help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0267
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Valrance, M. E.
Right arrow Articles by Welsh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Valrance, M. E.
Right arrow Articles by Welsh, J.
Endocrinology Vol. 148, No. 10 4887-4894
Copyright © 2007 by The Endocrine Society

Vitamin D Receptor-Dependent Inhibition of Mammary Tumor Growth by EB1089 and Ultraviolet Radiation in Vivo

Meggan E. Valrance, Andrea H. Brunet and JoEllen Welsh

Department of Biological Sciences (M.E.V., J.W.), University of Notre Dame, Notre Dame, Indiana 46556; and Department of Biochemistry (A.H.B.), Queen’s University, Kingston, Ontario, Canada K7L 3N6

Address all correspondence and requests for reprints to: JoEllen Welsh, Department of Biological Sciences, University of Notre Dame, 214 Galvin Life Sciences Building, Notre Dame, Indiana 46556. E-mail: jwelsh3{at}nd.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1,25-Dihydroxyvitamin D3 (1,25D), the biologically active form of vitamin D3, exerts antiproliferative and proapoptotic effects in multiple transformed cell types, and thus, the vitamin D signaling pathway represents a potential anticancer target. Although chronic treatment with 1,25D induces hypercalcemia, synthetic vitamin D analogs have been developed that inhibit tumor growth in vivo with minimal elevation of serum calcium. Furthermore, vitamin D is synthesized in skin exposed to UV light, and this route of vitamin D elevation is not associated with hypercalcemia. In this study, we examined whether enhancement of vitamin D status via exogenous (EB1089, a 1,25D analog) or endogenous (UV exposure) approaches could exert antitumor effects without hypercalcemia. We used mammary xenografts with differential vitamin D receptor (VDR) expression to examine whether the antitumor effects of either therapy are receptor mediated. We present evidence that both EB1089 and UV exposure inhibit tumor growth via induction of growth arrest and apoptosis. These antitumor effects were observed only in xenografts containing VDR-positive tumor cells; heterogeneous tumors containing VDR-negative tumor cells and VDR-positive stromal and endothelial cells were unresponsive to both therapies. No evidence for antiangiogenic effects of EB1089 were detected in this model system. Neither EB1089 nor UV was associated with overt toxicity, but keratinocyte proliferation was increased in UV-exposed skin. These data provide proof of principle that UV exposure modulates tumor growth via elevation of vitamin D signaling and that therapeutic approaches designed to target the vitamin D pathway will be effective only if tumor cells express functional VDR.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
1{alpha},25-DIHYDROXYVITAMIN D (1,25D) IS the biologically active form of vitamin D3 (cholecalciferol), a steroid that can be obtained in the diet or through endogenous synthesis in skin exposed to UV light. The metabolism and biological effects of dietary and UV-generated vitamin D are indistinguishable. For biological activity, vitamin D is sequentially hydroxylated to 25-hydroxyvitamin D (25D, the major circulating form) and 1,25D (the biologically active form). 1,25D is the ligand for the vitamin D receptor (VDR), a transcription factor that regulates tissue-specific gene expression and also exerts nonreceptor mediated effects on intracellular calcium and signaling pathways (1). In vitro, 1,25D induces growth arrest, differentiation, and apoptosis in transformed cell lines derived from breast, prostate, colon, and other tissues (2), and these effects are mediated by VDR (3, 4, 5). The VDR is expressed in 80% of human breast cancers, and tumor VDR has been correlated with prognosis (6, 7, 8).

Despite the beneficial growth inhibitory effects of 1,25D in vitro, its use in cancer therapy is precluded by its potent calcemic effects. However, synthetic vitamin D analogs that display enhanced anticancer activity with reduced calcemic activity have been developed for potential therapeutic applications (9). Although the growth-inhibitory effects of these vitamin D analogs in vitro are VDR mediated (10), the mechanism of the dissociation between their antiproliferative and calcemic effects in vivo is still unclear. EB1089 (seocalcitol) is a well-characterized vitamin D analog, which is more potent than 1,25D in regulating growth and differentiation but 50% less calcemic than 1,25D (11). The efficacy of vitamin D analogs to induce growth arrest, activate apoptosis, inhibit angiogenesis, and mediate tumor regression in animal models of cancer with minimal calcemic toxicity has been documented (5, 12, 13, 14). However, previous studies have not addressed the relative contributions of genomic and nongenomic vitamin D signaling or identified the specific cellular targets of vitamin D signaling in vivo.

More recently evidence has also accumulated to support a role for vitamin D in breast cancer prevention. Studies in knockout mice have demonstrated that the VDR impacts on normal mammary gland development and tumorigenesis (15, 16, 17, 18). Epidemiological studies have demonstrated that breast cancer incidence and mortality inversely correlate with incident UV radiation and occupational or recreational sun exposure (19, 20). It has been proposed that these correlations might reflect the ability of UV rays present in sunlight to stimulate conversion of 7-dehydrocholesterol to vitamin D in skin. Exposure of human skin to suberythemal (nonreddening) doses of UV rapidly generates in excess of 20,000 U of vitamin D, an amount much higher than can be obtained from the diet and approximately 100 times the established adequate intake for adults of 200 U/d (21). It is well accepted that UV stimulation of vitamin D synthesis can both prevent and cure vitamin D deficiency, indicating that vitamin D generated in the skin is fully functional. Despite evidence that vitamin D impacts on mammary gland biology and may protect against breast cancer development or progression (22, 23), no studies have addressed whether UV-generated vitamin D influences the growth of normal or transformed breast cells.

In the studies reported here, we used a unique model system comprised of cells derived from VDR knockout (KO) and wild-type (WT) mice (10) to determine whether endogenous (UV generated) or exogenous (EB1089) stimulation of the vitamin D pathway altered growth of tumors in a VDR-dependent manner.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nude mouse xenografts
Female, athymic NCr nu/nu nude mice were housed in sterile isolator cages and maintained on sterilized water and irradiated low (0.1%) calcium diet (Purina Test Diets, Richmond, IN) ad libitum. Mice were implanted sc with a 90-d extended release 17ß-estradiol pellet (Innovative Research, Sarasota, FL). Two weeks later, mice were inoculated sc in the flank with 2 x 106 WT145 or KO240 tumor cells (10, 24) suspended in 300 µl Matrigel (BD Biosciences, San Jose, CA)/DMEM/F12 (4:1). Mice were weighed and tumor volumes were measured biweekly via caliper measurement and volume calculated using the formula for a semiellipsoid [(W/2L/2H4/3{pi})/2]. After 2 wk, when tumors were palpable, mice were randomized into the following treatment groups: placebo (n = 8), EB1089 (Leo Pharmaceuticals, Ballerup, Denmark; n = 8), and UV light (n = 4). EB1089-treated animals were injected ip with 45 pmol EB1089 in a total volume of 20 µl three times weekly for 6 wk. Placebo controls received vehicle injections on the same schedule. UV light-treated mice were exposed for 10 min, three times weekly, for 6 wk, using cage-top lamps designed for reptile aquaria (Big Apple Herpetological, Hauppauge, NY). UV light exposure was calculated to be approximately 100 µW/cm2. Two hours before the animals were killed, selected animals were injected sc with 1 mg bromodeoxyuridine (BrdU) in 0.9% saline. Animals were killed via CO2 asphyxiation and cervical dislocation. Tumors were removed, weighed, and measured and fixed in 4% formalin for histological analysis. Blood was collected via cardiac puncture. Skin biopsies were removed from the middorsal region and fixed in 4% formalin. All procedures were performed following institutional regulations regarding the care and use of laboratory animals.

Serum analysis
Blood was fractionated using serum separator tubes (BD Biosciences) and serum stored at –80 C. Serum calcium was assayed using the QuantiChrom calcium assay kit (BioAssay Systems, Hayward, CA) according to the manufacturer’s recommendations. Serum 25D and 1,25D levels were measured using the OCTEIA 25-hydroxyvitamin D kit and OCTEIA 1,25-dihydroxyvitamin D3 kit (Immunodiagnostic Systems Ltd., Boldon, UK) according to manufacturer’s recommendations.

Histological analysis
Formalin-fixed tumor and skin sections were dehydrated through a graded series of ethanols, paraffin embedded, and sectioned at 5 µM. Sections were stained using hematoxylin and eosin (H&E). Sections from animals injected with BrdU before the animals were killed were analyzed with a BrdU staining Kit (Zymed Laboratories, South San Francisco, CA) according to the manufacturer’s recommendations. Terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling (TUNEL) staining was performed using the In situ cell death detection kit, peroxidase (Roche Applied Science, Penzberg, Germany) according to the manufacturer’s recommendations.

Blood vessel density
Vessel density was calculated on H&E-stained tumor sections. The number of vessels per field at x20 magnification was counted in four random fields per tumor section and averaged. Slides were viewed using bright-field microscopy with an AX70 microscope (Olympus, Tokyo, Japan) equipped with a Spot-RT digital camera.

Quantitative RT-PCR
Tumor tissue (100 mg) was homogenized in Trizol (Invitrogen, Carlsbad, CA), according to the manufacturer’s instructions. Cells (500,000 cells per 100-mm dish) were treated 24 h after plating with 100 nM 1,25D. Cells were pelleted after 12 h treatment and RNA was isolated with the RNeasy minikit (QIAGEN, Valencia, CA) according to the manufacturer’s recommendations. Three cDNA replicates were made for each RNA, using the TaqMan reverse transcription reagents kit (Applied Biosystems, Foster City, CA). Gene expression analysis was performed using SYBR green (ABGene, Rochester, NY), and values were normalized against 18S RNA. Primer sequences are as follows: Mus CYP24 forward, AAGTCATGGACTTGGCCTTCA; Mus CYP24 reverse, GCTCCGCCTTCTCGTTGA; Mus CYP27B1 forward, CAGAGCGCTGTAGTTTCTCATCA; Mus CYP27B1 reverse, CGTTAGCAATCCGCAAGCA; 18S rRNA forward, AGTCCCTGCCCTTTGTACACA; 18S rRNA reverse, GTTCCGAGGGCCTCACTAAAC. Plates were run in triplicate on the ABI-Prism 7700 (Applied Biosystems), and mean values of representative results are shown.

Statistical analysis
Data are expressed as mean ± SE. One-way ANOVA or Student’s t tests were performed, as appropriate, using GraphPad software (GraphPad, San Diego, CA). Means were considered statistically significant when P values less than 0.05 were obtained.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
EB1089 inhibits growth of murine xenografts via tumor cell VDR
The effect of chronic EB1089 treatment on growth of established xenografts derived from murine mammary tumor cells was examined over a 6-wk period. Tumor volumes were assessed twice weekly via caliper measurement, and the fold change in tumor size over the final 2 wk of the study was calculated (Fig. 1Go). The growth rate of tumors derived from WT145 cells, which express functional VDR, was significantly reduced in EB1089-treated mice, compared with the placebo group (P < 0.05). In contrast, EB1089 treatment did not affect the growth of tumors derived from KO240 cells, which were derived from a VDR knockout mouse and are unresponsive to EB1089 in vitro (24, 25).


Figure 1
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 1. EB1089 inhibits growth of xenografted VDR-positive tumors. Nude mice bearing murine mammary xenografts derived from VDR-positive (WT145) or VDR-negative (KO240) cell lines were treated with 45 pmol EB1089 three times weekly for 6 wk. Fold change in tumor volume was calculated for the last 2 wk of the study. Bars represent mean ± SE of six or more mice per group. a and b, Bars with different letters are statistically significant (P < 0.05).

 
The overall health of the tumor-bearing mice was assessed by monitoring body weight and serum calcium at the end of the study. Corrected animal weight (total weight minus tumor weight) was calculated to control for the differences in tumor weight. No differences in body weight were observed between placebo and EB1089-treated mice or between mice bearing WT145 or KO240 tumors (data not shown). EB1089 did not significantly elevate serum calcium as measured 6 or more hours after dosing (Fig. 2Go). Serum 1,25D levels were significantly lower in EB1089-treated animals (data not shown), indicating that EB1089 effectively suppressed the formation of endogenous 1,25D as expected.


Figure 2
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 2. Serum calcium is not altered by EB1089 treatment. Serum total calcium was measured by colorimetric assay in mice after 6 wk placebo [Control (Con)] or EB1089 treatment. Bars represent mean ± SE of six or more mice per group.

 
Angiogenesis in mammary tumors is not inhibited by EB1089
Previous data (26, 27, 28) has suggested that the antitumor activities of vitamin D analogs such as EB1089 may be through inhibition of tumor angiogenesis. To assess the potential contribution of antiangiogenic effects in our model system, blood vessel density was quantitated in tumor sections (Fig. 3Go). The average number of blood vessels per field was similar in tumors consisting of WT145 and KO240 cells, and no significant effects of EB1089 treatment on vessel density were observed in either tumor type.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
FIG. 3. Tumor vessel density is not altered by VDR or EB1089 treatment. Blood vessel density was quantitated on sections of xenografts derived from VDR-positive (WT145) and VDR-negative (KO240) tumor cells. Four random fields of view for each mouse were counted at x20 magnification. Bars represent mean ± SE of six or more mice per group.

 
EB1089 induces growth arrest and apoptosis in VDR-positive mammary tumor cells:
BrdU uptake was assessed on tumor sections as a measure of active cell proliferation (Fig. 4Go). The average percentage of BrdU-positive cells in control mice bearing tumors derived from WT145 cells was approximately 17% (Fig. 4AGo), and staining was restricted to the epithelial cells (Fig. 4BGo). The percentage of BrdU-positive cells was significantly decreased to less than 5% in WT145 tumors derived from mice treated with EB1089 (P < 0.05). BrdU incorporation in KO240 tumors was also restricted to epithelial cells and was not significantly different from that in WT145 tumors. No effect of EB1089 treatment on the percentage of BrdU-positive cells was observed in tumors derived from KO240 cells.


Figure 4
View larger version (69K):
[in this window]
[in a new window]

 
FIG. 4. EB1089 inhibits tumor cell proliferation and induces apoptosis through VDR-dependent mechanisms. A, The percentage of cells positive for the proliferation marker BrdU was assessed on sections of xenografts derived from VDR-positive (WT145) and VDR-negative (KO240) tumor cells. Counts were made on four random fields of view for each mouse at x20 magnification. B, Representative histological sections for each group. C, The percentage of TUNEL-positive cells was assessed on sections of xenografts derived from VDR-positive (WT145) and VDR-negative (KO240) tumor cells. D, Representative histological sections for each group. For A and C, counts were made on four random fields of view for each mouse at x20 magnification. Bars represent mean ± SE of six or more mice per group. a and b, Bars with different letters are statistically significant (P < 0.05). Con, Control.

 
TUNEL assays were used to quantitate apoptotic index in tumors as a function of treatment and cell type. Figure 4CGo shows the average percentage of TUNEL-positive cells per tumor (apoptotic index), and Figure 4DGo shows representative images from each group. Basal apoptotic index in WT145 and KO240 tumors was similar (~2%), and TUNEL positivity was restricted to the tumor cells. In WT145 tumors, apoptotic index increased approximately 2.5-fold (P < 0.05) after EB1089 treatment. No effect of EB1089 treatment on apoptotic index of KO240 tumors was detected.

Chronic UV treatment elevates vitamin D status and inhibits growth of VDR-positive xenografts
To assess whether endogenously produced vitamin D could elicit antitumor activities comparable with those of EB1089, a subset of mice bearing WT145 and KO240 tumors were exposed to UV light three times weekly for 6 wk. Chronic UV exposure did not affect final body weight in either group of tumor-bearing mice (data not shown). As reported in Fig. 5AGo, chronic UV treatment decreased the size of WT145 tumors, from approximately 2000 mm3 to approximately 1200 mm3 (P < 0.05). In contrast, KO240 tumor size was not significantly different from untreated WT145 tumors and was not significantly affected by UV light treatment.


Figure 5
View larger version (12K):
[in this window]
[in a new window]

 
FIG. 5. Chronic UV exposure inhibits proliferation and induces apoptosis in mammary xenografts through VDR-dependent mechanisms. A, Nude mice bearing murine mammary xenografts derived from VDR-positive (WT145) or VDR-negative (KO240) cell lines were chronically exposed to low-dose UV radiation three times weekly for 6 wk. Bars represent mean ± SE of tumor volume calculated at the end of the study. The percentage of BrdU (B) and TUNEL (C) positive cells was assessed on sections of xenografts derived from VDR-positive (WT145) and VDR-negative (KO240) tumor cells as described in Figs. 4Go and 5Go. Bars represent mean ± SE of six or more mice per group. a and b, Bars with different letters are statistically significant (P < 0.05).

 
Proliferation was measured by BrdU staining in tumor sections from all four treatment groups (Fig. 5BGo). The average percentage of BrdU-positive epithelial cells in WT145 tumors was significantly decreased after chronic UV light treatment, from approximately 17% to approximately 2% (P < 0.05). No significant effect was observed in KO240 tumors. Apoptosis was measured via TUNEL analysis in tumor sections (Fig. 5CGo). A low basal level of apoptosis was observed in WT145 tumors from untreated mouse hosts, and this level was increased approximately 3-fold (P < 0.05), in response to UV light treatment. KO240 tumors also had a low basal level of apoptosis, but this was not affected by chronic UV light exposure.

The effect of UV treatment on vitamin D status was assessed by measurement of 25D, the major circulating form of vitamin D, which increases in proportion to epidermal synthesis or dietary intake. Figure 6AGo shows that circulating 25D was significantly elevated in response to chronic UV treatment, with levels approximately double that of nonexposed controls (P < 0.05). Elevation in serum 25D was not associated with increases in either circulating 1,25D (Fig. 6BGo) or calcium (Fig. 6CGo), suggesting the possibility that the antitumor effects of UV might be secondary to the conversion of 25D to 1,25D within the tumor tissue. In support of this concept, we detected CYP27B1, the 25D-1{alpha}-hydroxylase enzyme, in WT145 and KO240 cells (Fig. 7AGo) and tumors (Fig. 7BGo). No significant effects of 1,25D treatment or UV exposure on CYP27B1 expression was detected. CYP24, a well-characterized VDR target gene, was examined in tumor tissue as a biomarker of vitamin D action. As demonstrated in Fig. 7CGo, chronic UV exposure significantly elevated CYP24 gene expression in WT tumors.


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 6. Chronic UV exposure increases serum 25D without affecting serum 1,25D or serum calcium. Serum 25D (A) and serum 1,25D (B) were measured by ELISA after 6 wk of UV exposure. C, Total calcium was measured by colorimetric assay in the same animals. Graphs are mean ± SE of six or more mice per group. *, Bars are statistically significant (P < 0.05). Con, Control.

 

Figure 7
View larger version (10K):
[in this window]
[in a new window]

 
FIG. 7. Expression of vitamin D metabolizing enzymes in cells and tumors. A, CYP27B1 mRNA expression in WT145 and KO240 cells was measured via SYBR green analysis after 1,25D treatment. B, CYP27B1 mRNA expression in WT145 tumors was measured via SYBR green analysis after 6 wk of UV exposure. C, CYP24 mRNA expression in WT145 tumors was measured by SYBR green analysis after 6 wk of UV exposure. *, Bars are statistically significant (P < 0.05). Con, Control.

 
Chronic UV exposure increases epidermal thickness and basal cell proliferation
Although no erythema was observed in UV-exposed mice, histological sections of skin taken from the middorsal region were examined to determine whether the UV treatment regimen adversely affected epidermal cell populations (Fig. 8Go). H&E staining to examine the overall architecture of the skin suggested thickening of the epidermal layer in response to UV exposure, and this was confirmed by direct measurement. Quantitation of BrdU incorporation on skin sections indicated that UV treatment increased the percentage of proliferating cells in the epidermis without altering the rate of apoptosis as measured by TUNEL staining.


Figure 8
View larger version (60K):
[in this window]
[in a new window]

 
FIG. 8. UV treatment induces epidermal hyperplasia. After 6 wk of UV exposure, dorsal skin biopsies were processed for H&E analysis, and representative figures are shown in A. Quantitative data are summarized in B. Skin thickness was measured on H&E sections, and BrdU and TUNEL assays were quantitated as described in Figs. 4Go and 5Go. a and b, Data with different letters are statistically significant (P < 0.05). Con, Control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In these studies, we exploited a novel model system comprised of mammary tumor cell lines with differential VDR expression to distinguish the effects of VDR agonists that are mediated directly in tumor cells vs. those mediated systemically or indirectly via stromal-epithelial interactions or through inhibition of angiogenesis. Furthermore, we manipulated the vitamin D pathway via both exogenous (treatment with the analog drug EB1089) and endogenous (treatment with chronic UV light) approaches and showed that in both cases, the antitumor effects of 1,25D absolutely require VDR expression in the tumor epithelial cell.

Although previous studies (28, 29, 30) have consistently demonstrated antitumor effects of EB1089, the precise mechanism of action of this analog is not known. EB1089 binds the VDR with lower affinity than 1,25D (31) and does not inhibit growth of tumor cells lacking VDR in vitro (24). However, in vivo evidence suggests that the antitumor effects of EB1089 may be mediated, at least partially, by direct effects on endothelial cells to inhibit angiogenesis (26, 27). In these studies, we created heterogeneous xenografts containing VDR-positive stromal and endothelial cells (originating from the host mouse) and either VDR-positive (WT145) or VDR-negative (KO240) epithelial tumor cells (inoculated subcutaneously). With this system, we have clearly demonstrated that EB1089 exhibits antitumor effects in vivo but only in xenografts containing WT145 cells (VDR positive). Thus, the effects of EB1089 are not mediated extratumorally and absolutely require expression of the VDR in the tumor epithelial cells. Histological analysis confirmed that both WT145 and KO240 tumors were comparably infiltrated with VDR-positive stromal and endothelial cells (not shown). Thus, if any effects of EB1089 were indirectly mediated, i.e. via disruption of stromal cell growth factor production, we would anticipate some growth inhibition in KO240 tumors in response to EB1089, but no significant growth inhibition was observed. We also found no evidence for direct effects of EB1089 on angiogenesis, which would have been mediated through the VDR-positive endothelial cells present in both WT145 and KO240 xenografts. These data suggest that the antiproliferative effect of EB1089 on mammary tumors is mediated directly via tumor cell VDR signaling and not indirectly via antiangiogenesis or disruption of stromal-epithelial signaling. These studies therefore support the concept that VDR is the relevant therapeutic target for vitamin D analogs with respect to tumor growth inhibition.

These are the first studies to demonstrate proof of principle that enhancement of the endogenous vitamin D synthesis pathway via UV exposure can exert antitumor effects. A protective effect of sunlight exposure against a variety of human cancers, including breast, prostate, and melanoma, has been suggested by epidemiological studies (19, 20, 32), but the role of UV-mediated vitamin D synthesis has yet to be experimentally tested. Because UV exposure exerts pleiotropic effects on biological systems (such as immunosuppression, tissue hyperplasia, and generation of photoproducts), it has been difficult to specifically distinguish the subset of UV effects that are mediated secondary to vitamin D synthesis. We therefore exploited the xenograft system described above to determine whether tumors derived from VDR-positive epithelial cells (WT145) would respond differently to UV exposure than tumors derived from VDR-KO epithelial cells (KO240). Our data indicate that chronic UV exposure elevated circulating 25D and induced the VDR target gene CYP24 in association with growth inhibition of VDR-positive tumor xenografts. No effects of UV on growth of xenografts lacking VDR were observed. Although unlikely, it is formally possible that WT and VDR-KO cells differ in their responsiveness to some other UV-mediated effects unrelated to vitamin D status; further in vivo studies with VDR-KO cells stably expressing VDR (in which vitamin D mediated growth inhibition has been reconstituted) would be necessary to completely rule out this possibility.

Our findings also suggest that higher vitamin D status in UV-exposed mice translated to growth-inhibitory effects on VDR-positive tumor cells via local generation of 1,25D within mammary tumors. In support of this concept, we detected CYP27B1 gene expression in WT145 and KO240 cells and xenografts. Of particular interest, the increase in 25D associated with chronic UV exposure did not elevate serum calcium, indicating that the antitumor effects are not related to changes in calcium homeostasis. Thus, it is tempting to speculate that elevating 25D via UV exposure could reduce breast cancer risk via autocrine generation of 1,25D in the mammary gland. This notion is supported by our recent demonstration that normal human mammary epithelial cells express CYP27B1 and are growth inhibited by 25D.

Our results demonstrating beneficial effects of UV exposure on breast tumors should be interpreted with caution because UV is an established risk factor for the development of skin cancer (33). In our study, skin of the host nude mice exhibited enhanced proliferation and epidermal thickening in response to the UV regimen. Whereas this clearly demonstrates that our UV exposure conditions were sufficient to impact on skin and support the notion that the elevated serum 25D is derived from conversion of epidermal precursors to cholecalciferol, further studies will be necessary to determine whether optimum vitamin D status can be induced by chronic UV exposure in the absence of skin pathology. Alternatively, it is possible that a high-dose topical or oral vitamin D regimen could be designed to mimic the antitumor effects of UV without epidermal hyperplasia or calcemic toxicity.

In summary, we have shown that enhancement of vitamin D signaling via either endogenous or exogenous pathways elicits antiproliferative and proapoptotic activity in mammary xenografts but only in tumors composed of VDR-expressing epithelial cells. No evidence for inhibitory effects of EB1089 on accessory cells or angiogenesis was obtained. The comparable effects of EB1089 and UV treatments on proliferation and apoptosis in WT145 tumor cells, and lack of effect in KO240 tumor cells, suggest that similar VDR-dependent pathways are activated by these distinct endogenous and exogenous regimens. This study is the first, to our knowledge, to demonstrate that 25D generated via UV exposure exerts VDR-dependent anticancer effects and that these effects are comparable with those mediated by a synthetic vitamin D analog. These results provide support to the hypothesis that the observed correlations between sunlight exposure and cancer risk are related to the vitamin D endocrine system.


    Acknowledgments
 
The authors thank the staff of the Freimann Life Sciences Center for their assistance with the care and housing of the NCr nude mice. The authors are grateful to Leo Pharmaceuticals for their donation of EB1089.


    Footnotes
 
This work was supported by National Institutes of Health Grant CA69700 (to J.W.) and Department of Defense BCRP Grants DAMD-17-03-1-0359 (to J.W.) and W81XWH-06-1-0439 (to M.E.V.). M.E.V. was supported by the Henry Luce Foundation’s Clare Boothe Luce program.

Disclosure Statement: The authors have nothing to disclose.

First Published Online July 12, 2007

Abbreviations: BrdU, Bromodeoxyuridine; 1,25D, 1,25-dihydroxyvitamin D3; 25D, 25-hydroxyvitamin D; H&E, hematoxylin and eosin; KO, knockout; TUNEL, terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick end labeling; VDR, vitamin D receptor; WT, wild type.

Received February 27, 2007.

Accepted for publication July 5, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Fleet JC 2004 Rapid, membrane-initiated actions of 1,25 dihydroxyvitamin D: what are they and what do they mean? J Nutr 134:3215–3218[Abstract/Free Full Text]
  2. Lowe L, Hansen CM, Senaratne S, Colston KW 2003 Mechanisms implicated in the growth regulatory effects of vitamin D compounds in breast cancer cells. Recent results in cancer research. Fortschritte Der Krebsforschung. Recent Results Cancer Res 164:99–110[Medline]
  3. Simboli-Campbell M, Narvaez CJ, Tenniswood M, Welsh J 1996 1,25-Dihydroxyvitamin D3 induces morphological and biochemical markers of apoptosis in MCF-7 breast cancer cells. J Steroid Biochem Mol Biol 58:367–376[CrossRef][Medline]
  4. Welsh J, Wietzke JA, Zinser GM, Smyczek S, Romu S, Tribble E, Welsh JC, Byrne B, Narvaez CJ 2002 Impact of the vitamin D3 receptor on growth-regulatory pathways in mammary gland and breast cancer. J Steroid Biochem Mol Biol 83:85–92[CrossRef][Medline]
  5. Narvaez CJ, Welsh J 2001 Role of mitochondria and caspases in vitamin D-mediated apoptosis of MCF-7 breast cancer cells. J Biol Chem 276:9101–9107[Abstract/Free Full Text]
  6. Eisman JA, Suva LJ, Martin TJ 1986 Significance of 1,25-dihydroxyvitamin D3 receptor in primary breast cancers. Cancer Res 46:5406–5408[Abstract/Free Full Text]
  7. Berger U, Wilson P, McClelland RA, Colston K, Haussler MR, Pike JW, Coombes RC 1987 Immunocytochemical detection of 1,25-dihydroxyvitamin D3 receptor in breast cancer. Cancer Res 47:6793–6799[Abstract/Free Full Text]
  8. Berger U, McClelland RA, Wilson P, Greene GL, Haussler MR, Pike JW, Colston K, Easton D, Coombes RC 1991 Immunocytochemical determination of estrogen receptor, progesterone receptor, and 1,25-dihydroxyvitamin D3 receptor in breast cancer and relationship to prognosis. Cancer Res 51:239–244[Abstract/Free Full Text]
  9. O’Kelly J, Koeffler HP 2003 Vitamin D analogs and breast cancer. Recent Results Cancer Res 164:333–348[Medline]
  10. Zinser GM, McEleney K, Welsh J 2003 Characterization of mammary tumor cell lines from wild type and vitamin D3 receptor knockout mice. Mol Cell Endocrinol 200:67–80[CrossRef][Medline]
  11. Hansen CM, Binderup L, Hamberg KJ, Carlberg C 2001 Vitamin D and cancer: effects of 1,25(OH)2D3 and its analogs on growth control and tumorigenesis. Front Biosci 6:D820–D848
  12. VanWeelden K, Flanagan L, Binderup L, Tenniswood M, Welsh J 1998 Apoptotic regression of MCF-7 xenografts in nude mice treated with the vitamin D3 analog, EB1089. Endocrinology 139:2102–2110[Abstract/Free Full Text]
  13. Oades GM, Dredge K, Kirby RS, Colston KW 2002 Vitamin D receptor-dependent antitumour effects of 1,25-dihydroxyvitamin D3 and two synthetic analogues in three in vivo models of prostate cancer. BJU Int 90:607–616[CrossRef][Medline]
  14. Mehta R, Hawthorne M, Uselding L, Albinescu D, Moriarty R, Christov K 2000 Prevention of N-methyl-N-nitrosourea-induced mammary carcinogenesis in rats by 1{alpha}-hydroxyvitamin D(5). J Natl Cancer Inst 92:1836–1840[Abstract/Free Full Text]
  15. Zinser G, Packman K, Welsh J 2002 Vitamin D(3) receptor ablation alters mammary gland morphogenesis. Development 129:3067–3076[Abstract/Free Full Text]
  16. Zinser GM, Suckow M, Welsh J 2005 Vitamin D receptor (VDR) ablation alters carcinogen-induced tumorigenesis in mammary gland, epidermis and lymphoid tissues. J Steroid Biochem Mol Biol 97:153–164[CrossRef][Medline]
  17. Zinser GM, Welsh J 2004 Accelerated mammary gland development during pregnancy and delayed postlactational involution in vitamin D3 receptor null mice. Mol Endocrinol 18:2208–2223[Abstract/Free Full Text]
  18. Zinser GM, Welsh J 2004 Vitamin D receptor status alters mammary gland morphology and tumorigenesis in MMTV-neu mice. Carcinogenesis 25:2361–2372[Abstract/Free Full Text]
  19. Grant WB 2003 Ecologic studies of solar UV-B radiation and cancer mortality rates. Recent Results Cancer Res 164:371–377[Medline]
  20. Gorham ED, Garland FC, Garland CF 1990 Sunlight and breast cancer incidence in the USSR. Int J Epidemiol 20:1145–1146
  21. Holick MF 2003 Evolution and function of vitamin D. Recent Results Cancer Res 164:3–28[Medline]
  22. Mawer EB, Walls J, Howell A, Davies M, Ratcliffe WA, Bundred NJ 1997 Serum 1,25-dihydroxyvitamin D may be related inversely to disease activity in breast cancer patients with bone metastases. J Clin Endocrinol Metab 82:118–122[Abstract/Free Full Text]
  23. Schondorf T, Eisberg C, Wassmer G, Warm M, Becker M, Rein DT, Gohring UJ 2003 Association of the vitamin D receptor genotype with bone metastases in breast cancer patients. Oncology 64:154–159[CrossRef][Medline]
  24. Valrance ME, Welsh J 2004 Breast cancer cell regulation by high-dose vitamin D compounds in the absence of nuclear vitamin D receptor. J Steroid Biochem Mol Biol 89–90:221–225
  25. Valrance ME, Brunet AH, Acosta A, Welsh J 2007 Dissociation of growth arrest and CYP24 induction by VDR ligands in mammary tumor cells. J Cell Biochem 101:1505–1519[CrossRef][Medline]
  26. Bernardi RJ, Johnson CS, Modzelewski RA, Trump DL 2002 Antiproliferative effects of 1{alpha},25-dihydroxyvitamin D(3) and vitamin D analogs on tumor-derived endothelial cells. Endocrinology 143:2508–2514[Abstract/Free Full Text]
  27. Mantell DJ, Owens PE, Bundred NJ, Mawer EB, Canfield AE 2000 1{alpha},25-Dihydroxyvitamin D(3) inhibits angiogenesis in vitro and in vivo. Circ Res 87:214–220[Abstract/Free Full Text]
  28. Blutt SE, Polek TC, Stewart LV, Kattan MW, Weigel NL 2000 A calcitriol analogue, EB1089, inhibits the growth of LNCaP tumors in nude mice. Cancer Res 60:779–782[Abstract/Free Full Text]
  29. Zhang X, Jiang F, Li P, Li C, Ma Q, Nicosia SV, Bai W 2005 Growth suppression of ovarian cancer xenografts in nude mice by vitamin D analogue EB1089. Clin Cancer Res 11:323–328[Abstract/Free Full Text]
  30. Milliken EL, Zhang X, Flask C, Duerk JL, MacDonald PN, Keri RA 2005 EB1089, a vitamin D receptor agonist, reduces proliferation and decreases tumor growth rate in a mouse model of hormone-induced mammary cancer. Cancer Lett 229:205–215[CrossRef][Medline]
  31. Carlberg C, Mathiasen IS, Saurat JH, Binderup L 1994 The 1,25-dihydroxyvitamin D3 (VD) analogues MC903, EB1089 and KH1060 activate the VD receptor: homodimers show higher ligand sensitivity than heterodimers with retinoid X receptors. J Steroid Biochem Mol Biol 51:137–142[CrossRef][Medline]
  32. Kricker A, Armstrong B 2006 Does sunlight have a beneficial influence on certain cancers? Prog Biophys Mol Biol 92:132–139[CrossRef][Medline]
  33. Gallagher RP, Lee TK 2006 Adverse effects of ultraviolet radiation: a brief review. Prog Biophys Mol Biol 92:119–131[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Valrance, M. E.
Right arrow Articles by Welsh, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Valrance, M. E.
Right arrow Articles by Welsh, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals