help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-1568
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, M.
Right arrow Articles by Thatcher, G. R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, M.
Right arrow Articles by Thatcher, G. R. J.
Endocrinology Vol. 148, No. 10 4793-4802
Copyright © 2007 by The Endocrine Society

Activation of Estrogen Receptor-Mediated Gene Transcription by the Equine Estrogen Metabolite, 4-Methoxyequilenin, in Human Breast Cancer Cells

Minsun Chang, Kuan-wei Peng, Irida Kastrati, Cassia R. Overk, Zhi-Hui Qin, Ping Yao, Judy L. Bolton and Gregory R. J. Thatcher

Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, Chicago, Illinois 60612

Address all correspondence and requests for reprints to: Gregory R. J. Thatcher, Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, Chicago, Illinois 60612. E-mail: thatcher{at}uic.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
4-Methoxyequilenin (4-MeOEN) is an O-methylated metabolite in equine estrogen metabolism. O-methylation of catechol estrogens is considered as a protective mechanism; however, comparison of the properties of 4-MeOEN with estradiol (E2) in human breast cancer cells showed that 4-MeOEN is a proliferative, estrogenic agent that may contribute to carcinogenesis. 4-MeOEN results from O-methylation of 4-hydroxyequilenin, a major catechol metabolite of the equine estrogens present in hormone replacement therapeutics, which causes DNA damage via quinone formation, raising the possibility of synergistic hormonal and chemical carcinogenesis. 4-MeOEN induced cell proliferation with nanomolar potency and induced estrogen response element (ERE)-mediated gene transcription of an ERE-luciferase reporter and the endogenous estrogen-responsive genes pS2 and TGF-{alpha}. These estrogenic actions were blocked by the antiestrogen ICI 182,780. In the standard radioligand estrogen receptor (ER) binding assay, 4-MeOEN showed very weak binding. To test for alternate ligand-ER-independent mechanisms, the possibility of aryl hydrocarbon receptor (AhR) binding and ER-AhR cross talk was examined using a xenobiotic response element-luciferase reporter and using AhR small interfering RNA silencing in the ERE-luciferase reporter assay. The results negated the possibility of AhR-mediated estrogenic activity. Comparison of gene transcription time course, ER degradation, and rapid activation of MAPK/ERK in MCF-7 cells demonstrated that the actions of 4-MeOEN mirrored those of E2 with potency for classical and nonclassical estrogenic pathways bracketing that of E2. Methylation of 4-OHEN may not represent a detoxification pathway because 4-MeOEN is a full, potent estrogen agonist.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PROLONGED EXPOSURE TO estrogens is associated with the increased risk of developing breast and endometrial cancers either through early menarche, late menopause, and/or hormone replacement therapy (HRT). In animal models, estrogens have been proven to induce mammary, pituitary, cervical, and uterine tumors (1). The dominant clinical HRT therapies use conjugated equine estrogens, despite results from the Women’s Health Initiative clinical trials demonstrating risks including increased breast cancer (2, 3) and the recent correlation between cessation of HRT and reduction in breast cancer incidence (4).

Although the molecular mechanisms underlying estrogen-associated carcinogenesis are not completely established, the estrogen receptor (ER) is seen as a prime mediator of hormonal carcinogenesis. Estrogenic (agonist) activity at the ER leads to cellular proliferation commonly seen as providing increased opportunity for accumulation of the genetic damage that can initiate carcinogenesis and proliferation of preneoplastic and neoplastic cells. Reactive intermediates derived from estrogen metabolism that cause DNA damage by direct and indirect chemical reactions have the capacity to induce chemical carcinogenesis (5). However, the hormonal activity of estrogen metabolites as ER agonists has less frequently been studied as a potential contributor to carcinogenesis.

Estrogens are oxidatively metabolized to form catechols that are subject to conjugative metabolism including formation of methoxy-estrogens by catechol-O-methyltransferase (COMT) (6). Oxidative metabolism of estrogens generates genotoxic reactive intermediates, whereas conjugative metabolism is considered a detoxification pathway (6, 7). Studies on the 2-hydroxy, 4-hydroxy, and 2-methoxy metabolites of endogenous estrogens have begun to show that the metabolites possess biological activity independent of the parent estrogens that must form part of the puzzle of estrogen-associated carcinogenesis (6).

In contrast to endogenous estrogens, the equine estrogens are predominantly hydroxylated at the 4-position, yielding catechols that are considerably more reactive and cytotoxic than their human estrogen counterparts. The catechol, 4-hydroxyequilenin (4-OHEN), is the major phase 1 oxidative metabolite of the equine estrogens contained in the most widely prescribed HRT formulations (8). 4-OHEN autoxidizes to an o-quinone (Fig. 1Go), which has been shown to react with DNA leading to a variety of DNA lesions (9). In human breast cancer cells, 4-OHEN was found to induce DNA damage, in addition to acting as an effective carcinogen in cultured cell models (10). The parent equine estrogens exert biological effects in estrogen target tissues via interaction with the ER, and 4-OHEN has also been reported to induce estrogenic effects, although the chemical instability of 4-OHEN hinders study of its hormonal actions (11, 12). Conjugative metabolism of 4-OHEN yields the stable O-methylated metabolite, 4-methoxyequilenin (4-MeOEN), which has been identified in breast cancer cells (Fig. 1Go) (13, 14). An important question to be asked is whether catechol O-methylation represents a detoxification pathway or whether these metabolites are themselves proliferative or mitotic agents able to elicit responses via ER or other relevant nuclear receptors. The potential ability of equine estrogen metabolites to function as hormonal carcinogens, added to their known ability to function as chemical carcinogens, might indicate that metabolic bioactivation is a contributor to carcinogenesis associated with HRT.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 1. A, Oxidative metabolism pathway for EN to 4-MeOEN and 17-4-MeOEN mediated by cytochrome P450 (CYP P450) oxidation and COMT methylation. Oxidation to the genotoxic quinone does not require enzyme meditation. Putative demethylation of 4-MeOEN and 17-4-MeOEN has not been reported. B, Comparable oxidative metabolism pathway for E2; demethylation of 4-MeOE2 has been reported in the literature. C, Structures of AhR ligands and EN derivatives used or referred to in this study.

 
In the present study, the biological effects of 4-MeOEN and 17ß-dihydro-4-methoxy-equilenin (17-4-MeOEN) were studied in breast cancer cells. 4-MeOEN was observed to be a proliferative agent in estrogen-sensitive breast cancer cells; to activate expression of endogenous estrogen-responsive genes; to activate gene expression via the estrogen response element (ERE); but to be an extremely weak ER ligand as determined by radioligand competitive binding assays. A rationale was sought by probing transactivation of estrogenic function via the aryl hydrocarbon receptor (AhR) or a membrane-associated estrogen-binding receptor, requiring application of AhR gene silencing and a xenobiotic response element (XRE) reporter. The results are relevant to both the carcinogenic potential of equine estrogen bioactivation and identification of nonclassical mechanisms of estrogenic action.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Materials
All chemicals and reagents were purchased from Sigma (St. Louis, MO) or Fisher Scientific (Itasca, IL) unless stated otherwise. ICI 182,780 (ICI) was purchased from Tocris (Ellisville, MO). 3',4'-Dimethoxyflavone was obtained from Lancaster Synthesis Inc. (Windham, NH). 4-OHEN and 17-4-MeOEN were synthesized by minor modifications of literature procedures (15). Synthesis of 4-bromoequilenin (4-BrEN) and 4-MeOEN was modified from published procedures to increase overall yields by performing B-ring oxidation before ketone protection or installation of the methoxy group (13, 16, 17).

Cell culture
All cell culture reagents were purchased from Invitrogen (Carlsbad, CA) unless stated otherwise. MCF-7 cells (American Type Culture Collection, Manassas, VA) and a clonal derivative, MCF-7 WS8 human breast cancer cells (a kind gift from Dr. V. C. Jordan, Fox Chase Cancer Center, Philadelphia, PA), were maintained in RPMI 1640 containing 10% fetal bovine serum (Atlanta Laboratory, Atlanta, GA), 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 6 µg/ml bovine insulin (Sigma). Estrogen-free media were prepared by supplementing 3x dextran-coated charcoal-treated fetal bovine serum to phenol-red-free RPMI 1640 media, whereas other components remained the same. S30 cells (a gift from Dr. V. C. Jordan) were derived from MDA-MB-231 human breast cancer cells by stable transfection of cDNA encoding the wild-type ER{alpha} (18) and maintained in phenol red-free MEM supplemented with 5% 3x dextran-coated charcoal-treated calf serum, 0.5 mg/ml geneticin, and concentrations of glutamine, nonessential amino acids, and insulin the same as those for MCF-7 cells.

ER competitive ligand binding assay
Competitive displacement of [3H] estradiol (E2) radioligand (Amersham Biosciences, Piscataway, NJ) from full-length recombinant human (h) ER{alpha} or hERß (PanVera/Invitrogen, Carlsbad, CA) was assayed as described previously (10, 12). Briefly, the ER binding buffer consisted of 10 mM Tris-Cl (pH 7.5), 10% glycerol, 2 mM dithiothrietol, 1 mg/ml BSA, and test compounds [or dimethylsulfoxide (DMSO) vehicle control] were incubated with ER (5 nM) and radioligand (20 nM) at room temperature for 2 h. The percent inhibition of [3H]E2 binding to each ER was determined as follows: [1 – (dpmsample – dpmblank)/(dpmDMSO – dpmblank)] x 100. The binding (expressed as percent) was calculated in comparison with estradiol (50 nM, 100%) to generate concentration-binding curves and hence IC50 values. Relative binding affinity (RBA) was as follows: RBA = 100 x [IC50(E2)/IC50(sample)]. The RBA values kindly provided by J. Katzenellenbogen and K. Carlson (University of Illinois at Urbana-Champagne) were obtained from incubations of ER with radioligand (2 nM) and test sample for 18–24 h at 0 C.

Induction of alkaline phosphatase in Ishikawa cells
The procedure of Overk et al. (19) was used as described previously. Briefly, Ishikawa cells (5 x 104 cells/ml) were incubated overnight with estrogen-free media in 96-well plates, test compounds or vehicle was added, and cells were incubated for a further 4 d before assay of alkaline phosphatase (AP) activity. The data represent the average ± SD of three determinations.

Cell proliferation assays
MCF-7 cells were seeded at 1.5 x 104 cells/well in 24-well plates after cultured in estrogen-free media for 4 d. Cells were treated with compounds every 2–3 d for 6 d in triplicate. The cell growth was determined by measuring the DNA amount (20). Briefly, cells were lysed with 100 µl/well 1x passive lysis buffer (Promega, Madison, WI), and the lysates were resuspended in 400 µl/well 0.1x PBS followed by sonication. DNA content was detected with a 96-well fluorescence reader using an excitation filter of 360–390 nm and an emission filter of 450–470 nm after 30 µl of cell lysates were incubated with 200 µl of 2 µg/ml of Hoechst 33258 (Bio-Rad Laboratories, Hercules, CA) for 1 h. DNA amount in each sample was calculated as calf thymus DNA as a standard.

Western blot analysis
MCF-7 cells were grown in estrogen-free media for 4 d before compound treatment. Cells were either treated for 24 h with compounds as indicated or, for analysis of ERK (p42/44 MAPK) analysis, pretreated with ICI or vehicle for 30 min before addition of test compounds, followed by incubation for a further 5 min. Cells were trypsinized, pelleted, washed in PBS, resuspended in ip buffer [50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10 mM ß-glycerophosphate, 10% glycerol, and 0.5% Nonidet P-40 (pH 8.0)] containing protease inhibitors, mixed, and centrifuged at 12,000 x g for 10 min. Protein concentration was measured in supernatants using the Bradford assay kit (Bio-Rad Laboratories). Equal aliquots of total protein samples (20 µg/lane) were electrophoresed on a 10% Bis-Tris polyacrylamide gel, transferred to PVDF membranes (Millipore, Bedford, MA), and blotted using antibodies to ER{alpha} (G-20; Santa Cruz Biotechnology, Santa Cruz, CA) or phospho-p44/p42 MAPK (Thr202/Tyr20) (Cell Signaling Technology, Beverly, MA). ß-Actin (AC-15; Sigma) or total ERK (p44/42 MAPK) antibody (Cell Signaling Technology) was used as a control for loading and transfer. The blotted proteins were visualized using the enhanced chemiluminescence detection system (Amersham Biosciences) and quantitated using Bio-Rad Quantity One software.

Transient transfection and luciferase assays
Cells were cultured in estrogen-free media for 4 d before transfection. The cells were transfected with 2 µg of the pERE-luciferae plasmid, which contains three copies of the Xenopus laevis vitellogenin A2 ERE upstream of fire fly luciferase (a gift from Dr. V. C. Jordan) (21). To normalize transfection efficiency, pRL-TK plasmid (1 µg; Promega), which contains a cDNA encoding Renilla luciferase, was cotransfected. In some experiments, pGudLuc1.1 (a gift from Dr. Michael S. Denison, University of California, Davis, Davis, CA) containing four copies of the XRE upstream of firefly luciferase was transfected. Cells (5 x 106) in serum-free media were transfected by electroporation in a 0.4-cm cuvette (Bio-Rad Laboratories) at a voltage of 0.320 kV and a high capacitance of 950 µF in a GenePulser X-cell (Bio-Rad Laboratories). The cells were resuspended in estrogen-free media, transferred to 12-well plates immediately after electroporation, and incubated overnight. The cells were treated with the appropriate compounds for 24 h. The luciferase activities in cell lysates were measured using dual luciferase assay system (Promega) with a FLUOstar OPTIMA (BMG Labtech, Durham, NC). Data are reported as relative luciferase activity, which is the firefly luciferase reading divided by the Renilla luciferase reading.

Total RNA isolation and quantitative PCR analysis
MCF-7 and S30 cells grown in estrogen-free media were treated with compounds as indicated. Total RNA was extracted from cell pellets using the RNeasy kit (QIAGEN, Valencia, CA) according to the manufacturer’s instructions. Total RNA (2 µg) was reverse transcribed with Moloney murine leukemia virus reverse transcriptase using TaqMan reverse transcript reagents kit (Applied Biosystems, Foster City, CA). Depending on the gene of interest, 1 or 2 µl of reaction mixture were used in the following real-time PCR quantification. The PCR and subsequent analyses were performed using the GeneAmp 5700 sequence detection system (Applied Biosystems).

Probes and primers were designed using Primer Express software (Applied Biosystems) and synthesized by Applied Biosystems. TGF-{alpha} forward and reverse primers and probe sequences (5' to 3') were GTTTTTGGTGCAGGAGGACAA, CACAGCGTGCACCAACGT and CCAGCATGTGTCTGCCATTCTGGG, respectively; and pS2 forward and reverse primers and probe sequences (5' to 3') were CGTGAAAGACAGAATTGTGGTTTT, CGTCGAAACAGCAGCCCTTA, and TGTCACGCCCTCCCAGTGTGCA, respectively. 18S rRNA TaqMan probe and primers (TaqMan predeveloped assay reagent control; Applied Biosystems) were used as an internal control. All probes were labeled with 6-carboxyfluorescein, and TAMRA was used as the 3'-quencher in all cases.

The PCR mixture contained TaqMan Universal master mix (Applied Biosystems) and different concentrations of primers and probes, depending on the genes subject to analysis. Real-time quantitative PCR consisted of one cycle of 50 C for 2 min and 95 C for 10 min and 40 cycles of 95 C for 15 sec and 60 C for 1 min. The fluorescence signal was measured during the last 30 sec of the annealing/extension phase. A standard curve was derived using RNA samples from vehicle control-treated cells. Data were normalized by dividing the expression level of a specific gene by that of 18S rRNA; results were expressed as a fold induction where the gene expression level in vehicle control-treated cells was set as 1.

Transient transfection of small interfering (si) RNAs
siRNA duplexes were prepared by Dharmacon Research (Lafayette, CO). Each siRNA was prepared with TT overhang to the end of 3' position. The sense sequence (5' to 3') of siRNA duplexes for AhR (siAhR) was UAC UUC CAC CUC AGU UGG C (nucleotide positions 774–792), CGU ACG CGG AAU ACU UCG A for firefly luciferase (siLuc; nucleotide positions 153–171), and GCGCGCUUUGUAGGAUUCG for scrambled inhibitory RNA (siSC; nucleotide positions 24750–24768). The sequence for siSC was derived from a message transcribed from the chloroplast genome of Euglena gracilis. Cells were cultured in estrogen-free media for 4 d and seeded at a density of 8 x 105 cells/well in six-well plates 24 h before transfection experiments. siRNA duplexes (100 nM/well), pERE-Luc plasmid (0.5 µg/well), and pRL-TK (0.5 µg/well) were transfected using Lipofectamine 2000 reagent (Invitrogen) and incubated for 24 h. Cells were treated with the appropriate compounds for another 24 h. Luciferase activities were determined as described above.

Statistics
The data were reported as the mean ± SD. Statistical comparisons between control and treated groups were performed using either Student’s t test or single-factor ANOVA model. Differences in results among data sets were considered statistically significant when P < 0.05 unless stated otherwise.

Computational methods
The structure for ER{alpha} ligand binding domain (LBD) extracted from the crystal structure (Protein Database code: 1ERE) was examined using SYBYL 7.2 software (Tripos, Inc., St. Louis, MO; 2004). FlexX and FlexPharm were used to dock the compounds at an active site designed at r = 6.5 Å from E2 with core subpocket residues such as Glu353, Arg394, His524, and Glu353 set as an optional H-bond acceptor. Experimental ER{alpha} binding affinities for equilenin (EN), 4-BrEN, 4-chloroequilenin (4-CIEN), and 4-fluoroequilenin (4-FEN) were used as a small training set to evaluate binding energies.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Estrogenic activity in Ishikawa cells and ER ligand binding
The induction of AP in ER{alpha}-positive Ishikawa cells is used as a standard screening assay for estrogenic and antiestrogenic compounds. Full concentration-response curves were obtained at 10–9 to 10–5 M test compounds (data not shown). 4-BrEN was observed to induce AP (EC50 ~6 x 10–8 M) in accord with published data and the reported RBA for ER{alpha} (17); both 4-MeOEN and 17-4-MeOEN were also observed to induce AP (EC50 ~1 x 10–7 M and 1 x 10–6 M, respectively).

The radioligand displacement assay for ER binding is carried out using incubations of test compound with ER at 0–25 C for 2–24 h; the standard assay incorporates BSA for ER stabilization. Although hydrophobic molecules are known to have affinity for BSA, nonspecific binding is also likely to compete with ER binding in a cellular milieu; therefore, this assay is normally expected to be predictive of estrogenic activity in cells. IC50 values for neither 4-MeOEN nor 17-4-MeOEN could be obtained in the assay after 2 h incubation because no reproducibly significant binding was observed, even at micromolar concentrations (≤50 µM). ER binding by the structurally related equilenin derivatives, 4-OHEN and 4-BrEN (Fig. 1Go), has been reported, although 4-OHEN was observed to be a low-affinity ligand: RBA (ER{alpha}) approximately 0.4% (12, 17). In light of the estrogenic activity seen in Ishikawa cells, the RBA was assayed by radioligand displacement in the Katzenellenbogen lab using an 18- to 24-h incubation period, which confirmed the extremely low affinity for recombinant hER of 4-MeOEN (RBA: ER{alpha}, 0.003%; ERß, 0.006%) and 17-4-MeOEN (RBA: ER{alpha}, 0.018%; ERß, 0.025%). The RBA determination for binding of 4-MeOEN to ER{alpha} predicts a reduced potency of at least 105 fold relative to E2.

Given the discrepancy between the measured ER{alpha} RBA for 4-MeOEN and the observed estrogenicity in Ishikawa cells, the ER{alpha} binding of 4-MeOEN was examined computationally using the protein structure obtained from the E2-bound complex. The calculated docking scores to the rigid receptor indicated an ER{alpha} affinity for 4-MeOEN higher than that for 4-BrEN.

Cell proliferation by 4-MeOEN in MCF-7 cells
Proliferation of ER{alpha}-positive MCF-7 breast cancer cells is a well-established assay for assessing estrogenic activity. Sensitivity for measuring estrogen-stimulated growth was maximized by treatment with test compounds for 6 d after estrogen deprivation for 4 d and quantification of DNA as the measure of proliferation. E2 itself increased cell growth up to 7-fold, compared with vehicle control in a concentration-dependent manner in good agreement with the published data (Fig. 2Go) (22). 4-MeOEN also increased cell proliferation with comparable efficacy to E2 but with lower potency (EC50 ~10–9 M). To rule out any antagonistic or antiestrogenic effects of 4-MeOEN on E2-stimulated cell growth, cells were treated with E2 at a fixed concentration of 4-MeOEN (10–7 M) and with 4-MeOEN at a fixed concentration of E2 (10–9 M): the fixed concentrations selected corresponded to maximal activity. To determine whether proliferative activity was ER mediated, cells were cotreated with the antiestrogen ICI (Fig. 2Go). ICI completely blocked cell proliferation in E2-treated cells (data not shown). Proliferation in response to 4-MeOEN was also abolished by ICI, strongly indicating that MeOEN effects proliferation via an ER-dependent mechanism.


Figure 2
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 2. Concentration-dependent cell proliferation induced by E2 and 4-MeOEN. MCF-7 cells were treated for 6 d with vehicle control (open diamond; E2 (10–13 to 10–8 M; closed circles); 4-MeOEN (10–11 to 2.5 x 10–6 M; open circles); E2 (10–13 to 10–8 M) + 4-MeOEN (10–7 M; closed squares)); 4-MeOEN (10–11 to 2.5 x 10–6 M) + E2 (10–9 M; open triangles); and 4-MeOEN + ICI (closed triangles). Assays were performed in three individual experiments; data show mean ± SD.

 
Activation of an ERE-luciferase reporter in MCF-7 cells
The observed estrogenic proliferative activity of 4-MeOEN stimulated the investigation of the molecular targets of transcriptional activation by this agent. Cells were transiently transfected with an ERE-luciferase reporter plasmid and luciferase activity was determined after 24 h treatment with test compounds as a measure of ER-mediated transcriptional activation. E2 and 4-MeOEN caused dose-dependent induction of luciferase activity (Fig. 3Go). Both compounds displayed similar efficacy (6- to 7-fold induction) with higher potency for E2 than 4-MeOEN (EC50 ~3 x 10–11 vs. 7 x 10–9 M, respectively). In addition, ICI completely abolished the luciferase activity induced by both E2 and 4-MeOEN (Fig. 4Go). Cotreatment with E2 and 4-MeOEN again showed no antagonist or antiestrogenic activity (data not shown). These data show that 4-MeOEN is estrogenic, activating ER/ERE-dependent transcription with nanomolar potency in MCF-7 cells.


Figure 3
View larger version (11K):
[in this window]
[in a new window]

 
FIG. 3. Dose-dependent activation by 4-MeOEN of an ERE-luciferase and XRE-luciferase reporter in MCF-7 cells. A, Cells were transiently transfected with 2 µg of an ERE-luciferase reporter plasmid. Cells were treated with vehicle control, E2 (closed circles; 10–13 to 10–8 M), and 4-MeOEN (open circles; 10–11 to 10–6 M) for 24 h followed by transient transfection. B, Cells were transiently transfected with 4 µg of an XRE-luciferase reporter plasmid. Cells were treated with DMSO, 4-MeOEN (open circles; 10–12 to 10–6 M), and 3-MC (closed circles; 10–12 to 10–7 M) for 24 h. C, MCF-7 WS-8 cells were transiently transfected with 2 µg of an ERE-luciferase reporter plasmid. Cells were pretreated with CYP P450 inhibitors ABT (10 µM; triangles), {alpha}-NF (10 µM; squares), or vehicle (circles) for 2 h and treated with E2 (10–13 to 10–9 M; open symbols) and 4-MeOEN (10–10 to 10–6 M; closed symbols) for 18 h. The background activity of the CYP P450 inhibitors, which was subtracted, is shown by X (ABT) and diamond ({alpha}-NF) symbols. To normalize transfection efficiency, 1 µg of Renilla luciferase reporter plasmid was cotransfected; luciferase activities were measured for at least duplicate samples and are expressed as relative luciferase activity (ERE-luciferase reading divided by Renilla luciferase reading). Data show mean ± SD.

 

Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 4. ER-mediated activation of the ERE-luciferase activity by 4-MeOEN. The ER antagonist ICI abolishes the ERE-luciferase activity induced by 4-MeOEN. MCF-7 cells were transiently transfected with ERE-luciferase reporter and Renilla luciferase plasmids. Twenty-four hours after transfection, cells were treated with vehicle control, E2 (1 nM), 4-MeOEN (100 nM), and ICI (1 µM) for another 24 h. Luciferase activities were determined as described previously. Data show mean ± SD. An asterisk indicates P < 0.001, compared with the vehicle control.

 
To further compare the estrogenic activity of 4-MeOEN with that of E2, the time course of ERE-dependent luciferase induction was examined at 1, 6, 12, 18, and 24 h. No significant differences were seen between the time course for induction by 4-MeOEN (100 nM) and E2 (1 nM) nor between 4-MeOEN (1 nM) and E2 (10 pM) (data not shown). Concentration-response curves were obtained for 4-MeOEN and E2 in the MCF-7 WS8 clonal variant for ERE-luciferase induction, confirming the generality of the observed estrogenic activity of 4-MeOEN, although potency was somewhat lower in this assay.

The ERE-luciferase reporter was also used to test the influence of metabolism on the estrogenicity of 4-MeOEN and E2. CYP P450 has been reported to demethylate 4-MeOE2, in addition to the expected oxidative activity in catalyzing formation of 4-OHE2 and further quinone formation (Fig. 1Go) (6, 23). A CYP P450 inhibitor would therefore be expected both to inhibit oxidation of E2 and the putative demethylation of 4-MeOEN. The impact on ERE-luciferase induction by E2 and by 4-MeOEN would be predicted to be negligible if E2 and 4-MeOEN are the ultimate estrogens. The CYP P450 inhibitor {alpha}-naphthoflavone ({alpha}-NF) and the broad-spectrum irreversible inhibitor 1-aminobenzotriazole (ABT) (24, 25, 26) were preincubated with MCF-7 cells before estrogen treatment. In control incubations, both inhibitors significantly induced ERE-luciferase but not Renilla luciferase, compared with vehicle control (Fig. 3CGo); one possible explanation being activation via binding to AhR and cross talk with ER, inducing the ERE-target gene (27, 28). Therefore, in addition to normalizing transfection efficiency using the Renilla luciferase activity, the background ERE-luciferase activity of the inhibitors was subtracted. The effect of the CYP P450 inhibitors on ERE-luciferase induction by E2 was identical with that of the inhibitors on 4-MeOEN mediated induction, suggesting that these molecules are the proximal estrogenic species. The broad-spectrum CYP P450 inhibitor ABT had no effect, whereas {alpha}-NF inhibited the efficacy of both E2 and 4-MeOEN (Fig. 3CGo). Often used as a selective CYP P450 1A1 inhibitor, {alpha}-NF is also a noncompetitive CYP P450 1B1 inhibitor (inhibitory constant = 2.8 ± 0.5 nM) (26) and has been reported to down-regulate ER expression via an AhR-dependent mechanism, which may account for the reduction in efficacy of both E2 and 4-MeOEN (29).

Analysis of estrogen-responsive gene expression
To further study the 4-MeOEN-mediated transcriptional activity of ER at a target gene in situ, the levels of endogenous estrogen-responsive genes were measured in total RNA isolated from cells treated with 4-MeOEN. pS2 and TGF-{alpha} were chosen as the target genes because it is well documented that expression of these genes is modulated in response to estrogenic compounds. The expression levels of mRNA for pS2 and TGF-{alpha} were measured using real-time PCR in MCF-7 cells treated with compounds for 24 h. Treatment with E2 (1 nM) and 4-MeOEN (100 nM) resulted in 100- and 70-fold induction of the pS2 gene, respectively, compared with vehicle control (Fig. 5Go). E2 induction of pS2 mRNA in MCF-7 cells by 30-fold was reported using Northern blot (30). Interpretation of mechanistic differences between E2 and 4-MeOEN based on the variation in pS2 induction levels is unsafe without further concentration-induction studies in alternative cell lines. The level of TGF-{alpha} mRNA was investigated in S30 cells, an alternative ER{alpha}-positive breast cancer cell line. Treatment with E2 (1 nM) and 4-MeOEN (100 nM) resulted in 4-fold induction of gene expression, compared with vehicle control, which was again completely blocked by application of ICI (Fig. 5Go). Fold induction of TGF-{alpha} by E2 is consistent with the published Northern blot analysis (31).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 5. Induction of estrogen-responsive genes by 4-MeOEN in MCF-7 and S30 cells. Total RNA was isolated from cells treated with vehicle, E2 (1 nM), 4-MeOEN (1–100 nM), or ICI (1 µM) for 24 h as indicated, and RNA (2 µg) was reverse transcribed by Moloney murine leukemia virus reverse transcriptase (RT). Five microliters of the RT reaction were used as template for real-time PCR quantitation of genes, pS2 (A) and TGF-{alpha} (B). Three independent experiments were conducted; the data show mean ± SD, with significance (P < 0.005), compared with vehicle control.

 
Effect of 4-MeOEN on ER{alpha} and pERK protein levels in MCF-7 cells
To determine the effect of 4-MeOEN on the levels of ER{alpha} protein in human breast cancer cells, MCF-7 cells were treated with DMSO/EtOH vehicle, E2, ICI, 4-MeOEN, or a combination of two compounds for 24 h in estrogen-free media. The amount of ER{alpha} protein was determined by Western blot analysis. Cells treated with E2 or with ICI showed a 50 or 90% decrease in ER{alpha} protein levels, respectively, compared with control (Fig. 6Go). Treatment with 4-MeOEN (100 nM) gave a 55% decrease in ER{alpha} protein level, whereas lower concentrations gave no significant differences, compared with control. The combination of ICI with either E2 or 4-MeOEN showed a 70% decrease in ER{alpha}. The levels of ER{alpha} mRNA were also assessed to determine whether any differences existed between the mechanisms of ER{alpha} protein degradation induced by E2 and 4-MeOEN that might be reflected at the transcriptional level. Both E2 and 4-MeOEN decreased the amount of ER{alpha} mRNA in MCF-7 cells, whereas ICI did not change ER{alpha} mRNA levels (data not shown), showing that 4-MeOEN and E2 have similar effects on ER{alpha} transcription and expression.


Figure 6
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 6. Upper panels, Degradation of ER{alpha} protein by treatment of MCF-7 cells for 24 h with vehicle control, E2 (1 nM), ICI (1 µM), 4-MeOEN (1–100 nM), or combinations of two agents as indicated in the figure. Lower panels, Elevation of pERK by treatment of MCF-7 cells for 5 min with E2, 4-MeOEN, 4-BrEN, or 4-OHEN at the concentrations indicated in the figure, with or without 30 min pretreatment with ICI (1 µM). Representative Western blots of triplicate determinations are shown.

 
Levels of ERK and pERK were also determined by Western blot analysis of MCF-7 cells in stripped media but at only 5 min after addition of test compounds. Cells were preincubated for 30 min with ICI or vehicle to ascertain the ER-dependence of ERK activation. 4-MeOEN, 4-BrEN, 4-OHEN, and E2 all reproducibly elevated pERK levels with no significant effects on total ERK (Fig. 6Go). Furthermore, pERK elevation by all agents was completely inhibited by the ER antagonist ICI. The concentration-response relationship obtained for pERK activation by 4-MeOEN was nonlinear showing increases in pERK at 10 and 30 nM, respectively relative to 100 nM. At 10 nM, E2 and 4-MeOEN are approximately equipotent.

Assays for the XRE-luciferase reporter gene transcription
There are reports that ligand binding and activation of AhR leads to recruitment of ER{alpha}, which induces gene transcription via ER binding to ERE (27). Therefore, it was investigated whether 4-MeOEN could activate ER{alpha}-mediated transcription through AhR-ER{alpha} cross talk in which 4-MeOEN may act as a novel AhR ligand. An XRE-driven reporter gene assay was used because it is known that the ligand-AhR complex with AhR nuclear translocator (Arnt) binds to specific DNA sequences named as XRE leading to gene transcription (32). In XRE-luciferase transfected MCF-7 cells, 4-MeOEN activated luciferase reporter activity 5-fold at 1 µM but only 2-fold at 100 nM (Fig. 3BGo). In contrast, E2 activation via XRE exceeded 10-fold at 100 nM. For comparison, 3-methylcholanthrene (3-MC), a powerful AhR agonist, was studied in this assay and the observed activity at 3-MC (1 µM) set at 100% (27). In addition, 3',4'-dimethoxyflavone, reported to be an AhR antagonist (33), completely inhibited 4-MeOEN-induced XRE-reporter activity (data not shown).

Effect of AhR on ERE-luciferase gene transcription
To investigate cross talk between AhR and ER{alpha}, the ERE reporter assay was conducted in transfected MCF-7 cells in the presence of siRNA targeting AhR genes. AhR siRNA treatment was predicted to ablate ERE-mediated luciferase gene expression if the mechanism required AhR-ER cross talk initiated by binding of ligand to AhR. Cells were incubated with appropriate siRNA duplexes designed to block the expression of AhR (siAhR), firefly luciferase (siLuc; as a cross-check for luciferase induction), or E. gracilis (siSC; as a control for RNA interference performance). ERE-luciferase reporter induction by both E2 and 4-MeOEN was unperturbed by siAhR (Fig. 7Go), implying that the presence of AhR is not required for induction of ERE-luciferase activity, at least at these concentrations of E2 and 4-MeOEN. All control experiments were consistent with this observation. The concentrations of E2 and 4-MeOEN studied were equipotent in the XRE-luciferase assay (Fig. 3BGo). These data are compatible with 4-MeOEN-induced ERE-dependent gene transcription resulting from binding to ER{alpha} not to AhR.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 7. siRNA for AhR does not affect ERE-dependent transactivation by 4-MeOEN. MCF-7 cells were transfected with ERE-luciferase reporter and siSC, siAhR, or luciferase (siLuc). Luciferase activities were measured after treatment of cells for 24 h with vehicle, E2 (10 nM), and 4-MeOEN (1 µM). Results are expressed as mean ± SD, and significant (P < 0.005) difference, compared with solvent control, is indicated by an asterisk.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The results from assay of ER-ligand binding affinity, uterotrophic potency, and cell proliferation have demonstrated that the equine estrogens (EN, equilin, and their 17ß-hydroxy forms) are estrogenic. For example, in MCF-7 cells EN and equilin were both proliferative with potency approaching that of E2 (34). Clearly, the continued long-term use of equine estrogen-based HRT, in light of increased breast cancer risk demonstrated by the Women’s Health Initiative studies, requires a complete understanding of carcinogenic mechanisms mediated by equine estrogens and their metabolites (2, 3, 4). The biological activity of the catechol and the 2-methoxy metabolites of human estrogens has been the subject of significant research. 2-Methoxyestrone, an abundant estrogen metabolite in humans (6), has been reported to have low ER affinity, comparable with 2- and 4-methoxyestradiol (RBA < 1%) (35), and neither 2-methoxyestrone nor 2-methoxyestradiol induced estrogenic activity in the uterus (6, 36). Thus, for human estrogens, O-methylation can reasonably be seen as a detoxification pathway; indeed, 2-methoxyestradiol is a potent antiproliferative agent (37).

In contrast to human estrogens, the equine estrogens are predominantly hydroxylated at the 4-position to give 4-OHEN and 17-4-OHEN, which, unlike endogenous catechol estrogens, autoxidize to o-quinones that are genotoxic and carcinogenic in breast cancer cells (Fig. 1Go) (8, 9, 10). Quinones damage biomolecules via oxidative mechanisms, in addition to alkylating biomolecules including DNA, providing multiple mechanisms of chemical carcinogenesis. Cellular defenses targeted to quinones have been argued to rely on nicotinamide-dependent quinone oxidoreductase to reduce the quinone to a catechol and on COMT to methylate the catechol, blocking quinone formation. Whereas conjugative phase 2 metabolism, such as glucuronidation, generally increases hydrophilicity and clearance, metabolism by COMT increases lipophilicity, potentially leading to accumulation of metabolites in fatty tissue, which is of particular relevance to breast cancer in long-term therapies such as HRT. Conjugative metabolism of 4-OHEN gives the stable O-methylated metabolite 4-MeOEN, which has been identified in breast cancer cells and therefore warrants study (13, 14).

In the radioligand binding assay, extremely low ER affinity was measured herein for 17-4-MeOEN and 4-MeOEN (RBA = 0.001%). We have previously reported the activity of 4-OHEN and its stable synthetic halide congeners, including 4-BrEN: RBA was low, but measurable for 4-OHEN and 4-BrEN (Fig. 1Go) (12). Rigorous determination of the estrogenic activity of 4-OHEN in cell culture is severely hampered by its reactivity [autoxidation half-time ~0.5 min; decomposition half-time ~138 min (8, 17)]; hence, the low potency observed for AP induction in Ishikawa cells (IC50 ~6 µM) and low RBA (0.1–0.4%) probably reflect the decomposition of 4-OHEN in the assay media. For comparison, the catechol estrogens, 4-OHE2 and 4-OHE, which have much lower oxidative lability, show approximately 5- to 10-fold diminished potency in ER{alpha} ligand binding and Ishikawa-AP activity, compared with the parent estrogens (12), whereas the ER{alpha} RBA values recently reported for 4-OHE, 4-OHE2, and 4-MeOE2 are 2, 70, and 2%, respectively (38). The very low RBA value measured for 4-MeOEN was not rationalized by computational docking studies using ER{alpha} LBD. It was therefore not entirely surprising that 17-4-MeOEN and 4-MeOEN proved estrogenic toward AP induction in Ishikawa cells, the latter showing nanomolar potency. However, the low RBA measurement made it essential to first confirm estrogenicity and second determine whether the estrogenic activity was ER mediated.

Because target tissues for equine estrogens are estrogen responsive, the effects of 4-MeOEN on ER-mediated transcriptional activities were studied in ER{alpha}-positive MCF-7 and S30 breast cancer cells. The results using ERE reporter assays and induction of the classical estrogen-responsive genes TGF-{alpha} and pS2 confirmed that 4-MeOEN is estrogenic with nanomolar potency (e.g. EC50 ~1–7 x 10–9 M for cell proliferation and ERE-luciferase induction). Moreover, all estrogenic actions of 4-MeOEN and E2 were blocked by the antiestrogen ICI, strongly implying actions mediated by ligand-ER complexes.

The classical mechanism of estrogenic hormonal function involves ligand binding to cytosolic ER, dimerization, translocation to the nucleus, recruitment of coregulator proteins, and direct interaction with ERE leading to gene transcription. In the absence of estrogens, cross talk with other receptor pathways, such as the IGF-I and epithelial growth factor receptors, is able to modulate ER-mediated activity through ER phosphorylation. Cross talk between the ER and AhR has been proposed in various studies. For example, AhR binding of ligands, including dioxins and polyaromatic hydrocarbons, induced degradation of ER protein in MCF-7 cells in a proteasome-dependent manner (39, 40). A recent high-profile study reported that 3-MC binding to AhR led to dissociation of the cytosolic AhR-heat shock protein complex, translocation of the 3-MC-AhR complex to the nucleus, and recruitment of Arnt and unliganded ER, leading to ERE-luciferase induction (27). Because 4-MeOEN has very poor affinity for the isolated ER, an alternate mechanism of action via AhR binding appeared possible, given the structural similarities between 4-MeOEN and AhR ligands, including 3-MC and 3,4-dimethoxyflavone (Fig. 1Go) (41, 42). Additionally, because AhR-Arnt exerts transcriptional action via binding to the DNA XRE that mediates expression of proteins involved in xenobiotic catabolism, this would be of relevance to detoxification of estrogen metabolites. However, in XRE luciferase-transfected MCF-7 cells, we observed 4-MeOEN to be a very weak AhR agonist. Moreover, application of siRNA for AhR had no effect on ERE luciferase activity induced by 4-MeOEN or E2, leading to the conclusion that at nanomolar concentrations, binding of 4-MeOEN or E2 to AhR does not influence ERE-dependent gene transcription. These observations on 4-MeOEN pointed to ER-mediated estrogenic activity. Further analysis of estrogenic time course and efficacy, ER degradation, and potential antagonist activity between 4-MeOEN and E2 indicated that 4-MeOEN mirrored the activity of E2, although with reduced potency.

Rapid estrogenic signaling in the brain has been recognized for some time, and there is now increasing interest in membrane-associated ER signal transduction leading to activation of phosphatidylinositol 3-kinase/Akt, protein kinase A, and MAPK/ERK cascades. Although these nonclassical, estrogenic mechanisms are often termed nongenomic, the intervening kinase cascades elicit genomic activity. Comparison of rapid ERK activation in MCF-7 cells treated with 4-MeOEN, 4-BrEN, 4-OHEN, and E2 demonstrated that all agents elevated pERK levels and that ERK activation was blocked by the antiestrogen ICI. Comparison of protein levels in these experiments (Fig. 6Go) and comparable experiments with a variety of agents (Bolton, J. L., and G. R. J. Thatcher, unpublished data) showed that concentration dependence and potency toward rapid ER-mediated signaling is not identical with that observed for classical ER-mediated activity. Indeed, in recent work using an E2-conjugate with reduced ER affinity (RBA ~3.8%), unable to cross the nuclear membrane, it was reported that the conjugate elevated pERK to twice the level observed for equimolar E2 (43). There is disagreement in the literature regarding the identity of the membrane-associated ER; candidates include new ER isoforms, posttranslationally modified ER LBD, and the G protein-coupled receptor-30 orphan receptor (44, 45), but 4-MeOEN, 4-Br-EN, 4-OHEN, and E2 were all seen to be active at membrane-associated ER.

The ER is a conformationally labile protein subject to posttranslational modification and in a cellular milieu is complexed to proteins including heat shock protein HSP-90, other chaperones, membrane scaffold proteins, and nuclear coregulators (46, 47). It is not unreasonable that affinity (RBA) measured in the isolated ER radioligand binding assay may not mirror ligand binding to ER in this cellular milieu. Computational modeling indicated that modest relaxation of the ER{alpha} LBD permitted 4-MeOEN binding without perturbation of helix 12, which causes antiestrogenic actions.

One additional possibility to accommodate the very low affinity of 4-MeOEN for isolated ER{alpha} with the observed estrogenicity in cell culture is further metabolism of 4-MeOEN to a more potent estrogen: the only reasonable candidate for such a metabolite is 4-OHEN, which itself showed low affinity in the ER{alpha} competitive binding assay. The putative CYP P450 catalyzed demethylation would have to occur to a similar extent in the different cell cultures studied; Ishikawa, MCF-7, and S30 (Fig. 1AGo). In tissues abundant in CYP P450 (48) and in vivo (49), 4-MeOE2 can be metabolically demethylated; and the enzyme kinetics for demethylation of 4-MeOE2 by CYP P450 1A1 (Michaelis constant > 30 µM) and 1B1 (Michaelis constant ~30 µM) have been reported (23) (Fig. 1BGo). It is theoretically possible that in cell culture, CYP P450-mediated demethylation of 4-MeOEN would yield 4-OHEN and that intracellular 4-OHEN would be sufficiently persistent to exert estrogenic activity more potent than observed in the competitive binding assay. To test this alternative hypothesis, the estrogenicity of 4-MeOEN in MCF-7 cells was compared with that of E2 in the presence of two CYP P450 inhibitors; again 4-MeOEN mirrored the behavior of E2. Work is in progress to quantify the cellular metabolites of 4-OHEN and 4-MeOEN, which is complicated by the high reactivity of oxidized 4-OHEN. Nevertheless, the conclusion supported by the weight of data presented herein is that 4-MeOEN is an estrogenic ligand eliciting ER-dependent activity with potency for genomic and nongenomic actions bracketing that of E2 itself.

2-Methoxyestrone, a major endogenous estrogen metabolite, has low ER affinity, lacks estrogenic activity, and is antiproliferative via non-ER-mediated mechanisms in breast cancer cells (35, 50). In contrast, 4-MeOEN, the primary comparable metabolite of the equine estrogens, is shown, for the first time, to be proliferative, eliciting classical and nonclassical ER-dependent mechanisms and gene transcription. Oxidative metabolism of equine estrogens generates the genotoxic catechol, 4-OHEN, the methylation of which to 4-MeOEN does not yield an inactive metabolite but produces a lipophilic, estrogenic compound of nanomolar potency that is proliferative in breast cancer cells. Equine estrogen metabolites may accumulate in long-term HRT and have potential to elicit both chemical and hormonal carcinogenesis.


    Acknowledgments
 
Dr. John Katzenellenbogen and Dr. Kathryn Carlson are thanked for providing assays.


    Footnotes
 
This work was supported by National Institutes of Health Grants CA73638 (to J.L.B.) and CA102590 (to G.R.J.T.) and American Cancer Society Institutional Research Grant (to M.C. through IRG 99-224 to Dr. Ronald Hoffman, University of Illinois at Chicago).

Present address for M.C.: Department of Metabolism and Pharmacokinetics, R&D Park, LG Life Sciences, Munji-dong 104-1, Yuseong-gu, Daejeon, Korea 305-380.

Disclosure Statement: The authors have nothing to disclose.

First Published Online June 21, 2007

Abbreviations: ABT, 1-Aminobenzotriazole; AhR, aryl hydrocarbon receptor; AP, alkaline phosphatase; Arnt, AhR nuclear translocator; 4-BrEN, 4-bromoequilenin; COMT, catechol-O-methyltransferase; DMSO, dimethylsulfoxide; E2, estradiol; EN, equilenin; ER, estrogen receptor; ERE, estrogen response element; h, human; HRT, hormone replacement therapy; ICI, ICI 182,780; LBD, ligand binding domain; 3-MC, 3-methylcholanthrene; 4-MeOEN, 4-methoxyequilenin; 17-4-MeOEN, 17ß-dihydro-4-methoxy-equilenin; {alpha}-NF, {alpha}-naphthoflavone; 4-OHEN, 4-hydroxyequilenin; RBA, relative binding affinity; si, small interfering; siSC, scrambled inhibitory RNA; XRE, xenobiotic response element.

Received November 27, 2006.

Accepted for publication June 13, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Liehr JG 1990 Genotoxic effects of estrogens. Mutat Res 238:269–276[Medline]
  2. Rossouw JE, Anderson GL, Prentice RL, LaCroix AZ, Kooperberg C, Stefanick, ML, Jackson RD, Beresford SA, Howard BV, Johnson KC, Kotchen JM, Ockene J 2002 Risks and benefits of estrogen plus progestin in healthy postmenopausal women: principal results from the Women’s Health Initiative randomized controlled trial. JAMA 288:321–333[Abstract/Free Full Text]
  3. Beral V 2003 Breast cancer and hormone-replacement therapy in the Million Women Study. Lancet 362:419–427[CrossRef][Medline]
  4. Ravdin PM, Cronin KA, Howlader N, Berg CD, Chlebowski RT, Feuer EJ, Edwards BK, Berry DA 2007 The decrease in breast-cancer incidence in 2003 in the United States. N Engl J Med 356:1670–1674[Abstract/Free Full Text]
  5. Liehr JG 2001 Genotoxicity of the steroidal oestrogens oestrone and oestradiol: possible mechanism of uterine and mammary cancer development. Hum Reprod Update 7:273–281[Abstract/Free Full Text]
  6. Zhu BT, Conney AH 1998 Functional role of estrogen metabolism in target cells: review and perspectives. Carcinogenesis 19:1–27[Medline]
  7. Zhu BT, Liehr JG 1996 Inhibition of catechol O-methyltransferase-catalyzed O-methylation of 2- and 4-hydroxyestradiol by quercetin. Possible role in estradiol-induced tumorigenesis. J Biol Chem 271:1357–1363[Abstract/Free Full Text]
  8. Zhang F, Chen Y, Pisha E, Shen L, Xiong Y, van Breemen RB, Bolton JL 1999 The major metabolite of equilin, 4-hydroxyequilin, autoxidizes to an o-quinone which isomerizes to the potent cytotoxin 4-hydroxyequilenin-o-quinone. Chem Res Toxicol 12:204–213[CrossRef][Medline]
  9. Zhang F, Swanson SM, van Breemen RB, Liu X, Yang Y, Gu C, Bolton JL 2001 Equine estrogen metabolite 4-hydroxyequilenin induces DNA damage in the rat mammary tissues: formation of single-strand breaks, apurinic sites, stable adducts, and oxidized bases. Chem Res Toxicol 14:1654–1659[CrossRef][Medline]
  10. Pisha E, Lui X, Constantinou AI, Bolton JL 2001 Evidence that a metabolite of equine estrogens, 4-hydroxyequilenin, induces cellular transformation in vitro. Chem Res Toxicol 14:82–90[CrossRef][Medline]
  11. Bhavnani BR 1998 Pharmacokinetics and pharmacodynamics of conjugated equine estrogens: chemistry and metabolism. Proc Soc Exp Biol Med 217:6–16[CrossRef][Medline]
  12. Liu X, Yao J, Pisha E, Yang Y, Hua Y, van Breemen RB, Bolton JL 2002 Oxidative DNA damage induced by equine estrogen metabolites: role of estrogen receptor {alpha}. Chem Res Toxicol 15:512–519[CrossRef][Medline]
  13. Spink DC, Zhang F, Hussain MM, Katz BH, Liu X, Hilker DR, Bolton JL 2001 Metabolism of equilenin in MCF-7 and MDA-MB-231 human breast cancer cells. Chem Res Toxicol 14:572–581[CrossRef][Medline]
  14. Yao J, Li Y, Chang M, Wu H, Yang X, Goodman JE, Liu X, Liu H, Mesecar AD, Van Breemen RB, Yager JD, Bolton JL 2003 Catechol estrogen 4-hydroxyequilenin is a substrate and an inhibitor of catechol-O-methyltransferase. Chem Res Toxicol 16:668–675[CrossRef][Medline]
  15. Shen L, Pisha E, Huang Z, Pezzuto JM, Krol E, Alam Z, van Breemen RB, Bolton JL 1997 Bioreductive activation of catechol estrogen-ortho-quinones: aromatization of the B ring in 4-hydroxyequilenin markedly alters quinoid formation and reactivity. Carcinogenesis 18:1093–1101[Abstract/Free Full Text]
  16. Rao PN, Somawardhana CW 1987 Synthesis of 2-methoxy and 4-methoxy equine estrogens. Steroids 49:419–432[CrossRef][Medline]
  17. Liu X, Zhang F, Liu H, Burdette JE, Li Y, Overk CR, Pisha E, Yao J, van Breemen RB, Swanson SM, Bolton JL 2003 Effect of halogenated substituents on the metabolism and estrogenic effects of the equine estrogen, equilenin. Chem Res Toxicol 16:741–749[CrossRef][Medline]
  18. Jiang SY, Jordan VC 1992 Growth regulation of estrogen receptor-negative breast cancer cells transfected with complementary DNAs for estrogen receptor. J Natl Cancer Inst 84:580–591[Abstract/Free Full Text]
  19. Overk CR, Yao P, Chadwick LR, Nikolic D, Sun Y, Cuendet MA, Deng Y, Hedayat AS, Pauli GF, Farnsworth NR, van Breemen RB, Bolton JL 2005 Comparison of the in vitro estrogenic activities of compounds from hops (Humulus lupulus) and red clover (Trifolium pratense). J Agric Food Chem 53:6246–6253[CrossRef][Medline]
  20. Labarca C, Paigen K 1980 A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102:344–352[CrossRef][Medline]
  21. Catherino WH, Jordan VC 1995 Increasing the number of tandem estrogen response elements increases the estrogenic activity of a tamoxifen analogue. Cancer Lett 92:39–47[CrossRef][Medline]
  22. Payne J, Jones C, Lakhani S, Kortenkamp A 2000 Improving the reproducibility of the MCF-7 cell proliferation assay for the detection of xenoestrogens. Sci Total Environ 248:51–62[CrossRef][Medline]
  23. Dawling S, Roodi N, Parl Fritz F 2003 Methoxyestrogens exert feedback inhibition on cytochrome P450 1A1 and 1B1. Cancer Res 63:3127–3132[Abstract/Free Full Text]
  24. Mugford CA, Mortillo M, Mico BA, Tarloff JB 1992 1-Aminobenzotriazole-induced destruction of hepatic and renal cytochromes P450 in male Sprague-Dawley rats. Fundam Appl Toxicol 19:43–49[CrossRef][Medline]
  25. Dubey RK, Jackson EK, Gillespie DG, Rosselli M, Barchiesi F, Krust A, Keller H, Zacharia LC, Imthurn B 2005 Cytochromes 1A1/1B1- and catechol-O-methyltransferase-derived metabolites mediate estradiol-induced antimitogenesis in human cardiac fibroblast. J Clin Endocrinol Metab 90:247–255[Abstract/Free Full Text]
  26. Rochat B, Morsman JM, Murray GI, Figg WD, McLeod HL 2001 Human CYP1B1 and anticancer agent metabolism: mechanism for tumor-specific drug inactivation? J Pharmacol Exp Ther 296:537–541[Abstract/Free Full Text]
  27. Ohtake F, Takeyama K, Matsumoto T, Kitagawa H, Yamamoto Y, Nohara K, Tohyama C, Krust A, Mimura J, Chambon P, Yanagisawa J, Fujii-Kuriyama Y, Kato S 2003 Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 423:545–550[CrossRef][Medline]
  28. Santostefano M, Merchant M, Arellano L, Morrison V, Denison MS, Safe S 1993 {alpha}-Naphthoflavone-induced CYP1A1 gene expression and cytosolic aryl hydrocarbon receptor transformation. Mol Pharmacol 43:200–206[Abstract]
  29. Gasiewicz TA, Rucci G 1991 {alpha}-Naphthoflavone acts as an antagonist of 2,3,7, 8-tetrachlorodibenzo-p-dioxin by forming an inactive complex with the Ah receptor. Mol Pharmacol 40:607–612[Abstract]
  30. Brown AM, Jeltsch JM, Roberts M, Chambon P 1984 Activation of pS2 gene transcription is a primary response to estrogen in the human breast cancer cell line MCF-7. Proc Natl Acad Sci USA 81:6344–6348[Abstract/Free Full Text]
  31. Levenson AS, Catherino WH, Jordan VC 1997 Estrogenic activity is increased for an antiestrogen by a natural mutation of the estrogen receptor. J Steroid Biochem Mol Biol 60:261–268[CrossRef][Medline]
  32. Seidel SD, Li V, Winter GM, Rogers WJ, Martinez EI, Denison MS 2000 Ah receptor-based chemical screening bioassays: application and limitations for the detection of Ah receptor agonists. Toxicol Sci 55:107–115[Abstract/Free Full Text]
  33. Lee JE, Safe S 2000 3',4'-Dimethoxyflavone as an aryl hydrocarbon receptor antagonist in human breast cancer cells. Toxicol Sci 58:235–242[Abstract/Free Full Text]
  34. Mueck AO, Seeger H, Wallwiener D 2003 Comparison of the proliferative effects of estradiol and conjugated equine estrogens on human breast cancer cells and impact of continuous combined progestogen addition. Climacteric 6:221–227[Medline]
  35. Van Aswegen CH, Purdy RH, Wittliff JL 1989 Binding of 2-hydroxyestradiol and 4-hydroxyestradiol to estrogen receptors from human breast cancers. J Steroid Biochem 32:485–492[CrossRef][Medline]
  36. Martucci CP, Fishman J 1979 Impact of continuously administered catechol estrogens on uterine growth and luteinizing hormone secretion. Endocrinology 105:1288–1292[Abstract/Free Full Text]
  37. Dubey RK, Gillespie DG, Zacharia LC, Rosselli M, Korzekwa KR, Fingerle J, Jackson EK 2000 Methoxyestradiols mediate the antimitogenic effects of estradiol on vascular smooth muscle cells via estrogen receptor-independent mechanisms. Biochem Biophys Res Commun 278:27–33[CrossRef][Medline]
  38. Zhu BT, Han GZ, Shim JY, Wen Y, Jiang XR 2006 Quantitative structure-activity relationship of various endogenous estrogen metabolites for human estrogen receptor {alpha} and ß subtypes: insights into the structural determinants favoring a differential subtype binding. Endocrinology 147:4132–4150[CrossRef][Medline]
  39. Astroff B, Safe S 1988 Comparative antiestrogenic activities of 2,3,7,8-tetrachlorodibenzo-p-dioxin and 6-methyl-1,3,8-trichlorodibenzofuran in the female rat. Toxicol Appl Pharmacol 95:435–443[CrossRef][Medline]
  40. Wormke M, Stoner M, Saville B, Safe S 2000 Crosstalk between estrogen receptor {alpha} and the aryl hydrocarbon receptor in breast cancer cells involves unidirectional activation of proteasomes. FEBS Lett 478:109–112[CrossRef][Medline]
  41. Casper RF, Quesne M, Rogers IM, Shirota T, Jolivet A, Milgrom E, Savouret JF 1999 Resveratrol has antagonist activity on the aryl hydrocarbon receptor: implications for prevention of dioxin toxicity. Mol Pharmacol 56:784–790[Abstract/Free Full Text]
  42. Amakura Y, Tsutsumi T, Nakamura M, Kitagawa H, Fujino J, Sasaki K, Toyoda M, Yoshida T, Maitani T 2003 Activation of the aryl hydrocarbon receptor by some vegetable constituents determined using in vitro reporter gene assay. Biol Pharm Bull 26:532–539[CrossRef][Medline]
  43. Harrington WR, Kim SH, Funk CC, Madak-Erdogan Z, Schiff R, Katzenellenbogen JA, Katzenellenbogen BS 2006 Estrogen dendrimer conjugates that preferentially activate extranuclear, nongenomic versus genomic pathways of estrogen action. Mol Endocrinol 20:491–502[Abstract/Free Full Text]
  44. Warner M, Gustafsson JA 2006 Nongenomic effects of estrogen: why all the uncertainty? Steroids 71:91–95[CrossRef][Medline]
  45. Pedram A, Razandi M, Levin ER 2006 Nature of functional estrogen receptors at the plasma membrane. Mol Endocrinol 20:1996–2009[Abstract/Free Full Text]
  46. Gee AC, Carlson KE, Martini PG, Katzenellenbogen BS, Katzenellenbogen JA 1999 Coactivator peptides have a differential stabilizing effect on the binding of estrogens and antiestrogens with the estrogen receptor. Mol Endocrinol 13:1912–1923[Abstract/Free Full Text]
  47. Kuiper GG, Lemmen JG, Carlsson B, Corton JC, Safe SH, van der Saag PT, van der Burg B, Gustafsson JA 1998 Interaction of estrogenic chemicals and phytoestrogens with estrogen receptor ß. Endocrinology 139:4252–4263[Abstract/Free Full Text]
  48. Jefcoate CR, Liehr JG, Santen RJ, Sutter TR, Yager JD, Yue W, Santner SJ, Tekmal R, Demers L, Pauley R, Naftolin F, Mor G, Berstein L 2000 Tissue-specific synthesis and oxidative metabolism of estrogens. J Natl Cancer Inst Monogr 95–112
  49. Ball P, Stubenrauch G, Knuppen R 1977 Metabolism of 2-methoxy- and 4-methoxyoestrone in man in vivo. J Steroid Biochem 8:989–993[CrossRef][Medline]
  50. LaVallee TM, Zhan XH, Herbstritt CJ, Kough EC, Green SJ, Pribluda VS 2002 2-Methoxyestradiol inhibits proliferation and induces apoptosis independently of estrogen receptors {alpha} and ß. Cancer Res 62:3691–3697[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chang, M.
Right arrow Articles by Thatcher, G. R. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chang, M.
Right arrow Articles by Thatcher, G. R. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals