help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0448
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fekete, C.
Right arrow Articles by Gereben, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fekete, C.
Right arrow Articles by Gereben, B.
Endocrinology Vol. 148, No. 10 4865-4874
Copyright © 2007 by The Endocrine Society

Expression Patterns of WSB-1 and USP-33 Underlie Cell-Specific Posttranslational Control of Type 2 Deiodinase in the Rat Brain

Csaba Fekete, Beatriz C. G. Freitas, Anikó Zeöld, Gábor Wittmann, Andrea Kádár, Zsolt Liposits, Marcelo A. Christoffolete, Praful Singru, Ronald M. Lechan, Antonio C. Bianco and Balázs Gereben

Laboratory of Endocrine Neurobiology (C.F., A.Z., G.W., A.K., Z.L., B.G.), Institute of Experimental Medicine, Hungarian Academy of Sciences, Budapest H-1083, Hungary; Tupper Research Institute and Department of Medicine (C.F., P.S., R.M.L.), Division of Endocrinology, Diabetes, and Metabolism, Boston, Massachusetts 02111; Thyroid Section (B.C.G.F., M.A.C., A.C.B.), Division of Endocrinology, Diabetes and Hypertension, Brigham and Women’s Hospital, and Harvard Medical School, Boston, Massachusetts 02115; and Department of Neuroscience (Z.L.), Faculty of Information Technology, Pázmány Péter Catholic University, Budapest H-1083, Hungary

Address all correspondence and requests for reprints to: Dr. Balázs Gereben, Institute of Experimental Medicine, Laboratory of Endocrine, Neurobiology, Szigony u. 43, Budapest H-1083 Hungary. E-mail: gereben{at}koki.hu; or Dr. Antonio C. Bianco, Brigham and Women’s Hospital at Harvard Institutes of Medicine, Room 643, 77 Avenue Louis Pasteur, Boston, Massachusetts 02115. E-mail: abianco{at}partners.org.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The type 2 deiodinase (D2) activates thyroid hormone and constitutes an important source of 3,5,3',-triiodothyronine in the brain. D2 is inactivated via WSB-1 mediated ubiquitination but can be rescued from proteasomal degradation by USP-33 mediated deubiquitination. Using an in silico analysis of published array data, we found a significant positive correlation between the relative mRNA expression levels of WSB-1 and USP-33 in a set of 56 mouse tissues (r = 0.08; P < 0.04). Subsequently, we used in situ hybridization combined with immunocytochemistry in rat brain to show that in addition to neurons, WSB-1 and USP-33 are differently expressed in astrocytes and tanycytes, the two main D2 expressing cell types in this tissue. Tanycytes, which are thought to participate in the feedback regulation of TRH neurons express both WSB-1 and USP-33, indicating the potential for D2 ubiquitination and deubiquitination in these cells. Notably, only WSB-1 is expressed in glial fibrillary acidic protein-positive astrocytes throughout the brain. Although developmental and environmental signals are known to regulate the expression of WSB-1 and USP-33 in other tissues, our real-time PCR studies indicate that changes in thyroid status do not affect the expression of these genes in several rat brain regions, whereas in the mediobasal hypothalamus, changes in gene expression were minimal. In conclusion, the correlation between the relative mRNA levels of WSB-1 and USP-33 in numerous tissues that do not express D2 suggests that these ubiquitin-related enzymes share additional substrates besides D2. Furthermore, the data indicate that changes in WSB-1 and USP-33 expression are not part of the brain homeostatic response to hypothyroidism or hyperthyroidism.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
THE MAIN PRODUCT secreted by the thyroid gland is T4, a prohormone that must be converted to T3 via outer ring deiodination to gain full biological activity. Although in most tissues thyroid hormone action is predominantly determined by plasma T3 concentration, the brain expresses deiodinases that can modulate thyroid hormone signaling locally, relatively independent of plasma T4 and T3 levels (1, 2, 3). In fact, Galton et al. (4) recently demonstrated that brain T3 content is substantially reduced in mice with targeted disruption of the type 2 deiodinase (D2) encoding Dio2 gene.

D2 is a thioredoxin fold-containing dimeric selenoenzyme that in the brain is predominantly expressed in two types of glial cells: the tanycytes lining the wall of the third ventricle, and the astrocytes (5, 6, 7). D2 expression and activity are under complex regulation, including transcriptional and posttranscriptional mechanisms. In contrast to the other two deiodinases (D1 and D3), D2 has a short half-life (8) due to substrate-induced ubiquitination and selective proteolysis via the ubiquitin/26S proteasomal pathway (9, 10). Both UBC6 and UBC7 ubiquitin-conjugating (E2) enzymes play a role in D2 ubiquitination (11, 12). The D2-ubiquitinating catalytic core complex has been modeled as Elongin BC-Cul5-Rbx1 (ECSWSB-1), with WSB-1 implicated as a D2-specific E3 ubiquitin ligase adaptor subunit (13). WSB-1 (also known as SWiP-1) is a hedgehog-inducible SOCS-box-containing WD-40 protein (14) that interacts with D2 through a specific instability loop present in D2 (13, 15).

Upon binding of T4, D2 is ubiquitinated, which inactivates the enzyme by interfering with D2’s globular interacting surfaces that are critical for dimerization and catalytic activity (16). Ubiquitinated D2 is catalytically inactive, but it is not immediately taken up by the proteasomes. A pair of D2-binding deubiquitinating enzymes (USP-33 and USP-20; also known as von Hippel-Lindau interacting deubiquitinating enzymes VDU-1 and VDU-2) can reactivate D2 through deubiquitination, rescuing it from proteasomal degradation (17). The continuous association of D2 with this regulatory protein complex supports rapid cycles of deiodination, conjugation to ubiquitin, and enzyme reactivation by deubiquitination, allowing tight control of thyroid hormone action (16).

Although components of the ubiquitinating pathway for endoplasmic reticulum resident proteins are generally ubiquitously expressed, the E3 ubiquitin ligase adaptors, which provide substrate recognition to the catalytic core complex, have more selective expression and, of course, must be coexpressed with the target protein in the same cell (18). To find out more about the expression of WSB-1 and USP-33, we first used data mining and in silico analyses of publicly available data sets of mouse tissues. Second, we used in situ hybridization combined with immunocytochemistry to analyze the expression of WSB-1 and USP-33 in the rat brain, finding that although WSB-1 is coexpressed with D2 in astrocytes and tanycytes, USP-33 coexpression with D2 is limited to tanycytes. This indicates that in the brain, USP-33 mediated reactivation of ubiquitinated D2 is a mechanism limited to the mediobasal hypothalamus (MBH).


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Gene expression data
The data of the relative gene expression of the different genes analyzed were obtained from the Genomics Institute of the Novartis Research Foundation web site (http://symatlas.gnf.org). These data consist of a transcriptional profile from 56 mouse tissues created with Affymetrix GNF1M, a custom microarray (19). For our analysis, embryonic and fetal tissues were excluded, leaving 56 mouse tissues. Samples for microarray hybridization in the SymAtlas were run in duplicate made from a pool of individual tissues. The reporters selected for each gene were: WSB-1 gnf1m26785_s_at; USP-33 gnf1m05997_a_at; USP-20 gnf1m23808_at; Dio2 gnf1m02182_a_at; UBE2J2 (UBC6) gnf1m11337_at; UBE2G2 (UBC7) gnf1m03814_a_at; SKP-1 gnf1m11809_a_at; SKP-2 gnf1m25233_a_at; USP48 gnf1m09416_a_at; UBE1C gnf1m11803_a_at. Only data processed using Affymetrix Microarray Suite (MAS5; Affymetrix, Santa Clara, CA) were analyzed in the present study.

Animals
Experiments were performed on male Wistar rats (TOXI-COOP KFT, Budapest, Hungary and Harlan, Indianapolis, IN) weighing between 200 and 300 g. The animals were housed under standard environmental conditions (light between 0600 and 1800 h, temperature 22 ± 1 C, rat chow and water available ad libitum). Animals were kept and experiments were performed according to protocols approved by the Animal Care and use Committees of the Institute of Experimental Medicine of the Hungarian Academy of Sciences and Harvard Medical School in compliance with National Institutes of Health standards. To generate hypothyroidism, the rats were given 0.1% methimazole and 0.5% sodium perchlorate in drinking water for 13 d. The hyperthyroid group received 10 µg T3/100 g body weight ip for 3 d. Nontreated euthyroid animals of the same age were used as controls. At the end of the experimental period, animals were anesthetized with 50 mg/kg body weight sodium pentobarbital, killed by exsanguination, and rapidly dissected for obtaining different brain tissues, which were frozen in dry ice. Each group consisted of four animals.

Probe generation for in situ hybridization
A 896-bp long rat USP-33 coding region fragment was amplified with Taq polymerase on rat MBH cDNA using the following oligos: sense, GACAAAGCATTATCTAACTGTGA; and antisense, GGCTGTTTAGGTCAACTGTTTCA. The region corresponds to bases 327-1222 of GenBank XM_001080019. The fragment was cloned into pGemT vector (Promega Corp., Madison, WI) and confirmed by sequencing. NcoI digestion followed by transcription with SP6 polymerase was used to generate the antisense cRNA probe in the presence of 35S-UTP, whereas NotI digestion and T7 polymerase was used for the sense probe.

The 808-bp long rat WSB-1 fragment corresponding to bases 152–959 of XM_220736 was amplified on rat MBH cDNA using the oligos as indicated: sense, CGAGGGTCAACGAGAAAGAGAT; and antisense, GACGCAGTAGCTAGTAATGCT. The fragment was cloned into pGemT vector, confirmed by sequencing and transcribed the same way as indicated for USP-33 previously.

Single-label in situ hybridization
The rats were decapitated. The brains were removed quickly from the skull, quickly frozen on dry ice, and stored at –80 C until used. Serial 12-µm thick coronal sections were cut on a cryostat (Leica Microsystems GmbH, Wetzlar, Germany), mounted on Superfrost Plus slides (Fisher, Hampton, NH), and dried at 42 C overnight, as described (20). On the day of hybridization, the sections were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 1 h, washed in 2-fold concentration of standard sodium citrate (2x SSC), acetylated with 0.25% acetic anhydride in 0.9% triethanolamine for 20 min, and then treated in graded solutions of ethanol (70, 80, 96, and 100%), chloroform, and a descending series of ethanol (100 and 96%) for 5 min each, and hybridized with the aforementioned rat WSB-1 or USP-33 single-stranded 35S-UTP labeled cRNA probes. The hybridizations were performed under plastic coverslips in a buffer containing 50% formamide, 2-fold concentration of SSC (2x SSC), 10% dextran sulfate, 0.5% sodium dodecyl sulfate, 250 µg/ml denatured salmon sperm DNA, and the 105-cpm radiolabeled probe for 16 h at 56 C. The slides were washed in 1x SSC for 15 min and then treated with RNase (25 µg/ml) for 1 h at 37 C, followed by additional washes in 0.1x SSC (2 x 30 min) at 65 C. After dehydration in graded dilutions of ethanol, the slides were dipped into Kodak NTB autoradiography emulsion (Eastman Kodak, Rochester, NY), and the autoradiograms were developed after 6-wk exposure at 4 C. The specificity of hybridization was confirmed using sense probes that resulted in the complete absence of hybridization signal in the brain.

Double-labeling in situ hybridization and immunocytochemistry for WSB-1, USP-33, and glial fibrillary acidic protein (GFAP)
Brain sections were prepared and hybridized for WSB-1 and USP-33, respectively, as described previously. After post-hybridization washes, the sections were treated with the mixture of 0.5% Triton X-100 and 0.5% H2O2 for 15 min, and then with 1% BSA in PBS for 20 min to reduce nonspecific antibody binding. The sections were incubated with a mouse monoclonal antibody against GFAP (GA 5; Roche Molecular Biochemicals GmbH, Vienna, Austria) at 1:50 dilution in 1% BSA containing PBS overnight at 4 C. After washes in PBS, the sections were incubated in donkey antimouse IgG (1:500; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) for 2 h and ABC Elite (1:1000; Vector Laboratories, Burlingame, CA) for 1 h. The immunoreactivity was detected with 0.025%, 3,3'-diaminobenzidine containing 0.0036% H2O2 in 0.05 M Tris buffer (pH 7.6). After several washes in PBS, the sections were dehydrated in graded dilutions of ethanol, slides were dipped into Kodak NTB autoradiography emulsion, and autoradiograms were developed after 6-wk exposure at 4 C. A series of sections were then counterstained with 0.1% Fast Green FCF (Sigma-Aldrich, St. Louis, MO) dissolved in 1% acetic acid.

Imaging
Images were captured using a Zeiss Axiophot microscope (Zeiss, Vienna, Austria) equipped with a Real Time Spot Digital Camera (Diagnostic Instruments, Sterling Heights, MI). The single-labeled images were captured under dark-field illumination, whereas bright-field illumination was used to image the double-labeled preparations.

Real-time PCR (qPCR)
Frozen tissues, including cortex, cerebellum, hippocampus, medial basal hypothalamus, and pituitary, were processed for isolation of total RNA using Trizol Reagent from Invitrogen (Carlsbad, CA). After quantification, RNA was fractionated by agarose electrophoresis to ensure integrity. The reverse transcriptase reaction was performed using superscript II (Invitrogen) and oligo-dT. qPCR was performed as described previously by Zavacki et al. (21). Primers used in the real-time PCR for USP-33 were previously described by Curcio-Morelli et al. (17), and the D2 and WSB-1 are the same as in the study by Dentice et al. (13). All values for the qPCR were normalized using cyclophilin A mRNA as an internal control.

Statistical analysis
Multiple groups were compared using one-way ANOVA, followed by a Newman-Keuls post hoc test (Prism 4; GraphPad Software, San Diego, CA). In silico correlation analysis was performed by linear regression, whereas data obtained in T{alpha} T1 cells were analyzed by t test (Prism 4).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tissue distribution of WSB-1 and USP-33
The expression of WSB-1 and USP-33 genes in mouse tissues was analyzed in silico using data previously published (19) and available through the SymAtlas web site (http://symatlas.gnf.org/SymAtlas/). Both genes are expressed in all tissues analyzed, and there is a general tendency for USP-33 to have higher expression levels in the central nervous system (CNS) when compared with all other tissues (Fig. 1Go). WSB-1 is also highly expressed in the CNS, which is compatible with the fact that both USP-33 and WSB-1 were identified as a D2-interacting protein in a yeast two-hybrid screening of a human brain library (13, 17). Although WSB-1 is highly expressed in the preoptic area, hypothalamus, lower spinal cord, umbilical cord, large intestine, B cells, and thymus, USP-33 is found predominantly in the amygdala, frontal cortex, nucleus trigeminus, cerebral cortex, hypothalamus, lower and upper spinal cord, substantia nigra, prostate, and eye (Fig. 1Go).


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 1. Relative mRNA expression levels of WSB-1, USP-33, and Dio2 genes in mouse tissues.

 
It is notable the tendency for coexpression between WSB-1 and USP-33, particularly in the CNS. At the same time, no clear overall relationship with D2 expression is observed (Fig. 1Go). Performing correlation analyses between the respective relative mRNA levels revealed a positive relationship between WSB-1 and USP-33 relative expression. The overall correlation is weak but reached the statistical significance level (r = 0.08; P < 0.04; Table 1Go). When only CNS regions were analyzed, the correlation became much stronger, reaching 0.35 (P = 0.05). To test how specific the WSB-1 and USP-33 relationship is, we also looked at the gene expression of other ubiquitin-related proteins and their correlation with WSB-1 and USP-33, i.e. the ubiquitin-activating enzyme UBE–1 C, two ubiquitin conjugates UBC-6 and UBC-7, two deubiquitinases USP-20 and USP-48, and two ubiquitin ligases SKP-1 and SKP-2. Although no significant correlations were observed between the relative expression of WSB-1 or USP-33 gene expressions with that of the ubiquitin-activating and conjugating enzymes, there was a positive correlation between WSB-1 and that of USP-20 and USP-48. The relative expression of USP-33 also correlated significantly with that of SKP-1 (Table 1Go).


View this table:
[in this window]
[in a new window]

 
TABLE 1. Correlation analyses of the relative expression levels of Dio2, WSB-1, USP-33, and other ubiquitin-related genes in 56 mouse tissues

 
D2 expression is also predominant in the CNS (Fig. 1Go) (22). However, no significant correlation was identified between relative D2 mRNA levels and those of WSB-1 or USP-33 (Table 1Go).

Distribution of the WSB-1 and USP-33 mRNA in the rat brain
Given the predominant distribution of D2 and USP-33 in the CNS and the fact that the expression of both genes is positively correlated, we used in situ hybridization to assess the distribution of mRNA corresponding to both genes in the rat brain. WSB-1 mRNA was widely expressed in all regions of the rat brain, including the hypothalamus (Fig. 2Go and see Fig. 4Go, C–G) cortex (Fig. 2Go and see Fig. 4BGo), hippocampus (Fig. 2Go and see Fig. 4AGo), and cerebellum (Fig. 2Go and see Fig. 4HGo). WSB-1 is expressed in both neurons, including the pyramidal cells of the cortex (see Fig. 6BGo) and the CA1 region of the hippocampus (see Fig. 6DGo), as well as in GFAP-positive astrocytes (see Fig. 6CGo). In addition to these two cell types, WSB-1 mRNA was also detected in ependymal cells lining the wall of the third ventricle between the rostral pole of the median eminence and the mammillary recess. In the ependyma, the signal was localized to the floor of the third ventricle at the rostral pole of the median eminence, whereas more caudally, WSB-1 expressing cells covered the ventral half to two thirds of the ventricular wall (see Fig. 4GoC–G). The distribution of WSB-1 expressing ependymal cells was reminiscent of the distribution of third ventricular tanycytes. WSB-1 expression was not detected in other regions of the third ventricular wall.


Figure 2
View larger version (160K):
[in this window]
[in a new window]

 
FIG. 2. A–C and E–I, A series of low-power images illustrates the distribution of WSB-1 mRNA at eight rostrocaudal levels of the forebrain. J, Distribution of the WSB-1 mRNA in the cerebellum. D, No hybridization signal was detected using a sense WSB-1 probe. Scale bar, 2000 µm.

 

Figure 4
View larger version (201K):
[in this window]
[in a new window]

 
FIG. 4. Medium-power magnification images of WSB-1 mRNA distribution in the hippocampus (A), cerebral cortex (B), ependymal cells lining the wall of the third ventricle (3V) (C–G), and in the cerebellum (H). A very dense hybridization signal is observed in the hippocampus (A) over the pyramidal layer (CA1–CA3) and the granular layer of the dentate gyrus (GrDG). Many labeled cells were also observed in the oriens layer (Or), stratum radiatum (Rad), and lacunosum molecular layer of the hippocampus (LMol), and in the polymorph layer of the dentate gyrus (PoDG). A dense WSB-1 hybridization signal was observed in the two to five layers of the cortex (B). Scattered WSB-1 expressing cells were also observed in the first layer of cortex (arrow). All regions of the hypothalamus were densely labeled with a WSB-1 hybridization signal (C–G). A WSB-1 hybridization signal was also detected over ependymal cells lining the floor and wall of the third ventricle (arrows) (C–G). WSB-1 expressing ependymal cells were localized to the lower part of the ependymal lining at the level of the retrochiasmatic area (arrows) (C), and extended to the lower two thirds of the wall of the third ventricle in more caudal regions (arrows) (D–F), whereas the hybridization signal was absent from the roof of the mamillary recess (MR) (G). A very dense hybridization signal was observed over the granular layer of the cerebellum (GR) (H). In the white matter (WM), only scattered cells were labeled, and the hybridization signal was relatively low in the molecular layer. Scale bar on B, 500 µm, corresponding to A, B, and H. Scale bar on G, 200 µm, corresponding to C–G. CMol, Molecular layer of cerebellum; Mol, molecular layer of gyrus dentatus.

 

Figure 6
View larger version (165K):
[in this window]
[in a new window]

 
FIG. 6. Cell-type specificity of WSB-1 and USP-33 expression in the brain. A WSB-1 hybridization signal is observed over the majority of cortical GFAP positive astrocytes (brown) as well as many GFAP-negative cells (A). Medium-power magnification image illustrates a WSB-1 expressing GFAP-positive astrocyte and several WSB-1 expressing neurons labeled with Fast Green FCF in the third layer of the cortex (B). The majority of astrocytes express WSB-1 in the oriens (Or), pyramidal layers, and stratum radiatum (Rad) of the hippocampus (C) (arrows). Medium-power micrograph shows a WSB-1 mRNA-containing GFAP-positive astrocyte and WSB-1 positive pyramidal cells in the CA1 region of the hippocampus (D). A WSB-1 hybridization signal is observed over the majority of astrocytes in the arcuate nucleus (E), cerebellum (F), and in the polymorph and molecular layers of the dentate gyrus (Mol) (arrows) (G). Non-GFAP positive cells also express WSB-1 in these regions. Low-power images illustrate that the USP-33 hybridization signal is absent from the majority of GFAP-positive astrocytes in the cortex (H), hippocampus (J), arcuate nucleus (L), and cerebellum (M), and dentate gyrus (N), but the USP-33 hybridization signal is observed over numerous non-GFAP positive cells. Medium-power images illustrate the absence of a USP-33 hybridization signal in GFAP-positive astrocytes (brown), and USP-33 expression in neurons of the third layer of cortex (I) (green cells) and pyramidal cells of the CA1 region of the hippocampus (K) (green cells). Scale bar on K, 25 µm, corresponding to B, D, I, and K. Scale bar on N, 50 µm, corresponding to A, C, E–H, J, and L–N. GR, Granular layer of cerebellum; GrDG, granular layer of the dentate gyrus; MR, mamillary recess; PoDG, polymorph layer of the dentate gyrus; WM, white matter.

 
USP-33 mRNA was also widely expressed in all brain regions studied (Fig. 3Go and see Fig. 5Go). Although similar to WSB-1, the USP-33 hybridization signal was observed over the vast majority of the fast green FCF-stained neurons (see Fig. 6Go, I and K); only scattered GFAP-immunoreactive astrocytes were labeled with the USP-33 hybridization signal. The USP-33 hybridization signal was also detected in ependymal cells lining the wall of the lateral and third ventricles, including the regions where tanycytes line the wall of the third ventricle (see Fig. 5Go, C and D).


Figure 3
View larger version (158K):
[in this window]
[in a new window]

 
FIG. 3. A, B, and D–H, A series of low-power images illustrates the distribution of USP-33 mRNA at seven rostrocaudal levels of the forebrain. I, Distribution of the USP-33 mRNA in the cerebellum. C, No hybridization signal was detected using a sense USP-33 probe. Scale bar, 2000 µm.

 

Figure 5
View larger version (201K):
[in this window]
[in a new window]

 
FIG. 5. Medium-power magnification images of USP-33 mRNA distribution in the hippocampus (A), cortex (B), ependymal cells lining the wall of the third ventricle (3V) (C and D), and in the cerebellum (E). A very dense hybridization signal is observed in the hippocampus (A) over the pyramidal layer (CA1–CA3) and the granular layer of the dentate gyrus (GrDG). Only rare cells were labeled in the oriens layer (Or), stratum radiatum (Rad), and lacunosum molecular layer of the hippocampus (LMol), and in the polymorph layer of the dentate gyrus (PoDG). A dense USP-33 hybridization signal was observed in the two to five layers of the cortex (B), whereas a hybridization signal was absent from the first layer of cortex (arrow). All regions of the hypothalamus were labeled densely with a USP-33 hybridization signal (C and D). A USP-33 hybridization signal was also detected over ependymal cells lining all regions of the wall of the third ventricle (arrows) (C and D). A very dense hybridization signal was observed over the granular layer of the cerebellum (GR) (E). A moderate density hybridization signal was observed over the molecular layer of the cerebellum (CMol) (E). No hybridization signal was observed over the white matter (WM) (E). Scale bar on B, 500 µm, corresponding to A, B, and E. Scale bar on D, 200 µm, corresponding to C and D. Mol, Molecular layer of gyrus dentatus; MR, mamillary recess.

 
Expression of WSB-1 and USP-33 during hypothyroidism and hyperthyroidism
WSB-1 and USP-33 mRNA levels were measured by qPCR in specific brain regions of rats made systemically hypothyroid or hyperthyroid. WSB-1 mRNA levels were not significantly affected by changes in thyroid status in all brain regions studied, except for the MBH (Table 2Go). In this area, WSB-1 mRNA levels were decreased both in hypothyroid and hyperthyroid rats, but changes were restricted to a maximum of 50%. On the other hand, there was a general tendency for the USP-33 mRNA levels to be reduced in the brain of hypothyroid rats, and statistical significance was achieved in the pituitary gland, in which the reduction reached approximately 30% (Table 2Go). As a reference, D2 mRNA levels were also measured in this set of experiments, and, given that D2 regulation is mostly posttranscriptional, its mRNA levels were only slightly affected by both conditions (22, 23, 24). The pituitary gland was the only tissue in which changes in D2 mRNA levels reached statistical significance, with an approximately 3-fold increase in hypothyroid rats (Table 2Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2. Effects of hypothyroidism and hyperthyroidism on the expression WSB-, USP-33, and D2 in the cortex, cerebellum, hippocampus, MBH, and pituitary

 
A possible regulation of WSB-1 and USP-33 expression by thyroid hormone was also tested in T{alpha} T1 cells, a thyrotropic cell line that expresses D2 and is known to be responsive to T3 by decreasing TSHß mRNA levels (25). However, whereas exposing these cells to stripped serum-containing media almost doubled D2 activity, no changes in WSB-1 or USP-33 mRNA levels were detected (see Fig. 7Go).


Figure 7
View larger version (9K):
[in this window]
[in a new window]

 
FIG. 7. Effect of hypothyroidism on WSB1, USP-33, and D2 expression in T{alpha}T1 cells. Cells were grown to confluence, as previously described (25 ), and incubated in media containing 10% charcoal-stripped serum for 18 h. Control cells were incubated in normal media. Cells were then harvested and processed for D2 activity or mRNA levels of the indicated genes. Values are the mean ± SD of three to four cell plates. *, P < 0.01 by t test (n = 3).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The present studies found in a large data set of murine tissues a positive correlation between the relative expression of the genes encoding two critical components of the D2-related ubiquitination machinery, WSB-1 and USP-33 (Fig. 1Go and Table 1Go). We are certainly aware of the limitations imposed by measuring specific mRNA and not protein levels. However, in the present study, this is offset by the gain of studying large data sets otherwise unavailable for protein levels. The lack of correlation between the relative expression level of these two genes and that of other genes that are general components of the ubiquitination machinery, i.e. UBE–1 C, UBC-6, and UBC-7 (Table 1Go), suggests a high degree of specificity in this finding, and a possible functional linkage between WSB-1 and USP-33. Although Dio2 mRNA levels did not correlate with WSB-1 or USP-33 relative expression levels, the mRNA signal of both genes were found in D2-expressing cells of the adult rat brain. WSB-1, which inactivates D2 through conjugation to ubiquitin, is expressed in tanycytes and astrocytes, the two major D2 expressing cell types in the brain. At the same time, USP-33 is only coexpressed with D2 in the tanycytes, indicating that in the CNS, there are alternative pathways regulating D2-mediated T3 production.

Given that WSB-1 and USP-33 have opposite roles in the conjugation of ubiquitin to proteins, the finding of a positive correlation between the basal relative expressions of both genes is fascinating. One could speculate that by keeping a balance between the expressions of both genes constitutes a limiting mechanism to how much WSB-1 ubiquitinated substrates are effectively taken up by the proteasomes. This is clearly the case with ubiquitinated D2, which can be rescued from proteasomal destruction by USP-33. Notably, despite significant correlation in their relative basal expression levels (Table 1Go), both WSB-1 and USP-33 do have specific regulation independent from each other. For example, WSB-1, but not USP-33, is downstream of the hedgehog pathway in different cell types, whereas only USP-33, but not WSB-1, is induced by cold stimulation in brown adipocytes (13, 14, 17) (Dentice, M., and A.C.B., unpublished data). Revealing more upstream regulators of WSB-1 and/or USP-33 would shed light on key players in fine-tuning the balance between D2 ubiquitination and reactivation.

The finding that D2 is coexpressed with WSB-1 and USP-33 in tanycytes (Figs. 4Go and 5Go) is not unexpected, and indicates that the cycle of D2 ubiquitination-deubiquitination takes place in tanycytes as well. Such assumption is based on what has been previously characterized in other cells and tissues. WSB-1 and USP-33 are expressed in brown adipocytes, and deubiquitination has been suggested to play a role in acute D2 activation of brown fat during cold exposure (17, 19). In the case of the chicken developing growth plate, WSB-1 mediated D2 ubiquitination increases parathyroid hormone-related peptide expression and, thus, promotes chondrocyte proliferation (13). USP-33 is also expressed in the perichondrial cells, in which D2 and WSB-1 are also coexpressed, indicating that D2 deubiquitination also plays a role in this location. Furthermore, D2 plays a critical role in TSH feedback regulation, and a murine thyrotrophic cell line was shown to coexpress D2, WSB-1, and USP-33 (25). Of note, the coexpression of sonic hedgehog (Shh) signaling components (Shh, Ptc, and Smo) in the median eminence and in the ventrolateral wall of the third ventricle (26, 27), the exact location of the D2 expressing tanycytes, suggests that local Shh signaling might regulate T3 production in tanycytes.

Given that WSB-1 and USP-33 are coexpressed in all the other D2-expressing cells studied to date, the finding that USP-33 is not coexpressed with WSB-1 and D2 in astrocytes is unexpected (Fig. 6Go). The scattered expression of USP-33 in astrocytes indicates that D2 deubiquitination is not an active pathway in these cells. This of course is based on the assumption that no other D2-deubiquitinating activity exists in these cells. In this regard, the expression of USP-20 in the brain as well as in isolated astrocytes is well below the median (19) and, thus, would be predicted to result in a shorter D2 half-life when compared with USP-33 containing cells. In fact, D2’s reported half-life in astrocytes is the lowest reported to date, approximately 20 min in the presence of fetal bovine serum-containing media (28).

WSB-1 is induced by the hedgehog-signaling pathway, and it is notable that WSB-1 is coexpressed with D2 in brain areas influenced by Shh. In these areas, Shh acts as a mitogen on precursor cells, regulating the fate of neural stem cells (29) in areas such as the spinal cord and hippocampus (29, 30, 31). Based on the studies performed in the developing tibia growth plate of chickens, it is likely that the Shh-induced WSB-1 would accelerate D2 ubiquitination and decrease T3 production. This microenvironment of relative hypothyroidism would certainly favor the pro-proliferation effects of Shh to an extent that remains to be determined.

The high-expression levels of WSB-1 in cerebellar astrocytes (Fig. 6FGo) is notable because the cerebellum is a known target of Shh in the adult brain and expresses D2 in the granular layer (6). In the cerebellum, Shh is secreted by Purkinje cells, preventing differentiation and inducing a potent, long-lasting proliferative response of granule cell precursors (32), the most abundant type of neuron in the brain. Shh also regulates proliferation of CNS precursor cells in the hippocampus (29), and D2 is expressed in the molecular layer astrocytes (6), which we also found to express WSB-1.

The expression levels of WSB-1 and USP-33 were largely unaffected by changes in thyroid status (Table 2Go). In the pituitary gland, there was a significant decrease in USP-33 mRNA levels during hypothyroidism, but the significance of this change to TSH regulation is questionable, given that similar findings were not observed in T{alpha} T1 cells (Fig. 7Go). In addition, limited changes in WSB-1 mRNA levels were also observed in the MBH of hypothyroid and hyperthyroid rats (Table 2Go), which are hard to interpret from a thyroid perspective alone. Perhaps this could be related to the existence of additional substrates for the WSB-1 USP-33 pair. In fact, the observation that WSB-1 and USP-33 are expressed in a large number of tissues, the majority of which do not express D2, strongly suggests that WSB-1 and USP-33 have additional substrates. Alternatively, one could speculate that our finding of WSB-1 and USP-33 expression in neurons is reminiscent of D2 expression in neural progenitor cells, which decreases during progenitor differentiation (33). Further studies will determine the identity of these additional substrates, and whether such proteins are shared by WSB-1 and USP-33, such as in the case of D2.


    Acknowledgments
 
We thank Mrs. V. Hársfalvi for her technical help.


    Footnotes
 
This work was supported by Hungarian Scientific Research Fund Grants OTKA T049081 (to B.G.), T046492 (to C.F.), the National Institutes of Health Grants TW006467, DK58538, and DK37021, and the NKFP 004/2004 (to Z.L.). B.C.G.F. is a recipient of a Fundacao de Amparo a Pesquisa do Estado de Sao Paulo scholarship.

Disclosure Statement: The authors have nothing to disclose.

First Published Online July 12, 2007

Abbreviations: CNS, Central nervous system; D2, type 2 deiodinase; GFAP, glial fibrillary acidic protein; MBH, mediobasal hypothalamus; qPCR, real-time PCR; Shh, sonic hedgehog; SSC, standard sodium citrate.

Received April 5, 2007.

Accepted for publication June 29, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Crantz FR, Silva JE, Larsen PR 1982 Analysis of the sources and quantity of 3,5,3'-triiodothyronine specifically bound to nuclear receptors in rat cerebral cortex and cerebellum. Endocrinology 110:367–375[Abstract/Free Full Text]
  2. Kakucska I, Rand W, Lechan RM 1992 Thyrotropin-releasing hormone gene expression in the hypothalamic paraventricular nucleus is dependent upon feedback regulation by both triiodothyronine and thyroxine. Endocrinology 130:2845–2850[Abstract/Free Full Text]
  3. Escobar-Morreale HF, Obregon MJ, Escobar del Rey F, Morreale de Escobar G 1995 Replacement therapy for hypothyroidism with thyroxine alone does not ensure euthyroidism in all tissues, as studied in thyroidectomized rats. J Clin Invest 96:2828–2838[Medline]
  4. Galton VA, Wood ET, St Germain EA, Withrow CA, Aldrich G, St Germain GM, Clark AS, St Germain DL 2007 Thyroid hormone homeostasis and action in the type 2 deiodinase-deficient rodent brain during development. Endocrinology 148:3080–3088[Abstract/Free Full Text]
  5. Tu HM, Kim SW, Salvatore D, Bartha T, Legradi G, Larsen PR, Lechan RM 1997 Regional distribution of type 2 thyroxine deiodinase messenger ribonucleic acid in rat hypothalamus and pituitary and its regulation by thyroid hormone. Endocrinology 138:3359–3368[Abstract/Free Full Text]
  6. Guadano-Ferraz A, Obregon MJ, St Germain DL, Bernal J 1997 The type 2 iodothyronine deiodinase is expressed primarily in glial cells in the neonatal rat brain. Proc Natl Acad Sci USA 94:10391–10396[Abstract/Free Full Text]
  7. Bianco AC, Salvatore D, Gereben B, Berry MJ, Larsen PR 2002 Biochemistry, cellular and molecular biology and physiological roles of the iodothyronine selenodeiodinases. Endocr Rev 23:38–89[Abstract/Free Full Text]
  8. St Germain DL 1988 The effects and interactions of substrates, inhibitors, and the cellular thiol-disulfide balance on the regulation of type II iodothyronine 5'-deiodinase. Endocrinology 122:1860–1868[Abstract/Free Full Text]
  9. Steinsapir J, Harney J, Larsen PR 1998 Type 2 iodothyronine deiodinase in rat pituitary tumor cells is inactivated in proteasomes. J Clin Invest 102:1895–1899[Medline]
  10. Gereben B, Goncalves C, Harney JW, Larsen PR, Bianco AC 2000 Selective proteolysis of human type 2 deiodinase: a novel ubiquitin- proteasomal mediated mechanism for regulation of hormone activation. Mol Endocrinol 14:1697–1708[Abstract/Free Full Text]
  11. Botero D, Gereben B, Goncalves C, De Jesus LA, Harney JW, Bianco AC 2002 Ubc6p and ubc7p are required for normal and substrate-induced endoplasmic reticulum-associated degradation of the human selenoprotein type 2 iodothyronine monodeiodinase. Mol Endocrinol 16:1999–2007[Abstract/Free Full Text]
  12. Kim BW, Zavacki AM, Curcio-Morelli C, Dentice M, Harney JW, Larsen PR, Bianco AC 2003 Endoplasmic reticulum-associated degradation of the human type 2 iodothyronine deiodinase (D2) is mediated via an association between mammalian UBC7 and the carboxyl region of D2. Mol Endocrinol 17:2603–2612[Abstract/Free Full Text]
  13. Dentice M, Bandyopadhyay A, Gereben B, Callebaut I, Christoffolete MA, Kim BW, Nissim S, Mornon JP, Zavacki AM, Zeold A, Capelo LP, Curcio-Morelli C, Ribeiro R, Harney JW, Tabin CJ, Bianco AC 2005 The Hedgehog-inducible ubiquitin ligase subunit WSB-1 modulates thyroid hormone activation and PTHrP secretion in the developing growth plate. Nat Cell Biol 7:698–705[CrossRef][Medline]
  14. Vasiliauskas D, Hancock S, Stern CD 1999 SWiP-1: novel SOCS box containing WD-protein regulated by signalling centres and by Shh during development. Mech Dev 82:79–94[CrossRef][Medline]
  15. Zeold A, Pormuller L, Dentice M, Harney JW, Curcio-Morelli C, Tente SM, Bianco AC, Gereben B 2006 Metabolic instability of type 2 deiodinase is transferable to stable proteins independently of subcellular localization. J Biol Chem 281:31538–31543[Abstract/Free Full Text]
  16. Vivek Sagar GD, Gereben B, Callebaut I, Mornon JP, Zeold A, da Silva WS, Luongo C, Dentice M, Tente SM, Freitas BC, Harney JW, Zavacki AM, Bianco AC 2007 Ubiquitination-induced conformational change within the deiodinase dimer is a switch regulating enzyme activity. Mol Cell Biol 27:4774–4783[Abstract/Free Full Text]
  17. Curcio-Morelli C, Zavacki AM, Christofollete M, Gereben B, de Freitas BC, Harney JW, Li Z, Wu G, Bianco AC 2003 Deubiquitination of type 2 iodothyronine deiodinase by von Hippel-Lindau protein-interacting deubiquitinating enzymes regulates thyroid hormone activation. J Clin Invest 112:189–196[CrossRef][Medline]
  18. Pines J, Lindon C 2005 Proteolysis: anytime, any place, anywhere? Nat Cell Biol 7:731–735[CrossRef][Medline]
  19. Su AI, Wiltshire T, Batalov S, Lapp H, Ching KA, Block D, Zhang J, Soden R, Hayakawa M, Kreiman G, Cooke MP, Walker JR, Hogenesch JB 2004 A gene atlas of the mouse and human protein-encoding transcriptomes. Proc Natl Acad Sci USA 101:6062–6067[Abstract/Free Full Text]
  20. Hrabovszky E, Petersen SL 2002 Increased concentrations of radioisotopically-labeled complementary ribonucleic acid probe, dextran sulfate, and dithiothreitol in the hybridization buffer can improve results of in situ hybridization histochemistry. J Histochem Cytochem 50:1389–1400[Abstract/Free Full Text]
  21. Zavacki AM, Ying H, Christoffolete MA, Aerts G, So E, Harney JW, Cheng SY, Larsen PR, Bianco AC 2005 Type 1 iodothyronine deiodinase is a sensitive marker of peripheral thyroid status in the mouse. Endocrinology 146:1568–1575[Abstract/Free Full Text]
  22. Croteau W, Davey JC, Galton VA, St Germain DL 1996 Cloning of the mammalian type II iodothyronine deiodinase. A selenoprotein differentially expressed and regulated in human and rat brain and other tissues. J Clin Invest 98:405–417[Medline]
  23. Burmeister LA, Pachucki J, St Germain DL 1997 Thyroid hormones inhibit type 2 iodothyronine deiodinase in the rat cerebral cortex by both pre- and posttranslational mechanisms. Endocrinology 138:5231–5237[Abstract/Free Full Text]
  24. Kim SW, Harney JW, Larsen PR 1998 Studies of the hormonal regulation of type 2 5'-iodothyronine deiodinase messenger ribonucleic acid in pituitary tumor cells using semiquantitative reverse transcription-polymerase chain reaction. Endocrinology 139:4895–4905[Abstract/Free Full Text]
  25. Christoffolete MA, Ribeiro R, Singru P, Fekete C, da Silva WS, Gordon DF, Huang SA, Crescenzi A, Harney JW, Ridgway EC, Larsen PR, Lechan RM, Bianco AC 2006 Atypical expression of type 2 iodothyronine deiodinase in thyrotrophs explains the thyroxine-mediated pituitary thyrotropin feedback mechanism. Endocrinology 147:1735–1743[Abstract/Free Full Text]
  26. Traiffort E, Charytoniuk D, Watroba L, Faure H, Sales N, Ruat M 1999 Discrete localizations of hedgehog signalling components in the developing and adult rat nervous system. Eur J Neurosci 11:3199–3214[CrossRef][Medline]
  27. Traiffort E, Charytoniuk DA, Faure H, Ruat M 1998 Regional distribution of Sonic Hedgehog, patched, and smoothened mRNA in the adult rat brain. J Neurochem 70:1327–1330[Medline]
  28. Leonard JL, Siegrist-Kaiser CA, Zuckerman CJ 1990 Regulation of type II iodothyronine 5'-deiodinase by thyroid hormone. Inhibition of actin polymerization blocks enzyme inactivation in cAMP-stimulated glial cells. J Biol Chem 265:940–946[Abstract/Free Full Text]
  29. Lai K, Kaspar BK, Gage FH, Schaffer DV 2003 Sonic hedgehog regulates adult neural progenitor proliferation in vitro and in vivo. Nat Neurosci 6:21–27[CrossRef][Medline]
  30. Rowitch DH, S-Jacques B, Lee SM, Flax JD, Snyder EY, McMahon AP 1999 Sonic hedgehog regulates proliferation and inhibits differentiation of CNS precursor cells. J Neurosci 19:8954–8965[Abstract/Free Full Text]
  31. Kalyani AJ, Piper D, Mujtaba T, Lucero MT, Rao MS 1998 Spinal cord neuronal precursors generate multiple neuronal phenotypes in culture. J Neurosci 18:7856–7868[Abstract/Free Full Text]
  32. Wechsler-Reya RJ, Scott MP 1999 Control of neuronal precursor proliferation in the cerebellum by Sonic Hedgehog. Neuron 22:103–114[CrossRef][Medline]
  33. Gurok U, Steinhoff C, Lipkowitz B, Ropers HH, Scharff C, Nuber UA 2004 Gene expression changes in the course of neural progenitor cell differentiation. J Neurosci 24:5982–6002[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
A. M. Zavacki, R. Arrojo e Drigo, B. C. G. Freitas, M. Chung, J. W. Harney, P. Egri, G. Wittmann, C. Fekete, B. Gereben, and A. C. Bianco
The E3 Ubiquitin Ligase TEB4 Mediates Degradation of Type 2 Iodothyronine Deiodinase
Mol. Cell. Biol., October 1, 2009; 29(19): 5339 - 5347.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. Sanchez, M. A. Vargas, P. S. Singru, I. Pascual, F. Romero, C. Fekete, J.-L. Charli, and R. M. Lechan
Tanycyte Pyroglutamyl Peptidase II Contributes to Regulation of the Hypothalamic-Pituitary-Thyroid Axis through Glial-Axonal Associations in the Median Eminence
Endocrinology, May 1, 2009; 150(5): 2283 - 2291.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
B. Gereben, A. M. Zavacki, S. Ribich, B. W. Kim, S. A. Huang, W. S. Simonides, A. Zeold, and A. C. Bianco
Cellular and Molecular Basis of Deiodinase-Regulated Thyroid Hormone Signaling
Endocr. Rev., December 1, 2008; 29(7): 898 - 938.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, Y. Zhou, U. Schweizer, N. E. Savaskan, D. Hua, J. Kipnis, D. L. Hatfield, and V. N. Gladyshev
Comparative Analysis of Selenocysteine Machinery and Selenoproteome Gene Expression in Mouse Brain Identifies Neurons as Key Functional Sites of Selenium in Mammals
J. Biol. Chem., January 25, 2008; 283(4): 2427 - 2438.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fekete, C.
Right arrow Articles by Gereben, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fekete, C.
Right arrow Articles by Gereben, B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals