| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, Chicago, Illinois 60612
Address all correspondence and requests for reprints to: Gregory R. J. Thatcher, Department of Medicinal Chemistry and Pharmacognosy, College of Pharmacy, University of Illinois at Chicago, Chicago, Illinois 60612. E-mail: thatcher{at}uic.edu.
| Abstract |
|---|
|
|
|---|
. These estrogenic actions were blocked by the antiestrogen ICI 182,780. In the standard radioligand estrogen receptor (ER) binding assay, 4-MeOEN showed very weak binding. To test for alternate ligand-ER-independent mechanisms, the possibility of aryl hydrocarbon receptor (AhR) binding and ER-AhR cross talk was examined using a xenobiotic response element-luciferase reporter and using AhR small interfering RNA silencing in the ERE-luciferase reporter assay. The results negated the possibility of AhR-mediated estrogenic activity. Comparison of gene transcription time course, ER degradation, and rapid activation of MAPK/ERK in MCF-7 cells demonstrated that the actions of 4-MeOEN mirrored those of E2 with potency for classical and nonclassical estrogenic pathways bracketing that of E2. Methylation of 4-OHEN may not represent a detoxification pathway because 4-MeOEN is a full, potent estrogen agonist. | Introduction |
|---|
|
|
|---|
Although the molecular mechanisms underlying estrogen-associated carcinogenesis are not completely established, the estrogen receptor (ER) is seen as a prime mediator of hormonal carcinogenesis. Estrogenic (agonist) activity at the ER leads to cellular proliferation commonly seen as providing increased opportunity for accumulation of the genetic damage that can initiate carcinogenesis and proliferation of preneoplastic and neoplastic cells. Reactive intermediates derived from estrogen metabolism that cause DNA damage by direct and indirect chemical reactions have the capacity to induce chemical carcinogenesis (5). However, the hormonal activity of estrogen metabolites as ER agonists has less frequently been studied as a potential contributor to carcinogenesis.
Estrogens are oxidatively metabolized to form catechols that are subject to conjugative metabolism including formation of methoxy-estrogens by catechol-O-methyltransferase (COMT) (6). Oxidative metabolism of estrogens generates genotoxic reactive intermediates, whereas conjugative metabolism is considered a detoxification pathway (6, 7). Studies on the 2-hydroxy, 4-hydroxy, and 2-methoxy metabolites of endogenous estrogens have begun to show that the metabolites possess biological activity independent of the parent estrogens that must form part of the puzzle of estrogen-associated carcinogenesis (6).
In contrast to endogenous estrogens, the equine estrogens are predominantly hydroxylated at the 4-position, yielding catechols that are considerably more reactive and cytotoxic than their human estrogen counterparts. The catechol, 4-hydroxyequilenin (4-OHEN), is the major phase 1 oxidative metabolite of the equine estrogens contained in the most widely prescribed HRT formulations (8). 4-OHEN autoxidizes to an o-quinone (Fig. 1
), which has been shown to react with DNA leading to a variety of DNA lesions (9). In human breast cancer cells, 4-OHEN was found to induce DNA damage, in addition to acting as an effective carcinogen in cultured cell models (10). The parent equine estrogens exert biological effects in estrogen target tissues via interaction with the ER, and 4-OHEN has also been reported to induce estrogenic effects, although the chemical instability of 4-OHEN hinders study of its hormonal actions (11, 12). Conjugative metabolism of 4-OHEN yields the stable O-methylated metabolite, 4-methoxyequilenin (4-MeOEN), which has been identified in breast cancer cells (Fig. 1
) (13, 14). An important question to be asked is whether catechol O-methylation represents a detoxification pathway or whether these metabolites are themselves proliferative or mitotic agents able to elicit responses via ER or other relevant nuclear receptors. The potential ability of equine estrogen metabolites to function as hormonal carcinogens, added to their known ability to function as chemical carcinogens, might indicate that metabolic bioactivation is a contributor to carcinogenesis associated with HRT.
|
| Materials and Methods |
|---|
|
|
|---|
Cell culture
All cell culture reagents were purchased from Invitrogen (Carlsbad, CA) unless stated otherwise. MCF-7 cells (American Type Culture Collection, Manassas, VA) and a clonal derivative, MCF-7 WS8 human breast cancer cells (a kind gift from Dr. V. C. Jordan, Fox Chase Cancer Center, Philadelphia, PA), were maintained in RPMI 1640 containing 10% fetal bovine serum (Atlanta Laboratory, Atlanta, GA), 2 mM L-glutamine, 0.1 mM nonessential amino acids, and 6 µg/ml bovine insulin (Sigma). Estrogen-free media were prepared by supplementing 3x dextran-coated charcoal-treated fetal bovine serum to phenol-red-free RPMI 1640 media, whereas other components remained the same. S30 cells (a gift from Dr. V. C. Jordan) were derived from MDA-MB-231 human breast cancer cells by stable transfection of cDNA encoding the wild-type ER
(18) and maintained in phenol red-free MEM supplemented with 5% 3x dextran-coated charcoal-treated calf serum, 0.5 mg/ml geneticin, and concentrations of glutamine, nonessential amino acids, and insulin the same as those for MCF-7 cells.
ER competitive ligand binding assay
Competitive displacement of [3H] estradiol (E2) radioligand (Amersham Biosciences, Piscataway, NJ) from full-length recombinant human (h) ER
or hERß (PanVera/Invitrogen, Carlsbad, CA) was assayed as described previously (10, 12). Briefly, the ER binding buffer consisted of 10 mM Tris-Cl (pH 7.5), 10% glycerol, 2 mM dithiothrietol, 1 mg/ml BSA, and test compounds [or dimethylsulfoxide (DMSO) vehicle control] were incubated with ER (5 nM) and radioligand (20 nM) at room temperature for 2 h. The percent inhibition of [3H]E2 binding to each ER was determined as follows: [1 – (dpmsample – dpmblank)/(dpmDMSO – dpmblank)] x 100. The binding (expressed as percent) was calculated in comparison with estradiol (50 nM, 100%) to generate concentration-binding curves and hence IC50 values. Relative binding affinity (RBA) was as follows: RBA = 100 x [IC50(E2)/IC50(sample)]. The RBA values kindly provided by J. Katzenellenbogen and K. Carlson (University of Illinois at Urbana-Champagne) were obtained from incubations of ER with radioligand (2 nM) and test sample for 18–24 h at 0 C.
Induction of alkaline phosphatase in Ishikawa cells
The procedure of Overk et al. (19) was used as described previously. Briefly, Ishikawa cells (5 x 104 cells/ml) were incubated overnight with estrogen-free media in 96-well plates, test compounds or vehicle was added, and cells were incubated for a further 4 d before assay of alkaline phosphatase (AP) activity. The data represent the average ± SD of three determinations.
Cell proliferation assays
MCF-7 cells were seeded at 1.5 x 104 cells/well in 24-well plates after cultured in estrogen-free media for 4 d. Cells were treated with compounds every 2–3 d for 6 d in triplicate. The cell growth was determined by measuring the DNA amount (20). Briefly, cells were lysed with 100 µl/well 1x passive lysis buffer (Promega, Madison, WI), and the lysates were resuspended in 400 µl/well 0.1x PBS followed by sonication. DNA content was detected with a 96-well fluorescence reader using an excitation filter of 360–390 nm and an emission filter of 450–470 nm after 30 µl of cell lysates were incubated with 200 µl of 2 µg/ml of Hoechst 33258 (Bio-Rad Laboratories, Hercules, CA) for 1 h. DNA amount in each sample was calculated as calf thymus DNA as a standard.
Western blot analysis
MCF-7 cells were grown in estrogen-free media for 4 d before compound treatment. Cells were either treated for 24 h with compounds as indicated or, for analysis of ERK (p42/44 MAPK) analysis, pretreated with ICI or vehicle for 30 min before addition of test compounds, followed by incubation for a further 5 min. Cells were trypsinized, pelleted, washed in PBS, resuspended in ip buffer [50 mM HEPES, 150 mM NaCl, 1 mM EDTA, 2.5 mM EGTA, 10 mM ß-glycerophosphate, 10% glycerol, and 0.5% Nonidet P-40 (pH 8.0)] containing protease inhibitors, mixed, and centrifuged at 12,000 x g for 10 min. Protein concentration was measured in supernatants using the Bradford assay kit (Bio-Rad Laboratories). Equal aliquots of total protein samples (20 µg/lane) were electrophoresed on a 10% Bis-Tris polyacrylamide gel, transferred to PVDF membranes (Millipore, Bedford, MA), and blotted using antibodies to ER
(G-20; Santa Cruz Biotechnology, Santa Cruz, CA) or phospho-p44/p42 MAPK (Thr202/Tyr20) (Cell Signaling Technology, Beverly, MA). ß-Actin (AC-15; Sigma) or total ERK (p44/42 MAPK) antibody (Cell Signaling Technology) was used as a control for loading and transfer. The blotted proteins were visualized using the enhanced chemiluminescence detection system (Amersham Biosciences) and quantitated using Bio-Rad Quantity One software.
Transient transfection and luciferase assays
Cells were cultured in estrogen-free media for 4 d before transfection. The cells were transfected with 2 µg of the pERE-luciferae plasmid, which contains three copies of the Xenopus laevis vitellogenin A2 ERE upstream of fire fly luciferase (a gift from Dr. V. C. Jordan) (21). To normalize transfection efficiency, pRL-TK plasmid (1 µg; Promega), which contains a cDNA encoding Renilla luciferase, was cotransfected. In some experiments, pGudLuc1.1 (a gift from Dr. Michael S. Denison, University of California, Davis, Davis, CA) containing four copies of the XRE upstream of firefly luciferase was transfected. Cells (5 x 106) in serum-free media were transfected by electroporation in a 0.4-cm cuvette (Bio-Rad Laboratories) at a voltage of 0.320 kV and a high capacitance of 950 µF in a GenePulser X-cell (Bio-Rad Laboratories). The cells were resuspended in estrogen-free media, transferred to 12-well plates immediately after electroporation, and incubated overnight. The cells were treated with the appropriate compounds for 24 h. The luciferase activities in cell lysates were measured using dual luciferase assay system (Promega) with a FLUOstar OPTIMA (BMG Labtech, Durham, NC). Data are reported as relative luciferase activity, which is the firefly luciferase reading divided by the Renilla luciferase reading.
Total RNA isolation and quantitative PCR analysis
MCF-7 and S30 cells grown in estrogen-free media were treated with compounds as indicated. Total RNA was extracted from cell pellets using the RNeasy kit (QIAGEN, Valencia, CA) according to the manufacturers instructions. Total RNA (2 µg) was reverse transcribed with Moloney murine leukemia virus reverse transcriptase using TaqMan reverse transcript reagents kit (Applied Biosystems, Foster City, CA). Depending on the gene of interest, 1 or 2 µl of reaction mixture were used in the following real-time PCR quantification. The PCR and subsequent analyses were performed using the GeneAmp 5700 sequence detection system (Applied Biosystems).
Probes and primers were designed using Primer Express software (Applied Biosystems) and synthesized by Applied Biosystems. TGF-
forward and reverse primers and probe sequences (5' to 3') were GTTTTTGGTGCAGGAGGACAA, CACAGCGTGCACCAACGT and CCAGCATGTGTCTGCCATTCTGGG, respectively; and pS2 forward and reverse primers and probe sequences (5' to 3') were CGTGAAAGACAGAATTGTGGTTTT, CGTCGAAACAGCAGCCCTTA, and TGTCACGCCCTCCCAGTGTGCA, respectively. 18S rRNA TaqMan probe and primers (TaqMan predeveloped assay reagent control; Applied Biosystems) were used as an internal control. All probes were labeled with 6-carboxyfluorescein, and TAMRA was used as the 3'-quencher in all cases.
The PCR mixture contained TaqMan Universal master mix (Applied Biosystems) and different concentrations of primers and probes, depending on the genes subject to analysis. Real-time quantitative PCR consisted of one cycle of 50 C for 2 min and 95 C for 10 min and 40 cycles of 95 C for 15 sec and 60 C for 1 min. The fluorescence signal was measured during the last 30 sec of the annealing/extension phase. A standard curve was derived using RNA samples from vehicle control-treated cells. Data were normalized by dividing the expression level of a specific gene by that of 18S rRNA; results were expressed as a fold induction where the gene expression level in vehicle control-treated cells was set as 1.
Transient transfection of small interfering (si) RNAs
siRNA duplexes were prepared by Dharmacon Research (Lafayette, CO). Each siRNA was prepared with TT overhang to the end of 3' position. The sense sequence (5' to 3') of siRNA duplexes for AhR (siAhR) was UAC UUC CAC CUC AGU UGG C (nucleotide positions 774–792), CGU ACG CGG AAU ACU UCG A for firefly luciferase (siLuc; nucleotide positions 153–171), and GCGCGCUUUGUAGGAUUCG for scrambled inhibitory RNA (siSC; nucleotide positions 24750–24768). The sequence for siSC was derived from a message transcribed from the chloroplast genome of Euglena gracilis. Cells were cultured in estrogen-free media for 4 d and seeded at a density of 8 x 105 cells/well in six-well plates 24 h before transfection experiments. siRNA duplexes (100 nM/well), pERE-Luc plasmid (0.5 µg/well), and pRL-TK (0.5 µg/well) were transfected using Lipofectamine 2000 reagent (Invitrogen) and incubated for 24 h. Cells were treated with the appropriate compounds for another 24 h. Luciferase activities were determined as described above.
Statistics
The data were reported as the mean ± SD. Statistical comparisons between control and treated groups were performed using either Students t test or single-factor ANOVA model. Differences in results among data sets were considered statistically significant when P < 0.05 unless stated otherwise.
Computational methods
The structure for ER
ligand binding domain (LBD) extracted from the crystal structure (Protein Database code: 1ERE) was examined using SYBYL 7.2 software (Tripos, Inc., St. Louis, MO; 2004). FlexX and FlexPharm were used to dock the compounds at an active site designed at r = 6.5 Å from E2 with core subpocket residues such as Glu353, Arg394, His524, and Glu353 set as an optional H-bond acceptor. Experimental ER
binding affinities for equilenin (EN), 4-BrEN, 4-chloroequilenin (4-CIEN), and 4-fluoroequilenin (4-FEN) were used as a small training set to evaluate binding energies.
| Results |
|---|
|
|
|---|
-positive Ishikawa cells is used as a standard screening assay for estrogenic and antiestrogenic compounds. Full concentration-response curves were obtained at 10–9 to 10–5 M test compounds (data not shown). 4-BrEN was observed to induce AP (EC50
6 x 10–8 M) in accord with published data and the reported RBA for ER
(17); both 4-MeOEN and 17-4-MeOEN were also observed to induce AP (EC50
1 x 10–7 M and 1 x 10–6 M, respectively).
The radioligand displacement assay for ER binding is carried out using incubations of test compound with ER at 0–25 C for 2–24 h; the standard assay incorporates BSA for ER stabilization. Although hydrophobic molecules are known to have affinity for BSA, nonspecific binding is also likely to compete with ER binding in a cellular milieu; therefore, this assay is normally expected to be predictive of estrogenic activity in cells. IC50 values for neither 4-MeOEN nor 17-4-MeOEN could be obtained in the assay after 2 h incubation because no reproducibly significant binding was observed, even at micromolar concentrations (
50 µM). ER binding by the structurally related equilenin derivatives, 4-OHEN and 4-BrEN (Fig. 1
), has been reported, although 4-OHEN was observed to be a low-affinity ligand: RBA (ER
) approximately 0.4% (12, 17). In light of the estrogenic activity seen in Ishikawa cells, the RBA was assayed by radioligand displacement in the Katzenellenbogen lab using an 18- to 24-h incubation period, which confirmed the extremely low affinity for recombinant hER of 4-MeOEN (RBA: ER
, 0.003%; ERß, 0.006%) and 17-4-MeOEN (RBA: ER
, 0.018%; ERß, 0.025%). The RBA determination for binding of 4-MeOEN to ER
predicts a reduced potency of at least 105 fold relative to E2.
Given the discrepancy between the measured ER
RBA for 4-MeOEN and the observed estrogenicity in Ishikawa cells, the ER
binding of 4-MeOEN was examined computationally using the protein structure obtained from the E2-bound complex. The calculated docking scores to the rigid receptor indicated an ER
affinity for 4-MeOEN higher than that for 4-BrEN.
Cell proliferation by 4-MeOEN in MCF-7 cells
Proliferation of ER
-positive MCF-7 breast cancer cells is a well-established assay for assessing estrogenic activity. Sensitivity for measuring estrogen-stimulated growth was maximized by treatment with test compounds for 6 d after estrogen deprivation for 4 d and quantification of DNA as the measure of proliferation. E2 itself increased cell growth up to 7-fold, compared with vehicle control in a concentration-dependent manner in good agreement with the published data (Fig. 2
) (22). 4-MeOEN also increased cell proliferation with comparable efficacy to E2 but with lower potency (EC50
10–9 M). To rule out any antagonistic or antiestrogenic effects of 4-MeOEN on E2-stimulated cell growth, cells were treated with E2 at a fixed concentration of 4-MeOEN (10–7 M) and with 4-MeOEN at a fixed concentration of E2 (10–9 M): the fixed concentrations selected corresponded to maximal activity. To determine whether proliferative activity was ER mediated, cells were cotreated with the antiestrogen ICI (Fig. 2
). ICI completely blocked cell proliferation in E2-treated cells (data not shown). Proliferation in response to 4-MeOEN was also abolished by ICI, strongly indicating that MeOEN effects proliferation via an ER-dependent mechanism.
|
3 x 10–11 vs. 7 x 10–9 M, respectively). In addition, ICI completely abolished the luciferase activity induced by both E2 and 4-MeOEN (Fig. 4
|
|
The ERE-luciferase reporter was also used to test the influence of metabolism on the estrogenicity of 4-MeOEN and E2. CYP P450 has been reported to demethylate 4-MeOE2, in addition to the expected oxidative activity in catalyzing formation of 4-OHE2 and further quinone formation (Fig. 1
) (6, 23). A CYP P450 inhibitor would therefore be expected both to inhibit oxidation of E2 and the putative demethylation of 4-MeOEN. The impact on ERE-luciferase induction by E2 and by 4-MeOEN would be predicted to be negligible if E2 and 4-MeOEN are the ultimate estrogens. The CYP P450 inhibitor
-naphthoflavone (
-NF) and the broad-spectrum irreversible inhibitor 1-aminobenzotriazole (ABT) (24, 25, 26) were preincubated with MCF-7 cells before estrogen treatment. In control incubations, both inhibitors significantly induced ERE-luciferase but not Renilla luciferase, compared with vehicle control (Fig. 3C
); one possible explanation being activation via binding to AhR and cross talk with ER, inducing the ERE-target gene (27, 28). Therefore, in addition to normalizing transfection efficiency using the Renilla luciferase activity, the background ERE-luciferase activity of the inhibitors was subtracted. The effect of the CYP P450 inhibitors on ERE-luciferase induction by E2 was identical with that of the inhibitors on 4-MeOEN mediated induction, suggesting that these molecules are the proximal estrogenic species. The broad-spectrum CYP P450 inhibitor ABT had no effect, whereas
-NF inhibited the efficacy of both E2 and 4-MeOEN (Fig. 3C
). Often used as a selective CYP P450 1A1 inhibitor,
-NF is also a noncompetitive CYP P450 1B1 inhibitor (inhibitory constant = 2.8 ± 0.5 nM) (26) and has been reported to down-regulate ER expression via an AhR-dependent mechanism, which may account for the reduction in efficacy of both E2 and 4-MeOEN (29).
Analysis of estrogen-responsive gene expression
To further study the 4-MeOEN-mediated transcriptional activity of ER at a target gene in situ, the levels of endogenous estrogen-responsive genes were measured in total RNA isolated from cells treated with 4-MeOEN. pS2 and TGF-
were chosen as the target genes because it is well documented that expression of these genes is modulated in response to estrogenic compounds. The expression levels of mRNA for pS2 and TGF-
were measured using real-time PCR in MCF-7 cells treated with compounds for 24 h. Treatment with E2 (1 nM) and 4-MeOEN (100 nM) resulted in 100- and 70-fold induction of the pS2 gene, respectively, compared with vehicle control (Fig. 5
). E2 induction of pS2 mRNA in MCF-7 cells by 30-fold was reported using Northern blot (30). Interpretation of mechanistic differences between E2 and 4-MeOEN based on the variation in pS2 induction levels is unsafe without further concentration-induction studies in alternative cell lines. The level of TGF-
mRNA was investigated in S30 cells, an alternative ER
-positive breast cancer cell line. Treatment with E2 (1 nM) and 4-MeOEN (100 nM) resulted in 4-fold induction of gene expression, compared with vehicle control, which was again completely blocked by application of ICI (Fig. 5
). Fold induction of TGF-
by E2 is consistent with the published Northern blot analysis (31).
|
and pERK protein levels in MCF-7 cells
protein in human breast cancer cells, MCF-7 cells were treated with DMSO/EtOH vehicle, E2, ICI, 4-MeOEN, or a combination of two compounds for 24 h in estrogen-free media. The amount of ER
protein was determined by Western blot analysis. Cells treated with E2 or with ICI showed a 50 or 90% decrease in ER
protein levels, respectively, compared with control (Fig. 6
protein level, whereas lower concentrations gave no significant differences, compared with control. The combination of ICI with either E2 or 4-MeOEN showed a 70% decrease in ER
. The levels of ER
mRNA were also assessed to determine whether any differences existed between the mechanisms of ER
protein degradation induced by E2 and 4-MeOEN that might be reflected at the transcriptional level. Both E2 and 4-MeOEN decreased the amount of ER
mRNA in MCF-7 cells, whereas ICI did not change ER
mRNA levels (data not shown), showing that 4-MeOEN and E2 have similar effects on ER
transcription and expression.
|
Assays for the XRE-luciferase reporter gene transcription
There are reports that ligand binding and activation of AhR leads to recruitment of ER
, which induces gene transcription via ER binding to ERE (27). Therefore, it was investigated whether 4-MeOEN could activate ER
-mediated transcription through AhR-ER
cross talk in which 4-MeOEN may act as a novel AhR ligand. An XRE-driven reporter gene assay was used because it is known that the ligand-AhR complex with AhR nuclear translocator (Arnt) binds to specific DNA sequences named as XRE leading to gene transcription (32). In XRE-luciferase transfected MCF-7 cells, 4-MeOEN activated luciferase reporter activity 5-fold at 1 µM but only 2-fold at 100 nM (Fig. 3B
). In contrast, E2 activation via XRE exceeded 10-fold at 100 nM. For comparison, 3-methylcholanthrene (3-MC), a powerful AhR agonist, was studied in this assay and the observed activity at 3-MC (1 µM) set at 100% (27). In addition, 3',4'-dimethoxyflavone, reported to be an AhR antagonist (33), completely inhibited 4-MeOEN-induced XRE-reporter activity (data not shown).
Effect of AhR on ERE-luciferase gene transcription
To investigate cross talk between AhR and ER
, the ERE reporter assay was conducted in transfected MCF-7 cells in the presence of siRNA targeting AhR genes. AhR siRNA treatment was predicted to ablate ERE-mediated luciferase gene expression if the mechanism required AhR-ER cross talk initiated by binding of ligand to AhR. Cells were incubated with appropriate siRNA duplexes designed to block the expression of AhR (siAhR), firefly luciferase (siLuc; as a cross-check for luciferase induction), or E. gracilis (siSC; as a control for RNA interference performance). ERE-luciferase reporter induction by both E2 and 4-MeOEN was unperturbed by siAhR (Fig. 7
), implying that the presence of AhR is not required for induction of ERE-luciferase activity, at least at these concentrations of E2 and 4-MeOEN. All control experiments were consistent with this observation. The concentrations of E2 and 4-MeOEN studied were equipotent in the XRE-luciferase assay (Fig. 3B
). These data are compatible with 4-MeOEN-induced ERE-dependent gene transcription resulting from binding to ER
not to AhR.
|
| Discussion |
|---|
|
|
|---|
In contrast to human estrogens, the equine estrogens are predominantly hydroxylated at the 4-position to give 4-OHEN and 17-4-OHEN, which, unlike endogenous catechol estrogens, autoxidize to o-quinones that are genotoxic and carcinogenic in breast cancer cells (Fig. 1
) (8, 9, 10). Quinones damage biomolecules via oxidative mechanisms, in addition to alkylating biomolecules including DNA, providing multiple mechanisms of chemical carcinogenesis. Cellular defenses targeted to quinones have been argued to rely on nicotinamide-dependent quinone oxidoreductase to reduce the quinone to a catechol and on COMT to methylate the catechol, blocking quinone formation. Whereas conjugative phase 2 metabolism, such as glucuronidation, generally increases hydrophilicity and clearance, metabolism by COMT increases lipophilicity, potentially leading to accumulation of metabolites in fatty tissue, which is of particular relevance to breast cancer in long-term therapies such as HRT. Conjugative metabolism of 4-OHEN gives the stable O-methylated metabolite 4-MeOEN, which has been identified in breast cancer cells and therefore warrants study (13, 14).
In the radioligand binding assay, extremely low ER affinity was measured herein for 17-4-MeOEN and 4-MeOEN (RBA = 0.001%). We have previously reported the activity of 4-OHEN and its stable synthetic halide congeners, including 4-BrEN: RBA was low, but measurable for 4-OHEN and 4-BrEN (Fig. 1
) (12). Rigorous determination of the estrogenic activity of 4-OHEN in cell culture is severely hampered by its reactivity [autoxidation half-time
0.5 min; decomposition half-time
138 min (8, 17)]; hence, the low potency observed for AP induction in Ishikawa cells (IC50
6 µM) and low RBA (0.1–0.4%) probably reflect the decomposition of 4-OHEN in the assay media. For comparison, the catechol estrogens, 4-OHE2 and 4-OHE, which have much lower oxidative lability, show approximately 5- to 10-fold diminished potency in ER
ligand binding and Ishikawa-AP activity, compared with the parent estrogens (12), whereas the ER
RBA values recently reported for 4-OHE, 4-OHE2, and 4-MeOE2 are 2, 70, and 2%, respectively (38). The very low RBA value measured for 4-MeOEN was not rationalized by computational docking studies using ER
LBD. It was therefore not entirely surprising that 17-4-MeOEN and 4-MeOEN proved estrogenic toward AP induction in Ishikawa cells, the latter showing nanomolar potency. However, the low RBA measurement made it essential to first confirm estrogenicity and second determine whether the estrogenic activity was ER mediated.
Because target tissues for equine estrogens are estrogen responsive, the effects of 4-MeOEN on ER-mediated transcriptional activities were studied in ER
-positive MCF-7 and S30 breast cancer cells. The results using ERE reporter assays and induction of the classical estrogen-responsive genes TGF-
and pS2 confirmed that 4-MeOEN is estrogenic with nanomolar potency (e.g. EC50
1–7 x 10–9 M for cell proliferation and ERE-luciferase induction). Moreover, all estrogenic actions of 4-MeOEN and E2 were blocked by the antiestrogen ICI, strongly implying actions mediated by ligand-ER complexes.
The classical mechanism of estrogenic hormonal function involves ligand binding to cytosolic ER, dimerization, translocation to the nucleus, recruitment of coregulator proteins, and direct interaction with ERE leading to gene transcription. In the absence of estrogens, cross talk with other receptor pathways, such as the IGF-I and epithelial growth factor receptors, is able to modulate ER-mediated activity through ER phosphorylation. Cross talk between the ER and AhR has been proposed in various studies. For example, AhR binding of ligands, including dioxins and polyaromatic hydrocarbons, induced degradation of ER protein in MCF-7 cells in a proteasome-dependent manner (39, 40). A recent high-profile study reported that 3-MC binding to AhR led to dissociation of the cytosolic AhR-heat shock protein complex, translocation of the 3-MC-AhR complex to the nucleus, and recruitment of Arnt and unliganded ER, leading to ERE-luciferase induction (27). Because 4-MeOEN has very poor affinity for the isolated ER, an alternate mechanism of action via AhR binding appeared possible, given the structural similarities between 4-MeOEN and AhR ligands, including 3-MC and 3,4-dimethoxyflavone (Fig. 1
) (41, 42). Additionally, because AhR-Arnt exerts transcriptional action via binding to the DNA XRE that mediates expression of proteins involved in xenobiotic catabolism, this would be of relevance to detoxification of estrogen metabolites. However, in XRE luciferase-transfected MCF-7 cells, we observed 4-MeOEN to be a very weak AhR agonist. Moreover, application of siRNA for AhR had no effect on ERE luciferase activity induced by 4-MeOEN or E2, leading to the conclusion that at nanomolar concentrations, binding of 4-MeOEN or E2 to AhR does not influence ERE-dependent gene transcription. These observations on 4-MeOEN pointed to ER-mediated estrogenic activity. Further analysis of estrogenic time course and efficacy, ER degradation, and potential antagonist activity between 4-MeOEN and E2 indicated that 4-MeOEN mirrored the activity of E2, although with reduced potency.
Rapid estrogenic signaling in the brain has been recognized for some time, and there is now increasing interest in membrane-associated ER signal transduction leading to activation of phosphatidylinositol 3-kinase/Akt, protein kinase A, and MAPK/ERK cascades. Although these nonclassical, estrogenic mechanisms are often termed nongenomic, the intervening kinase cascades elicit genomic activity. Comparison of rapid ERK activation in MCF-7 cells treated with 4-MeOEN, 4-BrEN, 4-OHEN, and E2 demonstrated that all agents elevated pERK levels and that ERK activation was blocked by the antiestrogen ICI. Comparison of protein levels in these experiments (Fig. 6
) and comparable experiments with a variety of agents (Bolton, J. L., and G. R. J. Thatcher, unpublished data) showed that concentration dependence and potency toward rapid ER-mediated signaling is not identical with that observed for classical ER-mediated activity. Indeed, in recent work using an E2-conjugate with reduced ER affinity (RBA
3.8%), unable to cross the nuclear membrane, it was reported that the conjugate elevated pERK to twice the level observed for equimolar E2 (43). There is disagreement in the literature regarding the identity of the membrane-associated ER; candidates include new ER isoforms, posttranslationally modified ER LBD, and the G protein-coupled receptor-30 orphan receptor (44, 45), but 4-MeOEN, 4-Br-EN, 4-OHEN, and E2 were all seen to be active at membrane-associated ER.
The ER is a conformationally labile protein subject to posttranslational modification and in a cellular milieu is complexed to proteins including heat shock protein HSP-90, other chaperones, membrane scaffold proteins, and nuclear coregulators (46, 47). It is not unreasonable that affinity (RBA) measured in the isolated ER radioligand binding assay may not mirror ligand binding to ER in this cellular milieu. Computational modeling indicated that modest relaxation of the ER
LBD permitted 4-MeOEN binding without perturbation of helix 12, which causes antiestrogenic actions.
One additional possibility to accommodate the very low affinity of 4-MeOEN for isolated ER
with the observed estrogenicity in cell culture is further metabolism of 4-MeOEN to a more potent estrogen: the only reasonable candidate for such a metabolite is 4-OHEN, which itself showed low affinity in the ER
competitive binding assay. The putative CYP P450 catalyzed demethylation would have to occur to a similar extent in the different cell cultures studied; Ishikawa, MCF-7, and S30 (Fig. 1A
). In tissues abundant in CYP P450 (48) and in vivo (49), 4-MeOE2 can be metabolically demethylated; and the enzyme kinetics for demethylation of 4-MeOE2 by CYP P450 1A1 (Michaelis constant > 30 µM) and 1B1 (Michaelis constant
30 µM) have been reported (23) (Fig. 1B
). It is theoretically possible that in cell culture, CYP P450-mediated demethylation of 4-MeOEN would yield 4-OHEN and that intracellular 4-OHEN would be sufficiently persistent to exert estrogenic activity more potent than observed in the competitive binding assay. To test this alternative hypothesis, the estrogenicity of 4-MeOEN in MCF-7 cells was compared with that of E2 in the presence of two CYP P450 inhibitors; again 4-MeOEN mirrored the behavior of E2. Work is in progress to quantify the cellular metabolites of 4-OHEN and 4-MeOEN, which is complicated by the high reactivity of oxidized 4-OHEN. Nevertheless, the conclusion supported by the weight of data presented herein is that 4-MeOEN is an estrogenic ligand eliciting ER-dependent activity with potency for genomic and nongenomic actions bracketing that of E2 itself.
2-Methoxyestrone, a major endogenous estrogen metabolite, has low ER affinity, lacks estrogenic activity, and is antiproliferative via non-ER-mediated mechanisms in breast cancer cells (35, 50). In contrast, 4-MeOEN, the primary comparable metabolite of the equine estrogens, is shown, for the first time, to be proliferative, eliciting classical and nonclassical ER-dependent mechanisms and gene transcription. Oxidative metabolism of equine estrogens generates the genotoxic catechol, 4-OHEN, the methylation of which to 4-MeOEN does not yield an inactive metabolite but produces a lipophilic, estrogenic compound of nanomolar potency that is proliferative in breast cancer cells. Equine estrogen metabolites may accumulate in long-term HRT and have potential to elicit both chemical and hormonal carcinogenesis.
| Acknowledgments |
|---|
| Footnotes |
|---|
Present address for M.C.: Department of Metabolism and Pharmacokinetics, R&D Park, LG Life Sciences, Munji-dong 104-1, Yuseong-gu, Daejeon, Korea 305-380.
Disclosure Statement: The authors have nothing to disclose.
First Published Online June 21, 2007
Abbreviations: ABT, 1-Aminobenzotriazole; AhR, aryl hydrocarbon receptor; AP, alkaline phosphatase; Arnt, AhR nuclear translocator; 4-BrEN, 4-bromoequilenin; COMT, catechol-O-methyltransferase; DMSO, dimethylsulfoxide; E2, estradiol; EN, equilenin; ER, estrogen receptor; ERE, estrogen response element; h, human; HRT, hormone replacement therapy; ICI, ICI 182,780; LBD, ligand binding domain; 3-MC, 3-methylcholanthrene; 4-MeOEN, 4-methoxyequilenin; 17-4-MeOEN, 17ß-dihydro-4-methoxy-equilenin;
-NF,
-naphthoflavone; 4-OHEN, 4-hydroxyequilenin; RBA, relative binding affinity; si, small interfering; siSC, scrambled inhibitory RNA; XRE, xenobiotic response element.
Received November 27, 2006.
Accepted for publication June 13, 2007.
| References |
|---|
|
|
|---|
. Chem Res Toxicol 15:512–519[CrossRef][Medline]
-Naphthoflavone-induced CYP1A1 gene expression and cytosolic aryl hydrocarbon receptor transformation. Mol Pharmacol 43:200–206[Abstract]
-Naphthoflavone acts as an antagonist of 2,3,7, 8-tetrachlorodibenzo-p-dioxin by forming an inactive complex with the Ah receptor. Mol Pharmacol 40:607–612[Abstract]
and ß subtypes: insights into the structural determinants favoring a differential subtype binding. Endocrinology 147:4132–4150[CrossRef][Medline]
and the aryl hydrocarbon receptor in breast cancer cells involves unidirectional activation of proteasomes. FEBS Lett 478:109–112[CrossRef][Medline]
and ß. Cancer Res 62:3691–3697
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |