAT3 transcription factor with the coactivator NcoA/SRC1a. J Biol Chem 277:8004–8011[Abstract/Free Full Text]
  59. Paulson M, Pisharody S, Pan L, Guadagno S, Mui AL, Levy DE 1999 Stat protein transactivation domains recruit p300/CBP through widely divergent sequences. J Biol Chem 274:25343–25349[Abstract/Free Full Text]
  60. Xu J, Li Q 2003 Review of the in vivo functions of the p160 steroid receptor coactivator family. Mol Endocrinol 17:1681–1692[Abstract/Free Full Text]
  61. McNally JG, Muller WG, Walker D, Wolford R, Hager GL 2000 The glucocorticoid receptor: rapid exchange with regulatory sites in living cells. Science 287:1262–1265[Abstract/Free Full Text]
  62. Stenoien DL, Patel K, Mancini MG, Dutertre M, Smith CL, O’Malley BW, Mancini MA 2001 FRAP reveals that mobility of oestrogen receptor-{alpha} is ligand- and proteasome-dependent. Nat Cell Biol 3:15–23[CrossRef][Medline]
  63. Chesnokova V, Auernhammer CJ, Melmed S 1998 Murine leukemia inhibitory factor gene disruption attenuates the hypothalamo-pituitary-adrenal axis stress response. Endocrinology 139:2209–2216[Abstract/Free Full Text]
  64. Yano H, Readhead C, Nakashima M, Ren SG, Melmed S 1998 Pituitary-directed leukemia inhibitory factor transgene causes Cushing’s syndrome: neuro-immune-endocrine modulation of pituitary development. Mol Endocrinol 12:1708–1720[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Latchoumanin, O.
Right arrow Articles by Catelli, M. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Latchoumanin, O.
Right arrow Articles by Catelli, M. G.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*DEXAMETHASONE
Medline Plus Health Information
*Steroids


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals