help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1119
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, A. W.
Right arrow Articles by Barsh, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, A. W.
Right arrow Articles by Barsh, G. S.
Endocrinology Vol. 148, No. 1 72-80
Copyright © 2007 by The Endocrine Society

Inactivation of Signal Transducer and Activator of Transcription 3 in Proopiomelanocortin (Pomc) Neurons Causes Decreased Pomc Expression, Mild Obesity, and Defects in Compensatory Refeeding

Allison W. Xu, Linda Ste-Marie, Christopher B. Kaelin and Gregory S. Barsh

Departments of Genetics and Pediatrics, Stanford University School of Medicine, Stanford, California 94305

Address all correspondence and requests for reprints to: Allison W. Xu, Diabetes Center, University of California, San Francisco, San Francisco, California 94143. E-mail: axu{at}diabetes.ucsf.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Leptin is an adipocyte-derived hormone that signals body energy status to the brain by acting on multiple neuronal subgroups in the hypothalamus, including those that express proopiomelanocortin (Pomc) and agouti-related protein (Agrp). Signal transducer and activator of transcription 3 (Stat3) is an important intracellular signaling molecule activated by leptin, and previous studies have shown that mice carrying a mutated leptin receptor that abolished Stat3 binding are grossly obese. To determine the extent to which Stat3 signaling in Pomc neurons was responsible for these effects, we constructed Pomc-specific Stat3 mutants using a Cre recombinase transgene driven by the Pomc promoter. We find that Pomc expression is diminished in the mutant mice, suggesting that Stat3 is required for Pomc transcription. Pomc-specific Stat3 female mutant mice exhibit a 2-fold increase in fat pad mass but only a slight increase in total body weight. Mutant mice remain responsive to leptin-induced hypophagia and are not hypersensitive to a high-fat diet; however, mutant mice fail to mount a normal compensatory refeeding response. These results demonstrate a requirement for Stat3 in transcriptional regulation of Pomc but indicate that this circuit is only one of several components that underlie the neuronal response to leptin and the role of Stat3 in that response.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
ENERGY BALANCE IS controlled by the coordinated action of hypothalamic neurons, which sense and integrate peripheral signals that report changes in body energy stores. Leptin, an adipocyte-derived hormone circulating at levels proportional to body fat mass, signals energy status to the brain by directly acting on target neurons in the hypothalamus (reviewed in Ref. 1). Located in the arcuate nucleus of the hypothalamus, two groups of neurons, agouti-related protein (Agrp) and proopiomelanocortin (Pomc) neurons, express leptin receptors and exert opposite effects on energy balance. Agrp stimulates feeding, and overexpression of Agrp causes obesity (2). In contrast, Pomc neurons secrete the neuropeptide {alpha}-MSH, which decreases food intake and increases energy expenditure. Mutations of the Pomc gene in mice or in humans causes profound obesity (3, 4, 5, 6, 7), underscoring the essential role of Pomc in regulation of energy balance.

Several observations indicate that Pomc and Pomc neurons are positively regulated by leptin and/or changes in energy balance. First, leptin causes depolarization of Pomc neurons (8); second, in leptin-deficient ob/ob mice, expression of Pomc is reduced and can be activated by leptin administration (9). Finally, in normal mice, Pomc mRNA levels are reduced during fasting when leptin levels are low and up-regulated during forced overfeeding (10).

One of the best characterized components in leptin signaling is signal transducer and activator of transcription 3 (Stat3). Phosphorylated Stat3 (pStat3) is a potent transcriptional activator of many target genes (11, 12), and leptin administration causes rapid phosphorylation of Stat3 in the hypothalamus (13). Previous studies in transfected cells indicate that leptin induced Pomc promoter activity via Stat3 activation (14). Most important, a neural-specific deletion of Stat3 using a Cre recombinase transgene driven by the Nestin promoter caused severe obesity and reduced expression of Pomc and recapitulated the phenotype of mice deficient in leptin or its receptor (15). Moreover, mice carrying a mutated leptin receptor that abolished Stat3 binding are grossly obese with decreased Pomc but not Agrp and neuropeptide Y (Npy) expression (16). These results have led to a view whereby Stat3-mediated regulation of Pomc transcription constitutes a major component of how the central nervous system responds to leptin. However, more recent studies have revealed a role for additional leptin-responsive neurons outside the arcuate nucleus of the hypothalamus (17, 18) and additional intracellular mediators of leptin besides Stat3 (19, 20, 21).

We have previously described the characterization of Cre recombinase transgenes under control of Pomc or Agrp regulatory sequences and the application of these transgenes to study specific signaling molecules or cell types (6, 20). Surprisingly, we found that removal of activatable Stat3 from Agrp neurons had no effect on Agrp mRNA levels (22). Here we have applied a similar strategy to remove activatable Stat3 specifically from the Pomc neurons. We find that mutant mice exhibit reduced levels of Pomc mRNA, indicating that Stat3 is essential for modulating Pomc expression. Mutant female mice exhibit mild obesity with a 2-fold increase in isolated fat pad mass. Moreover, mutant mice remain leptin responsive but exhibit defects in compensatory refeeding. Thus, Stat3 is required for transcriptional regulation of Pomc, but this circuit is only one of several components that underlie the neuronal response to leptin and the role of Stat3 in that response.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mouse genetics
Animals carrying the R26R LacZ reporter allele were obtained from Dr. Phillipe Soriano (University of Washington) and are maintained in our laboratory as homozygotes on a mixed background that includes contributions from FVB/N, C57BL/6J, and 129 strains. The Tg.PomcCre was maintained as heterozygotes on the same mixed background. Construction and application of the Stat3 conditional (Stat3flox/flox) has been described previously (23). In brief, the loxP sites flank exon 22, which encodes a phosphorylation site that is required for normal Stat3 function. Animals with Pomc-specific Stat3 deletion were generated by intercrossing Tg.PomcCre/+ and Stat3flox/flox mice. To help control for differences in litter size and modifier genes, results were analyzed by two-way ANOVA in which sibship was included as a variable. Although the genetic background is heterogeneous, there is less variation (both environmental and genetic) within litters than between litters. Animals were housed in a room with a 12-h light (0700–1900 h), 12-h dark cycle. Mice were fed standard mouse chow (14 kcal% fat, 60 kcal% carbohydrates, 26 kcal% protein, ProLab RMH 3000; LabDiet, Richmond, IN). For high-fat feeding, mice at 10 wk of age were placed on a high-fat diet (45 kcal% fat, 35 kcal% carbohydrates, 20 kcal% protein; Research Diets, Inc., New Brunswick, NJ) for a total of 12 wk. All experiments were carried out under a protocol approved by the Stanford Administrative Panel on Laboratory Animal Care.

Body composition and percent adiposity
Body fat mass, lean mass, and bone density of 3.5-month-old mice were determined by dual-energy x-ray absorptiometry (DEXA) using a PIXImus2 instrument (Lunar Corp., Madison, WI). The machine was calibrated using the Phantom mouse supplied by the manufacturer, which has a Phantom value of 16.1% fat and 0.0624 g/cm2 bone density. Quality control was performed to fit within ±2% of the standard value before each experiment. Percent adiposity was determined by adding the weights of the scapular, inguinal, retroperitoneal, and reproductive fat pads and dividing by body weight. Percent adiposity was determined from nine Pomc-Stat3 mutants and six control females (age, ~4–6 months) and four males of each genotype (age, ~6–8 months).

Measurement of serum circulating leptin levels
For leptin measurements, plasma was collected from mice fed ad libitum. The samples were centrifuged, plasma was removed, and levels were determined using a mouse leptin ELISA (Crystal Chem, Downers Grove, IL). Circulating leptin levels were determined from nine Pomc-Stat3 mutants and six control females (age, ~4–6 months) and five Pomc-Stat3 knockout and four control males (age, ~6–8 months).

Gene expression analysis
Gene expression analysis was performed as described previously (6). Measurements of mRNA levels were carried out by quantitative RT-PCR on RNA extracted from dissected hypothalamic tissue isolated from 3.5-month-old mice. Total RNA for each hypothalamus was quantified by spectrophotometry after purification using TRIzol reagent (Invitrogen, Carlsbad, CA) and an RNeasy mini kit (QIAGEN, Valencia, CA). Then, 250 ng of each total RNA sample was reverse transcribed and PCR amplified using a Lightcycler (Roche Applied Science, Indianapolis, IN) and SYBR green to measure relative cDNA levels. All neuropeptide expression was normalized by ß-actin expression. Agrp primers were TGCTACTGCCGCTTCTTCAA and CTTTGCCCAAACAACATCCA; Npy primers were TAACAAGCGAATGGGGCTGT and ATCTGGCCATGTCCTCTGCT; Pomc primers were AGGCCTGACACGTGGAAGAT and AGGCACCAGCTCCACACAT; Cart primers were GTGCTTGTGAAGGGACGACA and AGCCAGGCTCCAGGGATAAT; and Actb primers were CTGCGTTTTACACCCTTTCTTTG and GCCATGCCAATGTTGTCTCTTAT. Efficiency for each primer set was estimated from standard curves made with serial cDNA dilutions.

X-gal staining and immunohistochemistry
Colocalization studies were performed as previously described (20). Briefly, weight-matched mice were injected ip with leptin (3.5 mg/kg), and the animals were perfused with 4% paraformaldehyde 45 min later. Brains were removed, placed in fixative overnight, and infiltrated with 30% sucrose in PBS at 4 C, and then 12-µm frozen sections were prepared and mounted on Superfrost/Plus slides. Sections were washed with 0.1% Triton X-100 in PBS and then incubated with X-gal staining buffer (5 mM potassium ferricyanide, 5 mM potassium ferrocyanide, 2 mM MgCl2, and 1 mg/ml X-gal) overnight at 37 C. After X-gal staining, sections were washed and immunostained with a phospho-Y705 Stat3 antibody (Cell Signaling Technology, Beverly, MA) according to the manufacturer’s protocols.

Leptin sensitivity assay
The mice (5 months old) were singly housed for greater than 1 wk before the start of the experiment. One week before leptin injections, all animals were injected once a day at 1500 h with PBS vehicle. Body weight and food intake were measured at this time. On d 1 of the experiment, food was removed from the cages at 1300 h. At 1500 h, mice were injected ip with either 5 mg/kg leptin (R&D Systems, Minneapolis, MN) or vehicle (half of each genotype got vehicle, and half got leptin). The next morning, mice received another injection of either leptin or vehicle at 0800 h. At 0900 h, food was returned to the hopper and food intake measurements were taken 2, 4, 8, and 24 h later. Body weight was measured 24 h later. The experiment was repeated after 1 wk. The animals that received vehicle in the first round received leptin in the second round and vice versa. Mice were housed in a room with a 12-h light (0700–1900 h), 12-h dark cycle.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pomc-Stat3 knockout mice do not show phosphorylation of Stat3 in the Pomc neurons after leptin administration
Mice carrying Tg.PomcCre, previously employed and characterized in multiple studies (6, 20, 24, 25), were crossed with animals carrying Stat3flox, a gene-targeted Stat3 allele with loxP sites that flank exon 22, which encodes a tyrosine residue whose phosphorylation is critical for Stat3 dimerization and nuclear translocation (23).

We first investigated the ability of leptin to induce phosphorylation of Stat3 in control and Pomc-specific Stat3 mutant mice. Control (Tg.PomcCre/+; Stat3+/+) and mutant (Tg.PomcCre/+; Stat3flox/flox) animals were crossed to mice harboring the Cre reporter allele Gt(Rosa)26Sortm1Sor (R26R). LacZ expression of the R26R allele is activated upon Cre-mediated recombination, and therefore serves as a cell-autonomous marker to mark the Pomc neurons in histological studies. Forty-five minutes after ip administration of leptin, animals were euthanized, and hypothalamic sections were double stained for ß-galactosidase activity and immunohistochemical presence of pStat3.

In this preparation, a perinuclear dot of blue X-gal staining marks Pomc neurons, whereas brown staining of the entire nucleus signifies pStat3 immunostaining (Fig. 1Go, E and F). As expected, leptin-treated animals exhibited nuclear pStat3 accumulation in many neurons throughout the hypothalamus similar to what was reported before (14, 26); close inspection of the arcuate nucleus reveals that about 39% of the Pomc neurons are positive for pStat3 upon leptin treatment (Fig. 1Go, E and G). However, in Pomc-specific Stat3 mutant mice, Pomc neurons failed to stain with pStat3 (Fig. 1FGo). The pattern of pStat3 staining outside the arcuate nucleus was identical in control and Pomc-specific Stat3 mutant mice, demonstrating failure of leptin-induced pStat3 specifically in the Pomc neurons.


Figure 1
View larger version (77K):
[in this window]
[in a new window]

 
FIG. 1. Leptin fails to induce pStat3 in the Pomc neurons in Pomc-Stat3 mutant mice. Leptin induced pStat3 (brown nuclear staining) in the hypothalamus in the control (A and C) and the mutant mice (B and D). Controls, n = 3; mutants, n = 3. E and F show a region of the arcuate nucleus where Pomc neurons are identified by expressing lacZ (perinuclear blue dots). Arrows indicate colocalization of pStat3 immunostaining with the Pomc neurons. G, Quantification of Pomc neurons that are positive for pStat3 upon leptin administration; 39.2% (121 of 312) Pomc neurons (blue neurons) are positive for pStat3 (dark brown staining) in the controls, and 4.7% (23 of 464) Pomc neurons are positive for pStat3 in the Pomc-Stat3 mutants. Cells were counted in a blinded fashion. **, P < 0.01 as determined by Student’s t test.

 
Weight gain, growth, and feeding abnormalities in Pomc-specific Stat3 mutant mice
To generate a large cohort of mutant and control mice for physiological studies, we first established a breeding colony of animals homozygous for the Stat3flox allele among which segregation of the Tg.PomcCre allele determined assignment to control (+/+; Stat3flox/flox) or mutant (Tg.PomcCre/+; Stat3flox/flox) group. In separate studies (data not shown), we found that neither Tg.PomcCre nor the Stat3floxby itself had any effect on body weight regulation, food consumption, linear growth, or body composition.

Body weight gain over a 6-month period was the same in male mutant compared with male control mice (Fig. 2AGo). Mutant females, however, exhibited a 5–10% increase in body weight compared with control females, which first became apparent at 2 months of age (Fig. 2BGo). Using DEXA to measure body composition, mutant females, but not males, showed a modest but significant increase in fat mass, with no apparent change in lean body mass (Fig. 2Go, C and D). To gain more information about fat distribution, scapular, inguinal, reproductive, and retroperitoneal fat pads were isolated. Male mutant mice did not exhibit a significant increase in any of the fat depots examined (Fig. 2EGo). However, inguinal, reproductive, and retroperitoneal fat pads showed a significant 2-fold increase in female Pomc-Stat3 mutants (Fig. 2FGo), with a nearly 2-fold increase in percent adiposity (Fig. 2GGo). Both females and males exhibited a trend in which mutant animals were slightly longer than control animals, but these changes were not significant (supplemental Fig. 1, published as supplemental data on The Endocrine Society’s Journals Online web site at http://endo.endojournals.org). In addition, bone density was identical between controls and mutants (supplemental Fig. 1).


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 2. Body weight and body composition of control and Pomc-Stat3 mutant mice. A and B, Body weight curve for males (controls n = 17, mutants n = 22; upper left panel) and females (control n = 20, mutant n = 24; upper right panel); C and D, analysis of lean body mass and fat mass in control and mutant animals by DEXA (control male n = 10, mutant male n = 11, control female n = 10, mutant female n = 18); E and F, weight of isolated fat pads from male or female Pomc-Stat3 mutant mice (control male n = 4, mutant male n = 4, control female n = 6, mutant female n = 9); G, percent adiposity of Pomc-Stat3 mutants. Percent adiposity was determined by adding the weights of the scapular, inguinal, retroperitoneal, and reproductive fat pads and dividing by body weight. *, P < 0.05; **, P < 0.01 as determined by Student’s t test.

 
To better understand the basis for mild obesity in female Pomc-specific Stat3 mutant mice, we measured both daily food consumption (averaged over 7–14 d) and ability to mount a compensatory refeeding response after a 48-h fast. Under ad libitum feeding, mutant females showed a mild but significant increase in food intake (Fig. 3AGo). Food intake was no different between mutant and control male mice (data not shown). When allowed to refeed after a 48-h fast, mutant and control female mice consumed the same amount of food in a 24-h period (Fig. 3BGo) but showed a slight decrease when compared with their normal food intake (Fig. 3CGo). However, control mice normalized their body weight after 24 h of refeeding, whereas mutant mice were unable to do so (Fig. 3DGo).


Figure 3
View larger version (20K):
[in this window]
[in a new window]

 
FIG. 3. Food intake and compensatory refeeding in female Pomc-Stat3 mutant and control mice. A, Ad libitum daily food intake in control and Pomc-Stat3 mutant mice. Mice were singly housed for 1–2 wk before the start of feeding measurement. Daily food intake is an average of food intake over the course of 7–10 d (control n = 12, mutant n = 12). B, The 24-h refeeding after a 48-h fasting; 24-h refeeding is the amount of food consumed during the initial 24-h period after food is returned after a 48-h fast. C, The 24-h refeeding compared with normal daily food intake. D, Percent weight recovery after 24-h refeeding. Percent weight recovery = (weight after 24-h refeeding – prefasted body weight)/prefasted body weight (control n = 9, mutant n = 8). *, P < 0.05; **, P < 0.01 as determined by ANOVA.

 
Neuropeptide gene expression in Pomc-specific Stat3 mutant mice
Next, we measured neuropeptide mRNA levels in hypothalamic biopsies of normal and Pomc-specific Stat3 mutant mice using real-time quantitative PCR. Similar to the sexual dimorphism in body weight described above, levels of hypothalamic Pomc mRNA were significantly reduced in mutant females but not in mutant males (Fig. 4Go). We also measured expression of Cart, Agrp, and Npy mRNA levels and observed no difference between control and mutant animals in either males or females (Fig. 4Go).


Figure 4
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 4. Expression of neuropeptides in control and Pomc-Stat3 mutant mice. Pomc, Cart, Agrp, and Npy mRNA expression were analyzed by quantitative RT-PCR from control and Pomc-Stat3 mutant mice. ß-Actin was used as an internal control to normalize expression levels. Control values are made 100% in the y-axis for easy comparison (control male n = 6, mutant male n = 6, control female n = 6, mutant female n = 7). **, P < 0.01 as determined by Student’s t test.

 
Sensitivity to leptin and high-fat diet in Pomc-specific Stat3 mutant mice
To examine whether Pomc-Stat3 mutant mice have reduced sensitivity to leptin, we first measured circulating leptin levels in these mice. Neither male nor female mutant mice showed significant increase in serum leptin levels, although there is a trend in the female mutants (Fig. 5AGo). To test directly whether or not Stat3 signaling in Pomc neurons was required for leptin-induced anorexia, we examined the time course of food consumption and weight gain in mutant and control female animals after leptin treatment. We used a paradigm and crossover study design in which the same animals received either leptin or vehicle 1 wk apart. Leptin treatment reduced food intake by approximately 20% in both control and mutant mice; this effect was detectable by 2 h and remained apparent up to 24 h after leptin treatment (Fig. 5BGo). Hence, Pomc-specific Stat3 mutant mice maintain their ability to respond to leptin.


Figure 5
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 5. Sensitivity to leptin and diet-induced obesity in Pomc-Stat3 mutant mice. A, Circulating leptin levels were determined by ELISA (control male n = 4, mutant male n = 4, control female n = 6, mutant female n = 9). B, Sensitivity to leptin-induced anorexia. Food intake was measured at different time intervals (2, 4, 8, and 24 h) after ip leptin administration (5 mg/kg) (control n = 9, mutant n = 9). C and D, Body weight when feeding a high-fat diet (45 kcal% fat, 35 kcal% carbohydrate, 20 kcal% protein; Research Diets, Inc.) for 12 wk. Wild-type (WT) male n = 2, Het male n = 6, mutant male n = 5; WT female n = 3, Het female n = 4, and mutant female n = 5.

 
Finally, we investigated whether disruption of Stat3 function in the Pomc neurons predisposes mice to diet-induced obesity. Mice were placed on a high-fat diet (45 kcal% fat) for a total of 12 wk. No significant difference in body weight increase was observed in male or female mutant mice (Fig. 5Go, C and D) compared with wild-type and heterozygous controls.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutation of the Stat3 binding site in the leptin receptor produced mice that are grossly obese (16), suggesting that Stat3 function is essential in mediating leptin signaling directly in first-order leptin target neurons. Pomc and Agrp/Npy neurons in the arcuate nucleus of the hypothalamus are key first-order neurons that express leptin receptors. Pomc expression, but not Agrp/Npy expression is reduced in mice carrying the mutated leptin receptor with no Stat3 signaling, suggesting that the gross obesity phenotype could be attributed to lack of Stat3 function in the Pomc neurons (16). In this study, we showed that removal of activatable Stat3 from Pomc neurons causes reduced levels of Pomc mRNA and increase in adiposity in a sex-specific manner. In recent studies analogous to those described here where we removed activatable Stat3 from Agrp neurons, we observed no effect on Agrp mRNA levels (22). Thus, there exists an interesting dichotomy for the role of Stat3 in transcriptional regulation of arcuate nucleus neuropeptide, in that it is required for normal regulation of Pomc but not of Agrp or Npy. The reduction of Pomc mRNA levels in the mutant mice described here is likely to be an important contributor to their abnormal phenotype, because both the molecular and the physiological abnormalities were present in females but not in males. Hence, our result that Pomc, but not the Agrp expression, is regulated by leptin-mediated Janus kinase (Jak)-Stat3 signaling is consistent with what was observed in mice with a mutated leptin receptor that is incapable of Jak-Stat3 signaling (16). The differential requirement of Jak-Stat3 signaling by leptin in the regulation of gene expression suggests that different signaling mechanisms are engaged in these two neuronal subtypes, or that compensatory mechanisms develop in a cell-type-specific fashion.

The mechanism of sex-dimorphic regulation of Pomc expression by Stat3 is currently unknown. However, a gender-specific response to leptin has been described, in that females are more sensitive to the anorexic effects of leptin than males and that such differences are controlled by gonadal hormones (27, 28). So, it is possible that sex hormones may interact with leptin signaling to influence Pomc expression.

We have previously shown that Pomc neurons, but not the Agrp neurons, are required for normal compensatory refeeding (6). The Pomc-specific Stat3 mutant mice described here exhibit similar defects in compensatory refeeding, which suggests that modulation of Stat3 contributes to the mechanism by which Pomc expression is regulated in response to negative energy balance. It is interesting to note that Pomc-specific Stat3 mutant mice have a normal response to leptin, whereas deletion of suppressor of cytokine signaling-3 (Socs3) from the Pomc neurons results in increased leptin sensitivity (29). It is possible that Socs3 might inhibit other signaling pathways of leptin in addition to the Jak-Stat3 pathway. Socs3 has been shown to induce insulin resistance in peripheral tissue via inhibition of tyrosine phosphorylation of insulin receptor substrate (IRS)-1 and -2 (30). Because IRS-phosphatidyinositol-3-kinase signaling has been implicated in leptin signaling (19, 20), it is possible that deletion of Socs3 leads to increased leptin signaling via the Jak-Stat3 and IRS-phosphatidyinositol-3-kinase pathways. Deletion of Socs3 could potentially lead to increased insulin sensitivity as well.

Recent studies have investigated the involvement of Pomc neurons in the nucleus of the solitary tract (NTS) of the caudal brainstem. One study has shown that leptin does not stimulate pStat3 in Pomc neurons in the NTS (31), whereas a different study has reached the opposite conclusion (32). Our preliminary results show that Cre is expressed in the NTS of the Pomc-Cre mice (6), suggesting that Stat3 is also abolished in the Pomc neurons in the NTS. However, the mild phenotype in Pomc-Stat3 knockout mice (especially in the males) suggests that Stat3 in the NTS Pomc neurons does not play a major role in energy balance regulation.

In light of the dominant view in the field that Pomc neurons are primary first-order neurons that mediate leptin function, it is somewhat surprising that deletion of Stat3 function from the Pomc neurons results in only a mild phenotype, and even those are apparent only in female animals. These mild effects are in sharp contrast with the neural-specific Stat3 deletion (15), which develop severe obesity, hyperglycemia, and infertility. These results are consistent with a modified view of central control of energy homeostasis whereby leptin signals through multiple, possibly redundant, groups of neurons in several regions of the brain. Indeed, this view is consistent with recent work of Balthasar et al. (33) and Dhillon et al. (17), in which cell-type-specific removal of the leptin receptor in a subpopulation of neurons in the hypothalamus caused mild obesity.

An alternative hypothesis to account for the surprisingly mild phenotype we observed is to posit that Pomc neurons do, indeed, serve as a primary conduit for leptin signaling but that the signaling itself is transmitted via intracellular mediators in addition to Stat3. However, this seems less likely given the phenotype of animals with Pomc-specific deletion of the leptin receptor, in which one of the most surprising aspects is the relatively mild extent of their obesity (33). In this respect, an important puzzle is why removal of the Pomc gene itself causes severe obesity (4, 5, 7), much greater than that caused by removal of Stat3 or the leptin receptor from Pomc neurons. Recent studies have revealed several novel mechanisms involved in central nervous system regulation of energy homeostasis, including changes in electrical activity (8, 34), modulation of synaptic plasticity (35), and de novo neurogenesis (36). In addition, a simple explanation for the apparent discrepancy between the severe phenotype caused by removal of Pomc and the mild phenotypes caused by removal of Pomc-specific leptin signaling machinery could be that Pomc neurons receive leptin input indirectly from other leptin-responsive neurons in several brain regions. This latter view, in which non-Pomc leptin-responsive neurons might feed through Pomc neurons, is consistent with a role of Agrp/Npy neurons in providing inhibitory GABA input onto Pomc neurons (8, 34) and with the recent discovery of a circuit from the ventromedial hypothalamus to Pomc neurons (18). Neuron-specific disruption of additional signaling molecules will help dissect the unique function of these molecules in individual neuronal subtypes and will provide insight into the multitude of neuronal circuits in the regulation of energy homeostasis.


    Acknowledgments
 
We thank Dr. Akira at Osaka University for providing the Stat3flox/flox mice.


    Footnotes
 
This work was supported by grants from the National Institutes of Health to G.S.B. (DK48506 and DK68384).

Disclosure Statement: The authors have nothing to disclose.

First Published Online October 5, 2006

Abbreviations: Agrp, Agouti-related protein; DEXA, dual-energy x-ray absorptiometry; IRS, insulin receptor substrate; Jak, Janus kinase; Npy, neuropeptide Y; NTS, nucleus of the solitary tract; Pomc, proopiomelanocortin; pStat3, phosphorylated Stat3; Socs3, suppressor of cytokine signaling-3; Stat3, signal transducer and activator of transcription 3.

Received August 16, 2006.

Accepted for publication September 25, 2006.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schwartz MW, Woods SC, Porte Jr D, Seeley RJ, Baskin DG 2000 Central nervous system control of food intake. Nature 404:661–671[Medline]
  2. Ollmann MM, Wilson BD, Yang YK, Kerns JA, Chen Y, Gantz I, Barsh GS 1997 Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278:135–138[Abstract/Free Full Text]
  3. Krude H, Biebermann H, Luck W, Horn R, Brabant G, Gruters A 1998 Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nat Genet 19:155–157[CrossRef][Medline]
  4. Yaswen L, Diehl N, Brennan MB, Hochgeschwender U 1999 Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat Med 5:1066–1070[CrossRef][Medline]
  5. Coll AP, Challis BG, Lopez M, Piper S, Yeo GS, O’Rahilly S 2005 Proopiomelanocortin-deficient mice are hypersensitive to the adverse metabolic effects of glucocorticoids. Diabetes 54:2269–2276[Abstract/Free Full Text]
  6. Xu AW, Kaelin CB, Morton GJ, Ogimoto K, Stanhope K, Graham J, Baskin DG, Havel P, Schwartz MW, Barsh GS 2005 Effects of hypothalamic neurodegeneration on energy balance. PLoS Biol 3:e415
  7. Smart JL, Tolle V, Low MJ 2006 Glucocorticoids exacerbate obesity and insulin resistance in neuron-specific proopiomelanocortin-deficient mice. J Clin Invest 116:495–505[CrossRef][Medline]
  8. Cowley MA, Smart JL, Rubinstein M, Cerdan MG, Diano S, Horvath TL, Cone RD, Low MJ 2001 Leptin activates anorexigenic POMC neurons through a neural network in the arcuate nucleus. Nature 411:480–484[CrossRef][Medline]
  9. Schwartz MW, Seeley RJ, Woods SC, Weigle DS, Campfield LA, Burn P, Baskin DG 1997 Leptin increases hypothalamic pro-opiomelanocortin mRNA expression in the rostral arcuate nucleus. Diabetes 46:2119–2123[Abstract]
  10. Hagan MM, Rushing PA, Schwartz MW, Yagaloff KA, Burn P, Woods SC, Seeley RJ 1999 Role of the CNS melanocortin system in the response to overfeeding. J Neurosci 19:2362–2367[Abstract/Free Full Text]
  11. Aaronson DS, Horvath CM 2002 A road map for those who don’t know JAK-STAT. Science 296:1653–1655[Abstract/Free Full Text]
  12. Levy DE, Darnell Jr JE 2002 Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 3:651–662[CrossRef][Medline]
  13. Vaisse C, Halaas JL, Horvath CM, Darnell Jr JE, Stoffel M, Friedman JM 1996 Leptin activation of Stat3 in the hypothalamus of wild-type and ob/ob mice but not db/db mice. Nat Genet 14:95–97[CrossRef][Medline]
  14. Munzberg H, Huo L, Nillni EA, Hollenberg AN, Bjorbaek C 2003 Role of signal transducer and activator of transcription 3 in regulation of hypothalamic proopiomelanocortin gene expression by leptin. Endocrinology 144:2121–2131[Abstract/Free Full Text]
  15. Gao Q, Wolfgang MJ, Neschen S, Morino K, Horvath TL, Shulman GI, Fu XY 2004 Disruption of neural signal transducer and activator of transcription 3 causes obesity, diabetes, infertility, and thermal dysregulation. Proc Natl Acad Sci USA 101:4661–4666[Abstract/Free Full Text]
  16. Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AW, Wang Y, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers Jr MG 2003 STAT3 signalling is required for leptin regulation of energy balance but not reproduction. Nature 421:856–859[CrossRef][Medline]
  17. Dhillon H, Zigman JM, Ye C, Lee CE, McGovern RA, Tang V, Kenny CD, Christiansen LM, White RD, Edelstein EA, Coppari R, Balthasar N, Cowley MA, Chua Jr S, Elmquist JK, Lowell BB 2006 Leptin directly activates SF1 neurons in the VMH, and this action by leptin is required for normal body-weight homeostasis. Neuron 49:191–203[CrossRef][Medline]
  18. Sternson SM, Shepherd GM, Friedman JM 2005 Topographic mapping of VMH–>arcuate nucleus microcircuits and their reorganization by fasting. Nat Neurosci 8:1356–1363[CrossRef][Medline]
  19. Niswender KD, Morton GJ, Stearns WH, Rhodes CJ, Myers Jr MG, Schwartz MW 2001 Intracellular signalling. Key enzyme in leptin-induced anorexia. Nature 413:794–795[Medline]
  20. Xu AW, Kaelin CB, Takeda K, Akira S, Schwartz MW, Barsh GS 2005 PI3K integrates the action of insulin and leptin on hypothalamic neurons. J Clin Invest 115:951–958[CrossRef][Medline]
  21. Kitamura T, Feng Y, Ido Kitamura Y, Chua SC, Xu AW, Barsh GS, Rossetti L, Accili D 2006 Forkhead protein FoxO1 mediates Agrp-dependent effects of leptin on food intake. Nat Med 12:534–540[CrossRef][Medline]
  22. Kaelin CB, Gong L, Xu AW, Yao F, Hockman K, Morton GJ, Schwartz MW, Barsh GS, Mackenzie RG 2006 Signal transducer and activator of transcription (stat) binding sites but not stat3 are required for fasting-induced transcription of agouti-related protein messenger ribonucleic acid. Mol Endocrinol 20:2591–2602[Abstract/Free Full Text]
  23. Takeda K, Kaisho T, Yoshida N, Takeda J, Kishimoto T, Akira S 1998 Stat3 activation is responsible for IL-6-dependent T cell proliferation through preventing apoptosis: generation and characterization of T cell-specific Stat3-deficient mice. J Immunol 161:4652–4660[Abstract/Free Full Text]
  24. Choudhury AI, Heffron H, Smith MA, Al-Qassab H, Xu AW, Selman C, Simmgen M, Clements M, Claret M, Maccoll G, Bedford DC, Hisadome K, Diakonov I, Moosajee V, Bell JD, Speakman JR, Batterham RL, Barsh GS, Ashford ML, Withers DJ 2005 The role of insulin receptor substrate 2 in hypothalamic and ß-cell function. J Clin Invest 115:940–950[CrossRef][Medline]
  25. Gropp E, Shanabrough M, Borok E, Xu AW, Janoschek R, Buch T, Plum L, Balthasar N, Hampel B, Waisman A, Barsh GS, Horvath TL, Bruning JC 2005 Agouti-related peptide-expressing neurons are mandatory for feeding. Nat Neurosci 8:1289–1291[CrossRef][Medline]
  26. Munzberg H, Flier JS, Bjorbaek C 2004 Region-specific leptin resistance within the hypothalamus of diet-induced obese mice. Endocrinology 145:4880–4889[Abstract/Free Full Text]
  27. Clegg DJ, Brown LM, Woods SC, Benoit SC 2006 Gonadal hormones determine sensitivity to central leptin and insulin. Diabetes 55:978–987[Abstract/Free Full Text]
  28. Woods SC, Gotoh K, Clegg DJ 2003 Gender differences in the control of energy homeostasis. Exp Biol Med (Maywood) 228:1175–1180[Abstract/Free Full Text]
  29. Kievit P, Howard JK, Badman MK, Balthasar N, Coppari R, Mori H, Lee CE, Elmquist JK, Yoshimura A, Flier JS 2006 Enhanced leptin sensitivity and improved glucose homeostasis in mice lacking suppressor of cytokine signaling-3 in POMC-expressing cells. Cell Metab 4:123–132[CrossRef][Medline]
  30. Ueki K, Kondo T, Kahn CR 2004 Suppressor of cytokine signaling 1 (SOCS-1) and SOCS-3 cause insulin resistance through inhibition of tyrosine phosphorylation of insulin receptor substrate proteins by discrete mechanisms. Mol Cell Biol 24:5434–5446[Abstract/Free Full Text]
  31. Huo L, Grill HJ, Bjorbaek C 2006 Divergent regulation of proopiomelanocortin neurons by leptin in the nucleus of the solitary tract and in the arcuate hypothalamic nucleus. Diabetes 55:567–573[Abstract/Free Full Text]
  32. Ellacott KL, Halatchev IG, Cone RD 2006 Characterization of leptin-responsive neurons in the caudal brainstem. Endocrinology 147:3190–3195[Abstract/Free Full Text]
  33. Balthasar N, Coppari R, McMinn J, Liu SM, Lee CE, Tang V, Kenny CD, McGovern RA, Chua Jr SC, Elmquist JK, Lowell BB 2004 Leptin receptor signaling in POMC neurons is required for normal body weight homeostasis. Neuron 42:983–991[CrossRef][Medline]
  34. Roseberry AG, Liu H, Jackson AC, Cai X, Friedman JM 2004 Neuropeptide Y-mediated inhibition of proopiomelanocortin neurons in the arcuate nucleus shows enhanced desensitization in ob/ob mice. Neuron 41:711–722[CrossRef][Medline]
  35. Pinto S, Roseberry AG, Liu H, Diano S, Shanabrough M, Cai X, Friedman JM, Horvath TL 2004 Rapid rewiring of arcuate nucleus feeding circuits by leptin. Science 304:110–115[Abstract/Free Full Text]
  36. Kokoeva MV, Yin H, Flier JS 2005 Neurogenesis in the hypothalamus of adult mice: potential role in energy balance. Science 310:679–683[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Neurosci.Home page
M. B. Ernst, C. M. Wunderlich, S. Hess, M. Paehler, A. Mesaros, S. B. Koralov, A. Kleinridders, A. Husch, H. Munzberg, B. Hampel, et al.
Enhanced Stat3 Activation in POMC Neurons Provokes Negative Feedback Inhibition of Leptin and InsulinSignaling in Obesity
J. Neurosci., September 16, 2009; 29(37): 11582 - 11593.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
K. W Williams, M. M Scott, and J. K Elmquist
From observation to experimentation: leptin action in the mediobasal hypothalamus
Am. J. Clinical Nutrition, March 1, 2009; 89(3): 985S - 990S.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
V. Marion, C. Stoetzel, D. Schlicht, N. Messaddeq, M. Koch, E. Flori, J. M. Danse, J.-L. Mandel, and H. Dollfus
Transient ciliogenesis involving Bardet-Biedl syndrome proteins is a fundamental characteristic of adipogenic differentiation
PNAS, February 10, 2009; 106(6): 1820 - 1825.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Ma, L. Zubcevic, and F. M. Ashcroft
Glucose regulates the effects of leptin on hypothalamic POMC neurons
PNAS, July 15, 2008; 105(28): 9811 - 9816.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. Gong, F. Yao, K. Hockman, H. H. Heng, G. J. Morton, K. Takeda, S. Akira, M. J. Low, M. Rubinstein, and R. G. MacKenzie
Signal Transducer and Activator of Transcription-3 Is Required in Hypothalamic Agouti-Related Protein/Neuropeptide Y Neurons for Normal Energy Homeostasis
Endocrinology, July 1, 2008; 149(7): 3346 - 3354.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
E. Rother, A. C. Konner, and J. C. Bruning
Neurocircuits integrating hormone and nutrient signaling in control of glucose metabolism
Am J Physiol Endocrinol Metab, May 1, 2008; 294(5): E810 - E816.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. R. Cernkovich, J. Deng, M. C. Bond, T. P. Combs, and J. B. Harp
Adipose-Specific Disruption of Signal Transducer and Activator of Transcription 3 Increases Body Weight and Adiposity
Endocrinology, April 1, 2008; 149(4): 1581 - 1590.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. L. Piper, E. K. Unger, M. G. Myers Jr., and A. W. Xu
Specific Physiological Roles for Signal Transducer and Activator of Transcription 3 in Leptin Receptor-Expressing Neurons
Mol. Endocrinol., March 1, 2008; 22(3): 751 - 759.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Xu, A. W.
Right arrow Articles by Barsh, G. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Xu, A. W.
Right arrow Articles by Barsh, G. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals