help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2006-0153
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vahl, T. P.
Right arrow Articles by D’Alessio, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vahl, T. P.
Right arrow Articles by D’Alessio, D. A.
Endocrinology Vol. 148, No. 10 4965-4973
Copyright © 2007 by The Endocrine Society

Glucagon-Like Peptide-1 (GLP-1) Receptors Expressed on Nerve Terminals in the Portal Vein Mediate the Effects of Endogenous GLP-1 on Glucose Tolerance in Rats

Torsten P. Vahl, Miyuki Tauchi, Timothy S. Durler, Eileen E. Elfers, Timothy M. Fernandes, Ronald D. Bitner, Kay S. Ellis, Stephen C. Woods, Randy J. Seeley, James P. Herman and David A. D’Alessio

Departments of Medicine (T.P.V., T.S.D., E.E.E., T.M.F., R.D.B., K.S.E., D.A.D.) and Psychiatry (M.T., S.C.W., R.J.S., J.P.H.), University of Cincinnati, Cincinnati, Ohio 45267

Address all correspondence and requests for reprints to: David D’Alessio, M.D., University of Cincinnati, Department of Internal Medicine, Division of Endocrinology and Metabolism, 2170 East Galbraith Road., Building 43, Room 315, Cincinnati, Ohio 45267. E-mail: dalessd{at}ucmail.uc.edu.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Glucagon-like peptide-1 (GLP-1) is an intestinal hormone that is secreted during meal absorption and is essential for normal glucose homeostasis. However, the relatively low plasma levels and rapid metabolism of GLP-1 raise questions as to whether direct endocrine action on target organs, such as islet cells, account for all of its effects on glucose tolerance. Recently, an alternative neural pathway initiated by sensors in the hepatic portal region has been proposed to mediate GLP-1 activity. We hypothesized that visceral afferent neurons in the portal bed express the GLP-1 receptor (GLP-1r) and regulate glucose tolerance. Consistent with this hypothesis, GLP-1r mRNA was present in the nodose ganglia, and nerve terminals innervating the portal vein contained the GLP-1r. Rats given an intraportal infusion of the GLP-1r antagonist, [des-His1,Glu9] exendin-4, in a low dose, had glucose intolerance, with a 53% higher glucose excursion compared with a vehicle-infused control group. Infusion of [des-His1,Glu9] exendin-4 at an identical rate into the jugular vein had no effect on glucose tolerance, demonstrating that this dose of GLP-1r antagonist did not affect blood glucose due to spillover into the systemic circulation. These studies demonstrate that GLP-1r are present on nerve terminals in the hepatic portal bed and that GLP-1 antagonism localized to this region impairs glucose tolerance. These data are consistent with an important component of neural mediation of GLP-1 action.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
GLUCAGON-LIKE PEPTIDE-1 (GLP-1) is an intestinal hormone that is essential for normal glucose tolerance. GLP-1 is released into the circulation during meal ingestion and regulates processes that contribute to the absorption and disposition of carbohydrate meals including gastric emptying, islet hormone secretion, hepatic glucose metabolism, and satiety (1, 2, 3). Primary among these are the effect of GLP-1 as an insulin secretagogue and the contribution of this peptide to the incretin effect (4). Intravenous GLP-1 is highly effective in stimulating insulin secretion and reducing hyperglycemia in persons with type 2 diabetes (5, 6, 7), and a number of strategies to use the GLP-1 system therapeutically are actively being pursued (8, 9).

There is currently one known GLP-1 receptor (GLP-1r), and it is presumed to mediate all the actions of GLP-1. This receptor was initially cloned from a library of pancreatic islet cells (10) but is also expressed in the stomach, lung, brain, and other tissues (1). The generally accepted conception of GLP-1 action is that the peptide is released from intestinal L-cells into the splanchnic vasculature and passes through the liver to the central venous and then arterial circulation from where it binds to GLP-1r on ß-cells and other targets, mediating insulin secretion and other effects. This model is consistent with the effects of systemic GLP-1r antagonists and GLP-1 antisera to cause glucose intolerance in animals and humans (11, 12, 13, 14). However, several results from studies of GLP-1 physiology in humans and animal models raise questions as to a strictly endocrine action of GLP-1. First, plasma levels of GLP-1 are relatively low compared with those of the other established incretin, glucose-dependent insulinotropic polypeptide (GIP), and the magnitude of the postprandial rise is considerably less (15). Second, GLP-1 is rapidly metabolized in the circulation by the ubiquitous enzyme dipeptidyl peptidase IV (16, 17). The intact peptide, GLP-1 (7–36)amide is degraded quickly to GLP-1 (9–36)amide with a half-life in the plasma of approximately 60–90 sec (18, 19). GLP-1 (9–36)amide, which lacks the two N-terminal amino acids histidine and alanine does not stimulate insulin secretion (20, 21). Dipeptidyl peptidase IV is located on the endothelium of capillaries, and it has been suggested that about 50% of intact GLP-1 may be N-terminally cleaved within the vessels of the small intestine immediately after release (22). An additional 40% of intact GLP-1 is thought to be degraded during a single passage through the liver (23). The low postprandial plasma levels of GLP-1 coupled with its rapid degradation raise the question as to whether the amount of intact GLP-1 that actually reaches peripheral target tissues can account for all of its properties to lower blood glucose.

Several recent studies suggest an alternative model of postprandial GLP-1 action through a neural circuit originating in the hepatic portal area. Nakabayashi et al. (24) demonstrated a neural reflex in an in situ rat model whereby hepatic vagal afferents and vagal efferent activity to the pancreas were stimulated by intraportal injection of GLP-1 but not the inactive precursor GLP-1 (1–36)amide. Consistent with this finding, infusion of GLP-1 and glucose intraportally caused an increase in glucose-stimulated insulin secretion that was attenuated by neural blockade (25). Other evidence supporting neural mediation of GLP-1 action comes from Ahren (26) who showed that destruction of sensory nerves by neonatal administration of capsaicin inhibited GLP-1 activity in adulthood. In addition, several studies in dogs support a portal action of GLP-1 to promote glucose metabolism (27, 28). Taken together, these studies are consistent with the mediation of GLP-1 effects by a hepatic-portal neural mechanism.

There is currently little anatomic evidence for a GLP-1-sensing neural pathway in the region of the portal vein. Nor is there yet any data demonstrating a contribution of intraportal signaling of endogenously released GLP-1 to the maintenance of postprandial glycemic control. We sought to address these issues by determining the presence of the GLP-1r in the visceral sensory neural system supplying the hepatoportal region and assessing the role of these receptors during enteral glucose absorption by blocking the receptor binding of endogenously released GLP-1 specifically in the portal vein.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
All procedures were approved by the University of Cincinnati Institutional Animal Care and Use Committee. Male Sprague Dawley rats (Charles River Laboratories, Wilmington, MA) weighing 270–340 g were housed in individual cages at 23 C on an 0800–2000 h light/dark cycle for at least 1 wk before study.

RT-PCR
Tissues were harvested from naive rats immediately after lethal pentobarbital injection and stored in RNA Later (Ambion, Austin, TX). Total RNA was extracted using TRI reagent (Molecular Research Center, Cincinnati, OH). For nodose ganglia (n = 10 pools), portal vein (n = 5 pools), and femoral nerve ganglia (n = 2 pools) three tissue samples were pooled for one RNA extraction. Pancreatic islets were isolated from four rats and then pooled for one RNA extraction, whereas for liver (n = 4), lung (n = 2), and stomach (n = 2), single tissues from separate animals were extracted. RNA was extracted from three separate culture plates of confluent INS-1 cells (29). cDNA was synthesized from 500 ng total RNA by RT using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). An aliquot of 1 µl of a total of 20 µl cDNA was used in PCR using primer pairs for the GLP-1r (forward, 5' ACGCACTTTCTTTCTCTGCC 3'; reverse, 5' CAAACAGGTTCAGGTGGATG 3') or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; forward, 5' CCAAGGTCATCCATGACAAC 3'; reverse, 5' TCCACAGTCTTCTGAGTGGC 3'). PCR amplifications were performed in triplicate using the QuantiTect SYBR Green real-time PCR kit as directed by the manufacturer (QIAGEN, Valencia, CA) in a SmartCycler instrument (Cepheid, Sunnyvale, CA) for 40 cycles. The PCR products were confirmed by direct sequencing and demonstrated to be homogeneous by melting-curve analysis and electrophoresis on agarose gels.

Western blots
Frozen tissues and cultured cells were lysed in SDS lysis buffer containing protease inhibitors. The protein concentrations of extracts were measured using a bicinchoninic acid assay kit (Pierce, Rockford, IL), and 25–75 µg was added to 12% polyacrylamide gels. Gels were transferred to nitrocellulose membranes, blocked with a solution of Tween 20 and low-fat milk, and incubated with primary antibodies directed against the GLP-1r. The blots were probed using two distinct anti-GLP-1r sera: a mouse antihuman GLP-1r antiserum (here termed AS-DD) obtained from Dr. Daniel Drucker, University of Toronto (30), and antiserum ab13181 (rabbit antihuman GLP-1R antibody raised to an N-terminal epitope of the GLP-1r; Abcam, Inc., Cambridge, MA). AS-DD and ab13181 were used at 1:4000 and 1:500 dilutions, respectively. Labeled protein was detected using horseradish peroxidase-linked goat antirabbit or antimouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA; 1:2000) as appropriate with an ECL detection kit (GE Healthcare-Biosciences, Piscataway, NJ).

Tissue preparation for immunohistochemistry
Rats were euthanized by pentobarbital injection and perfused intracardially with 300 ml normal saline followed by 300 ml 4% paraformaldehyde. Tissues were postfixed in 4% paraformaldehyde for 4 h and then placed in 30% sucrose in PBS at 4 C for at least 24 h. The portal vein was removed en bloc with the liver hilus and the mesentery attached and placed together in tissue boats, leaving the surrounding anatomy of the hepatoportal region intact. Freezing medium was added, and the tissue blocs were frozen and subsequently cut at 12 µm on a cryostat and then stored directly on slides at –20 C.

Single- and dual-label immunohistochemistry
Antiserum ab13181 (1:100, rabbit antihuman GLP-1r antibody; Abcam) interacting with the GLP-1r, AS-DD (1:100, mouse antihuman GLP-1r), and antisynaptophysin (1:300 rabbit antisynaptophysin antibody; Zymed, San Francisco, CA) were used to immunostain sections of the hepatoportal bed, pancreas, or nodose ganglion (31). The signal was amplified using biotinylated tyramide (1:250; Vector Laboratories, Burlingame, CA) (31). The secondary antibody for the GLP-1r was goat antirabbit conjugated to Cy3 (1:200; Vector). Alexa 488-labeled antirabbit antibody (Molecular Probes, Eugene, OR) was the secondary antibody for the antisynaptophysin. To determine specificity of primary antibodies, control reactions were performed in the absence of one or both primary antibodies. For double labeling, sections were incubated first with ab13181 (1:100, biotinylated tyramide amplified) and subsequently with antisynaptophsin (1:60). Confocal imaging was performed on an LSM 510 microscope system (Zeiss, Thornwood, NY) in multichannel mode. All confocal images processed for analysis were collected using a x63 or x100 water immersion lens with a numerical aperture of 1.5, z-step 0.5 µm, and image size 1024 x 1024 pixels. Cy3 was excited using the yellow line (568 nm) of the krypton/argon laser, whereas the green line (488 nm) was used to collect images of Alexa 488-labeled synaptophysin.

In vivo studies
Food was removed at 1600 h the day before the experiments, but the rats were given continued access to water. The following morning, anesthesia was induced with isoflurane, and rats received an ip injection of pentobarbital (60 mg/kg) to maintain anesthesia as well as buprenex analgesia (300 µg/kg) sc. A midline laparotomy was performed, and silastic catheters were inserted anterogradely into the hepatic portal vein and vena cava. The portal line was initiated in the superior mesenteric vein, positioned with the tip approximately 1.0–1.5 cm from the porta hepatis and used for infusions; the vena cava line was used for collection of blood samples. Separate experiments were performed with the infusion catheter in the right jugular vein instead of the portal vein. All animals received a gastric tube for administration of a glucose load. The animals were placed on an electrical heating pad set at 38 C throughout the surgery and the experiments to maintain their body temperature. To block the activity of endogenous GLP-1, the GLP-1 antagonist [desHis1,Glu9] exendin-4 (dH-Ex) (32, 33) was used. dH-Ex was purchased from American Peptides (Sunnyvale, CA; this peptide is designated as [desHis1,Glu8] exendin-4 in their catalog). Experiments were set up with pairs of dH-Ex and vehicle-treated animals studied in parallel. After line placement and a short stabilization period, animals were studied according to the following protocols.

Baseline samples were taken at –5 and 0 min, and a low-dose infusion (5 ng/min) of the GLP-1r antagonist dH-Ex in 0.5% BSA was started into the portal vein at a rate of 2 µl/min for 30 min (n = 12). Paired control studies used an infusion of 0.5% BSA for 30 min (n = 10). Starting at 0 min, a glucose bolus (1.0 g/kg) of a 20% dextrose solution was administered into the stomach over 3 min. Blood was collected at 10, 20, and 30 min in chilled heparinized tubes and immediately placed on ice. Blood samples were centrifuged at 4000 rpm for 20 min at 4 C. Plasma samples were collected and stored at –20 C for measurements of glucose and insulin.

In a second set of experiments, the same regimen described above was applied with the exception that the dH-Ex (5 ng/min) and control infusions were administered via the jugular vein (n = 10 per group). This experiment was included to control for systemic effects of the portally administered dose of dH-Ex.

In the third set of experiments, the animals received a bolus of 10 µg dH-Ex followed by a high-dose infusion of 1 µg/min or the control 0.5% BSA solution infused into the jugular vein over 30 min (n = 10 per group).

A fourth set of experiments was conducted to determine the release of GLP-1 during the intragastric glucose loading. Blood samples were taken from the portal vein and inferior vena cava of rats (n = 6) at –5 and 0 min before and 10, 20, and 30 min after the glucose infusion. Samples were collected in 50 mM EDTA plus 500 kIU/ml aprotinin, placed on ice, and centrifuged within 1 h for collection of plasma.

Analytical methods
Glucose levels were measured on the same day using a glucose oxidase method. Plasma samples were assayed for insulin using a RIA as previously described (34). Plasma was extracted in ethanol (21) and 300-µl aliquots assayed for total GLP-1 immunoreactivity using a commercially available assay kit following the manufacturer’s instructions (Linco Research, St. Louis, MO). The intra- and interassay coefficients of variation for this assay in our lab are 15 and 17%, and the minimal detectable concentration is 3 pM.

Statistical analysis
Results are given as mean ± SEM. The area under the curve for glucose and insulin was calculated for 30 min employing the trapezoidal rule. Comparison of area-under-the-curve values from animals given dH-Ex and vehicle were made using t tests. Pre- and postglucose values of plasma GLP-1 were made using two-way ANOVA.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of GLP-1r mRNA in nodose ganglia extracts
The nodose ganglia contain the cell bodies of the hepatic vagal afferent nerves, which innervate the abdominal viscera including the portal vein and liver. Figure 1AGo illustrates the RT-PCR products generated from RNA extracted from nodose ganglia, pancreatic islets, spinal cord, liver, and lung. GLP-1r mRNA was detectable in nodose ganglia, pancreatic islets, and lung but not in the liver or the spinal cord. Starting with 0.5 µg total RNA in the reverse transcriptase reaction, the threshold cycle (CT) for the SYBR Green detection in the real-time PCR was reached after 28.6 ± 0.7 cycles for nodose ganglia, 25.7 ± 0.2 cycles for pancreatic islets, and 25.1 ± 0.5 for lung. A control PCR run with nodose ganglion RNA but without previous RT yielded no product. Consistent with the literature, GLP-1r mRNA was also detectable in stomach and kidney tissue with CT values of 28.2 ± 0.4 and 30.6 ± 0.2, respectively, and was also present in extracts of confluent INS-1 cells at 19.6 ± 0.1. The amount of GLP-1r mRNA expressed in the portal vein and in the femoral nerve ganglion (CT 37.5 ± 0.5 and 36.4 ± 0.2, respectively) was approximately 1000-fold lower than in the nodose ganglion, suggesting that these cells from these tissues do not have appreciable expression of the GLP-1r gene.


Figure 1
View larger version (28K):
[in this window]
[in a new window]

 
FIG. 1. Expression of GLP-1r mRNA and the GLP-1r in tissue sections and extracts. A, RT-PCR products from RNA extracted from rat nodose ganglia (NG), pancreatic islets (ISL), spinal cord (SC), liver (LV), and lung (LU). GLP-1r mRNA was detectable in nodose ganglia (NG), pancreatic islets and lung but not in the other tissues. The GAPDH control was comparable in all five tissues. No PCR product was obtained in the PCR run with RNA from nodose ganglia but without previous reverse transcriptase reactions (no RT). B, Detection of the GLP-1r immunoreactivity in extracts of portal vein (PV), pancreas (P), INS-1 cells, and COS-7 cells by immunoblot. Extracts were separated on acrylamide gels, blotted to polyvinylidene difluoride, and labeled with antisera ab13181 (left) or AS-DD (right), reacting with the GLP-1r. The migration of markers of known size is shown at the left border. Each antiserum labeled bands at approximately 53 and at 63 kDa in extracts of pancreas, portal vein, and INS-1 cells but not COS-7 cells. C, Immunocytochemistry of pancreatic islets with ab13181 (left) and AS-DD (right). D, Immunocytochemistry of sections of nodose ganglia with AS-DD. The first and third panels demonstrate cell bodies of nodose neurons by autofluorescence. The second and fourth panels show the same sections labeled with the anti-GLP-1r serum.

 
Expression of the GLP-1r in the portal vein
Protein extracts of rat pancreas and portal vein as well as INS-1 and COS-7 cells were separated on acrylamide gels and transferred to polyvinylidene difluoride membranes; INS-1 cells, which are stimulated by GLP-1 (35), served as a positive control, and COS-7 cells, which are not responsive to GLP-1 (36), served as negative controls. Two separate blots were probed with one of two distinct antisera against the GLP-1r. Both antisera labeled a major band at approximately 53 kDa in the electrophoresed protein extracts from pancreas, portal vein, and INS-1 but not COS-7 cells (Fig. 1BGo). In addition, a second more faintly stained band at approximately 63 kDa was detected in the pancreas, portal vein, and INS-1 cells. Previous reports have found that the GLP-1r migrates in acrylamide gels in a comparable size range with some heterogeneity due to glycosylation (30, 37). The two antisera stained sections of pancreas comparably, with specific labeling of islets (Fig. 1CGo); on these control sections, there was no visible staining when the primary antiserum was excluded. The concordant results with two different GLP-1r antisera, on immunoblots and immunostaining, support their specificity. In addition, AS-DD labeled discrete neural cell bodies in sections of the nodose ganglion (Fig. 1DGo).

Because GLP-1r mRNA was detectable in neurons of the nodose ganglion, immunohistochemistry was used to determine whether afferent fibers of the vagus nerve innervating the portal vein express the GLP-1r. Figure 2AGo shows a section of portal vein at the liver hilus stained with hematoxylin and eosin. Labeling of a section adjacent to the one shown in Fig. 2AGo with an antiserum raised against synaptophysin, a membrane glycoprotein of synaptic vesicles (31, 38), demonstrated that the wall of the portal vein contains a dense network of neural fibers and nerve terminals (Fig. 2BGo). On higher magnification, these nerve fibers can be seen penetrating the portal vein and traversing the wall nearly to the lumen (Fig. 2CGo).


Figure 2
View larger version (61K):
[in this window]
[in a new window]

 
FIG. 2. Innervation of the rat portal vein. A, Cross-section of a rat portal vein at the level of the liver hilus stained with hematoxylin and eosin (x10). B, An adjacent section of the same tissue block labeled with antisynaptophysin antiserum, a marker of synaptic boutons, demonstrating dense neural innervation of the wall of the portal vein (x10). C, Immunostain of a portal vein cross section with antisynaptophysin. Synaptophysin-positive nerve terminals and fibers are visualized as green fluorescence (x20).

 
Double labeling with antisynaptophysin and anti-GLP-1r sera is shown in Fig. 3Go. Sections were labeled with the two antibodies and viewed by confocal microscopy. Antisynaptophysin stained neural structures in the wall of the portal vein with the Alexa 488-labeled secondary antibody showing green fluorescence (Fig. 3Go, B, E, H, and K). The anti-GLP-1r antibodies labeled similar structures although at a much lower density, with red fluorescence from the Cy-3 labeled secondary antibody (Fig. 3Go, A, D, G, and J). The merged images demonstrate colocalization of antisynaptophysin and anti-GLP-1r staining in common structures (Fig. 3Go, C, F, I, and L). Whereas the antisynaptophysin serum labeled both nerve fibers and terminals, the GLP-1r staining tended to be most apparent in the latter, a feature highlighted by the arrows in the photomicrographs. The overall pattern of staining is consistent with expression of the GLP-1r in discrete structures of nerves in the wall of the portal vein, such as terminals. The overall number of neural structures labeled by antisynaptophysin far exceeded those that were positive for the GLP-1r, suggesting that GLP-1 could act as a neurotransmitter in only a subset of portal nerves. Similar patterns of neural staining were seen in sections examined from three rats.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
FIG. 3. Colocalization of GLP-1r and synaptophysin in sections of rat portal vein. Top, Double-label immunohistochemistry of a single section of rat portal vein viewed at x20, (A–C; scale bar, 10 µm) and x40 (D–F; scale bar, 20 µm); the white box in B shows the area expanded at the higher power. Anti-GLP-1r (A and D; ab13181; positive elements labeled red), antisynaptophysin (B and D; positive elements labeled green), and merged images show colocalization of synaptophysin and GLP-1r in the wall of the portal vein (C and F; colabeled elements appear yellow). Middle, Double label of a section of portal vein stained with anti-GLP-1r (G), anti-synaptophysin (H), and merged (I). Magnification, x40; scale bar, 20 µm. Bottom, Double label of a section of portal vein stained with anti-GLP-1r (J), antisynaptophysin (K), and merged (L). Magnification, x63. In all panels, the white arrows denote representative double-stained neuronal boutons.

 
Effects of regional blockade of GLP-1r in the hepatoportal bed
Administration of glucose into the stomach caused an increase in plasma levels of GLP-1 in the portal vein, from fasting levels of 7.1 ± 1.5 pM to peak levels greater than 20 pM over 30 min (Fig. 4Go). Peripheral plasma GLP-1 levels were significantly lower than portal values at all time points (P = 0.002) and increased from 4.2 ± 0.7 to 10 ± 2.9 pM over the course of the intragastric glucose loading.


Figure 4
View larger version (8K):
[in this window]
[in a new window]

 
FIG. 4. Total GLP-1 immunoreactivity from portal vein and inferior vena cava plasma extracts before and after intragastric glucose. Fasting (0 min) and 10-, 20-, and 30-min postglucose GLP-1 levels in portal (black bars) and inferior vena cava (white bars) plasma are shown. *, P value < 0.05 vs. fasting.

 
Plasma glucose and insulin values in response to intragastric glucose infusion during portal administration of dH-Ex or vehicle treatment are shown in Fig. 5Go. Starting from similar baseline levels of plasma glucose, intraportal infusion of the GLP-1r antagonist dH-Ex at a dose of 5 ng/min caused a relative hyperglycemia after administration of enteral glucose compared with vehicle infusion (P < 0.001). Starting from a fasting glucose of 7.2 ± 0.4 mM, blood glucose rose to a peak of 12.8 ± 0.7 mM at 30 min during intraportal blockade of the GLP-r, whereas vehicle-treated rats had basal glucose levels of 6.9 ± 0.3 mM that peaked at 10.5 ± 0.5 mM (Fig. 5AGo). The integrated glucose response was 53% greater during intraportal dH-Ex than vehicle treatment (74.9 ± 11 vs. 46.8 ± 7.1 mM·min, P = 0.035; Fig. 5BGo). In contrast, plasma insulin levels were comparable in animals treated with dH-Ex and vehicle (Fig. 5Go, C and D). When expressed as a function of the plasma glucose, there was a trend for the insulin-glucose ratio to be lower in the animals receiving intraportal dH-Ex compared with controls (2.5 ± 0.4 vs. 3.9 ± 0.6 pM/mM; P = 0.073).


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 5. Plasma glucose and insulin concentrations in anesthetized rats treated with intraportal low-dose GLP-1r antagonist or vehicle control before and after an intragastric glucose load. A and C, Plasma glucose (A) and insulin (C) levels in rats infused through the portal vein with a low dose (5 ng/min) of dH-Ex ({circ}) or vehicle control (bullet) during the intragastric glucose tolerance test. B and D, Integrated plasma glucose (B) and insulin (D) responses for animals treated with intraportal dH-Ex and vehicle (black bars, vehicle; white bars, dH-Ex). *, P value = 0.035 vs. vehicle control.

 
To determine whether the effects of low-dose intraportal dH-Ex were mediated at sites outside the portal bed, a control experiment was conducted with 5 ng/min GLP-1r antagonist infused into the jugular vein (Fig. 6Go). Plasma glucose concentrations rose in response to the intragastric glucose load and were similar in rats given intrajugular dH-Ex or vehicle (Fig. 6AGo); the integrated glucose responses in the two groups did not differ (59.2 ± 10.5 and 58.6 ± 12.5 mM·min for vehicle and dH-Ex; Fig. 6BGo). Likewise, plasma insulin over the course of the study and integrated for each animal did not differ between the groups given GLP-1r antagonist or control infusions into the systemic circulation (Fig. 6Go, C and D).


Figure 6
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 6. Plasma glucose and insulin concentrations in anesthetized rats treated with intrajugular low-dose GLP-1r antagonist or vehicle control before and after an intragastric glucose load. A and C, Plasma glucose (A) and insulin (C) levels in rats infused through the jugular vein with a low dose (5 ng/min) of dH-Ex ({circ}) or vehicle control (bullet) during the intragastric glucose tolerance test. B and D, Integrated plasma glucose (B) and insulin (D) responses for animals treated with intrajugular dH-Ex and vehicle (black bars, vehicle; white bars, dH-Ex).

 
The effect of systemic high-dose administration of dH-Ex was assessed in separate studies using different batches of animals. Infusion of a primed 1 µg/min infusion of dH-Ex was compared with vehicle treatment during intragastric loading. The glucose responses over the course of the study were greater during systemic GLP-1r blockade (Fig. 7AGo), with a relative difference in integrated glucose levels of nearly 40% (74.9 ± 11.1 vs. 46.9 ± 7.2 mM·min for high-dose dH-Ex and vehicle, P = 0.038; Fig. 7BGo). Plasma insulin levels increased after the glucose load but did not differ between the dH-Ex and vehicle treatment.


Figure 7
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 7. Plasma glucose and insulin concentrations in anesthetized rats treated with intrajugular high-dose GLP-1r antagonist or vehicle control before and after an intragastric glucose load. A and C, Plasma glucose (A) and insulin (C) levels in rats infused through the jugular vein with a high dose (1 µg/min) of dH-Ex ({circ}) or vehicle control (bullet) during the intragastric glucose tolerance test. B and D, Integrated plasma glucose (B) and insulin (D) responses for animals treated with intrajugular dH-Ex and vehicle (black bars, vehicle; white bars, dH-Ex). *, P value = 0.038 vs. vehicle control.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The purpose of these studies was to determine whether and where the GLP-1r is expressed in the hepatic portal bed, and to investigate the function of this receptor during the absorption of glucose from the gastrointestinal tract. Our data indicate that the GLP-1r is expressed by vagal afferent neurons that innervate the abdominal organs including the hepatoportal region. To our knowledge, ours is the first demonstration of the GLP-1r in the portal vein and the most direct evidence to date that this receptor is present on vagal afferent nerves. Selectively blocking the GLP-1r in the portal circulation caused a significant impairment of glucose tolerance. Together, these findings support the hypothesis that vagal GLP-1r neurons innervating the hepatic portal region mediate the glucose-lowering effect of endogenous GLP-1.

We studied anesthetized rats to minimize difficulties with catheter function and because several other groups have used a similar model for related studies. Kolligs et al. (11) reported one of the first in vivo experiments examining specific GLP-1r blockade during enteral glucose administration. In that study, peripheral administration of a high dose of the GLP-1r antagonist exendin (9–39) resulted in relative hyperglycemia in anesthetized rats given intraduodenal glucose. Similar models have been used to study nutrient-stimulated GLP-1 secretion (39, 40). The changes we noted in portal and peripheral plasma total GLP-1 immunoreactivity are consistent with those reported by Rocca and Brubaker (39), who noted increases of plasma GLP-1 from 10–33 pg/ml (3–10 pM) after intraduodenal corn oil administration in anesthetized rats, and with the 4 pM increase in intact GLP-1 that has been reported by Anini et al. (40) after corn oil in anesthetized rats. We have previously reported fasting plasma GLP-1 concentrations of 8–10 pM in conscious rats (41), and the roughly 2-fold higher portal than peripheral GLP-1 levels have also been noted previously (42).

We used dH-Ex to antagonize GLP-1 binding to its receptor because this peptide has been demonstrated to have a higher affinity for the GLP-1r than the more commonly used antagonist exendin (9–39) (43), an observation that has been borne out in our previous studies (32, 33). Although it has been reported that GLP-1r antagonists may also affect GIP signaling (44), we have found that dH-Ex does not affect insulin secretion from rats given GIP during an IV glucose tolerance test (Vahl, T. P., and D. A. D’Alessio, unpublished).

The findings presented herein provide direct anatomic support for the hypothesis that visceral sensory nerves mediate GLP-1 signals. The relative abundance of GLP-1r mRNA in nodose ganglia indicates that it is synthesized by afferent neurons innervating the abdominal viscera. This finding is in agreement with a recent report by Nakagawa and colleagues (45). The minimal production of GLP-1r message in other peripheral neural tissues indicates that synthesis of this receptor occurs only in specific sites throughout the nervous system. The presence of the GLP-1r in the portal vein was demonstrated by Western blot and immunohistochemistry. However, RT-PCR of RNA extracts from portal vein and liver strongly suggest that the GLP-1r gene is not expressed in these tissues. These results suggest that portal GLP-1r originate at a distant site, and based on our data, this is likely to be from vagal afferent nerves (46).

The results of our in vivo studies demonstrate that blocking the GLP-1r in the portal bed during enteral glucose absorption, the period when endogenous GLP-1 is released, causes glucose intolerance. The absence of comparable hyperglycemia observed with a low dose of dH-Ex infused in the jugular vein indicates that this dose of GLP-1r antagonist in the systemic circulation was not sufficient to affect the regulation of glucose homeostasis. We did not measure plasma dH-Ex and so cannot comment on the relative concentrations of antagonist in the systemic and portal circulation during these studies. However, the significant differences in glucose tolerance with the portal and jugular infusions of dH-Ex indicates that hepatoportal GLP-1r are specifically involved and that the results are not the result of systemic spillover of the antagonist. The degree of impairment of glucose tolerance was comparable with a low dose of the GLP-1r antagonist given into the portal vein and a high dose administered systemically. Our interpretation of these results is that a significant portion of the effects of GLP-1 to promote glucose tolerance in the early phase of a meal is mediated through a portal neural pathway.

Based on the results of our glucose tolerance tests we cannot explain the specific mechanism(s) by which portal GLP-1 antagonism impaired postload glycemia. Insulin secretion was not different between the intraportal dH-Ex-4 and control infusions. This finding differs from the earliest studies of GLP-1r blockade in rats (11, 12) but is similar to what has been described previously in humans and baboons treated with systemic doses of exendin (9–39) during oral glucose tolerance tests (13, 47). One interpretation of these results is that because GLP-1r antagonism caused hyperglycemia, an insulin response similar to the control study represents a relative impairment. This interpretation is consistent with the trend toward lower insulin-glucose ratios we found in the intraportal dH-Ex group. We did not assess gastric emptying or glucagon secretion in these studies, but both are reduced by GLP-1 and so could cause hyperglycemia with blockade of GLP-1r signaling. It will be important to carefully assess the effect of portal GLP-1r signaling on the variety of processes that are affected by peripheral administration of GLP-1. One possibility raised by these results is that neural signaling could integrate the variety of functions regulated by postprandial GLP-1.

The physiological importance of sensory units in the portal bed has received increased attention recently. For example, the hepatic vagus is the likely means by which portal glucose concentrations are sensed and transmitted (48, 49). Interestingly, Burcelin and colleagues (50) demonstrated that intraportal GLP-1 signaling is necessary for optimal function of the portal glucose sensor. In these studies, fasted mice given intraportal infusions of glucose at a rate similar to that of endogenous glucose production had a significant decrease in peripheral glucose levels, but administration of a GLP-1r antagonist or use of GLP-1r null mice reversed this effect. Because intraportal GLP-1 did not enhance the effect of the portal glucose sensor (50), it is not clear how this system relates to the postprandial setting when the incretins are released into the portal circulation. However, it is plausible that the neural pathway we propose here as mediating postprandial GLP-1 actions is also sensitive to changes in portal glucose concentration.

In summary, we have demonstrated the presence of GLP-1r in the hepatic portal region. These receptors are expressed on neural fibers in the portal vein that are likely to be extensions of vagal afferent nerves. Local blockade of portal GLP-1r causes glucose intolerance. These findings are consistent with a neural pathway by which GLP-1r can initiate responses from the splanchnic bed, closer to the origin of GLP-1 secretion, that promote glucose tolerance.


    Footnotes
 
This study was supported by National Institutes of Health Grants DK54263, DK54890, DK17844, and MH069680. The obesity research center is supported in part by Procter & Gamble.

The authors declare no conflict of interest.

First Published Online June 21, 2007

Abbreviations: CT, Threshold cycle; dH-Ex, [desHis1,Glu9] exendin-4; GIP, glucose-dependent insulinotropic polypeptide; GLP-1, glucagon-like peptide-1; GLP-1r, GLP-1 receptor.

Received February 10, 2006.

Accepted for publication June 13, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Kieffer TJ, Habener JF 1999 The glucagon-like peptides. Endocr Rev 20:876–913[Abstract/Free Full Text]
  2. Prigeon RL, Quddusi S, Paty B, D’Alessio DA 2003 Suppression of endogenous glucose production by glucagon-like peptide 1 independent of islet hormones: a novel extrapancreatic effect. Am J Physiol 285:E701–E7073
  3. Verdich C, Toubro S, Buemann B, Lysgard Madsen J, Juul Holst J, Astrup A 2001 The role of postprandial releases of insulin and incretin hormones in meal-induced satiety: effect of obesity and weight reduction. Int J Obes Relat Metab Disord 25:1206–1214[CrossRef][Medline]
  4. Nauck MA, Bartels E, Orskov C, Ebert R, Creutzfeldt W 1993 Additive insulinotropic effects of exogenous synthetic human gastric inhibitory polypeptide and glucagon-like peptide-1-(7–36) amide infused at near-physiological insulinotropic hormone and glucose concentrations. J Clin Endocrinol Metab 76:912–917[Abstract]
  5. Nauck MA, Kleine N, Orskov C, Holst JJ, Willms B, Creutzfeldt W 1993 Normalization of fasting hyperglycemia by endogenous glucagon-like peptide 1 (7–36 amide) in type 2 (non-insulin-dependent) diabetic patients. Diabetologia 36:741–744[CrossRef][Medline]
  6. Toft-Nielsen MB, Madsbad S, Holst JJ 2001 Determinants of the effectiveness of glucagon-like peptide-1 in type 2 diabetes. J Clin Endocrinol Metab 86:3853–3860[Abstract/Free Full Text]
  7. Quddusi S, Vahl TP, Hanson K, Prigeon RL, D’Alessio DA 2003 Differential effects of acute and extended infusions of glucagon-like peptide-1 on first- and second-phase insulin secretion in diabetic and nondiabetic humans. Diabetes Care 26:791–798[Abstract/Free Full Text]
  8. Vahl TP, D’Alessio DA 2004 Gut peptides in the treatment of diabetes mellitus. 13:177–188
  9. Drucker DJ 2003 Enhancing incretin action for the treatment of type 2 diabetes. Diabetes Care 26:2929–2940[Abstract/Free Full Text]
  10. Thorens B 1992 Expression cloning of the pancreatic beta cell receptor for the gluco-incretin hormone glucagon-like peptide 1. Proc Natl Acad Sci USA 89:8641–8645[Abstract/Free Full Text]
  11. Kolligs F, Fehmann HC, Goke R, Goke B 1995 Reduction of the incretin effect in rats by the glucagon-like peptide 1 receptor antagonist exendin (9–39) amide. Diabetes 44:16–19[Abstract]
  12. Wang Z, Wang RM, Owji AA, Smith DM, Ghatei MA, Bloom SR 1995 Glucagon-like peptide-1 is a physiological incretin in rat. J Clin Invest 95:417–421[Medline]
  13. D’Alessio DA, Vogel R, Prigeon R, Laschansky E, Koerker D, Eng J, Ensinck JW 1996 Elimination of the action of glucagon-like peptide 1 causes an impairment of glucose tolerance after nutrient ingestion by healthy baboons. J Clin Invest 97:133–138[Medline]
  14. Schirra J, Sturm K, Leicht P, Arnold R, Goke B, Katschinski M 1998 Exendin(9–39)amide is an antagonist of glucagon-like peptide-1(7–36)amide in humans. J Clin Invest 101:1421–1430[Medline]
  15. Vilsboll T, Krarup T, Deacon CF, Madsbad S, Holst JJ 2001 Reduced postprandial concentrations of intact biologically active glucagon-like peptide 1 in type 2 diabetic patients. Diabetes 50:609–613[Abstract/Free Full Text]
  16. Mentlein R, Gallwitz B, Schmidt WE 1993 Dipeptidyl-peptidase IV hydrolyses gastric inhibitory polypeptide, glucagon-like peptide-1(7–36)amide, peptide histidine methionine and is responsible for their degradation in human serum. Eur J Biochem 214:829–835[Medline]
  17. Kieffer TJ, McIntosh CHS, Pederson RA 1995 Degradation of glucose-dependent insulinotropic polypeptide and truncated glucagon-like peptide 1 in vitro and in vivo by dipeptidyl peptidase IV. Endocrinology 136:3585–3596[Abstract]
  18. Deacon CF, Nauck MA, Toft-Nielsen M, Pridal L, Willms B, Holst JJ 1995 Both subcutaneously and intravenously administered glucagon-like peptide 1 are rapidly degraded from the NH2-terminus in type II diabetic patients and in healthy subjects. Diabetes 44:1126–1131[Abstract]
  19. Holst JJ, Deacon CF 1998 Inhibition of the activity of dipeptidyl-peptidase IV as a treatment for type 2 diabetes. Diabetes 47:1663–1670[Abstract]
  20. Deacon CF, Plamboeck A, Moller S, Holst JJ 2002 GLP-1-(9–36) amide reduces blood glucose in anesthetized pigs by a mechanism that does not involve insulin secretion. Am J Physiol 282:E873–E921
  21. Vahl TP, Paty BW, Fuller BD, Prigeon RL, D’Alessio DA 2003 Effects of GLP-1-(7–36)NH2, GLP-1-(7–37), and GLP-1- (9–36)NH2 on intravenous glucose tolerance and glucose-induced insulin secretion in healthy humans. J Clin Endocrinol Metab 88:1772–1779[Abstract/Free Full Text]
  22. Hansen L, Deacon CF, Orskov C, Holst JJ 1999 Glucagon-like peptide-1-(7–36)amide is transformed to glucagon-like peptide-1-(9–36)amide by dipeptidyl peptidase IV in the capillaries supplying the L cells of the porcine intestine. Endocrinology 140:5356–5363[Abstract/Free Full Text]
  23. Deacon CF, Pridal L, Klarskov L, Olesen M, Holst JJ 1996 Glucagon-like peptide 1 undergoes differential tissue-specific metabolism in the anesthetized pig. Am J Physiol 271:E458–E464
  24. Nakabayashi H, Nishizawa M, Nakagawa A, Takeda R, Niijima A 1996 Vagal hepatopancreatic reflex effect evoked by intraportal appearance of tGLP-1. Am J Physiol 271:E808–E813
  25. Balkan B, Li X 2000 Portal GLP-1 administration in rats augments the insulin response to glucose via neuronal mechanisms. Am J Physiol 279:R1449–R1454
  26. Ahren B 2004 Sensory nerves contribute to insulin secretion by glucagon-like peptide-1 in mice. Am J Physiol 286:R269–R272
  27. Ionut V, Hucking K, Liberty IF, Bergman RN 2005 Synergistic effect of portal glucose and glucagon-like peptide-1 to lower systemic glucose and stimulate counter-regulatory hormones. Diabetologia 48:967–975[CrossRef][Medline]
  28. Nishizawa M, Moore MC, Shiota M, Gustavson SM, Snead WL, Neal DW, Cherrington AD 2003 Effect of intraportal glucagon-like peptide-1 on glucose metabolism in conscious dogs. Am J Physiol 284:E1027–E1036
  29. Sweet IR, Cook DL, Wiseman RW, Greenbaum CJ, Lernmark A, Matsumoto S, Teague JC, Krohn KA 2002 Dynamic perifusion to maintain and assess isolated pancreatic islets. Diabetes Technol Ther 4:67–76[CrossRef][Medline]
  30. Hui H, Yu R, Bousquet C, Perfetti R 2002 Transfection of pancreatic-derived ß-cells with a minigene encoding for human glucagon-like peptide-1 regulates glucose-dependent insulin synthesis and secretion. Endocrinology 143:3529–3539[Abstract/Free Full Text]
  31. Mueller NK, Di S, Paden CM, Herman JP 2005 Activity-dependent modulation of neurotransmitter innervation to vasopressin neurons of the supraoptic nucleus. Endocrinology 146:348–354[Abstract/Free Full Text]
  32. Seeley RJ, Blake K, Rushing PA, Benoit S, Eng J, Woods SC, D’Alessio D 2000 The role of CNS glucagon-like peptide-1 (7–36) amide receptors in mediating the visceral illness effects of lithium chloride. J Neurosci 20:1616–1621[Abstract/Free Full Text]
  33. Thiele TE, Seeley RJ, D’Alessio D, Eng J, Bernstein IL, Woods SC, van Dijk G 1998 Central infusion of glucagon-like peptide-1-(7–36) amide (GLP-1) receptor antagonist attenuates lithium chloride-induced c-Fos induction in rat brainstem. Brain Res 801:164–170[CrossRef][Medline]
  34. Ensinck JW, Laschansky EC, Vogel RE, D’Alessio DA 1991 Effect of somatostatin-28 on dynamics of insulin secretion in perfused rat pancreas. Diabetes 40:1163–1169[Abstract]
  35. Leech CA, Habener JF 2003 Regulation of glucagon-like peptide-1 receptor and calcium-sensing receptor signaling by L-histidine. Endocrinology 144:4851–4858[Abstract/Free Full Text]
  36. Widmann C, Dolci W, Thorens B 1996 Heterologous desensitization of the glucagon-like peptide-1 receptor by phorbol esters requires phosphorylation of the cytoplasmic tail at four different sites. J Biol Chem 271:19957–19963[Abstract/Free Full Text]
  37. Widmann C, Dolci W, Thorens B 1995 Agonist-induced internalization and recycling of the glucagon-like peptide-1 receptor in transfected fibroblasts and in insulinomas. Biochem J 310:203–214[Medline]
  38. Becher A, Drenckhahn A, Pahner I, Margittai M, Jahn R, Ahnert-Hilger G 1999 The synaptophysin-synaptobrevin complex: a hallmark of synaptic vesicle maturation. J Neurosci 19:1922–1931[Abstract/Free Full Text]
  39. Rocca AS, Brubaker PL 1999 Role of the vagus nerve in mediating proximal nutrient-induced glucagon-like peptide-1 secretion. Endocrinology 140:1687–1694[Abstract/Free Full Text]
  40. Anini Y, Hansotia T, Brubaker PL 2002 Muscarinic receptors control postprandial release of glucagon-like peptide-1: in vivo and in vitro studies in rats. Endocrinology 143:2420–2426[Abstract/Free Full Text]
  41. Strader AD, Vahl TP, Jandacek RJ, Woods SC, D’Alessio DA, Seeley RJ 2005 Weight loss through ileal transposition is accompanied by increased ileal hormone secretion and synthesis in rats. Am J Physiol 288:E447–E453
  42. Iritani N, Sugimoto T, Fukuda H, Komiya M, Ikeda H 1999 Oral triacylglycerols regulate plasma glucagon-like peptide-1(7–36) and insulin levels in normal and especially in obese rats. J Nutr 129:46–50[Abstract/Free Full Text]
  43. Montrose-Rafizadeh C, Yang H, Rodgers BD, Beday A, Pritchette LA, Eng J 1997 High potency antagonists of the pancreatic glucagon-like peptide-1 receptor. J Biol Chem 272:21201–21206[Abstract/Free Full Text]
  44. Gault VA, O’Harte FP, Harriott P, Mooney MH, Green BD, Flatt PR 2003 Effects of the novel (Pro3)GIP antagonist and exendin(9–39)amide on GIP- and GLP-1-induced cyclic AMP generation, insulin secretion and postprandial insulin release in obese diabetic (ob/ob) mice: evidence that GIP is the major physiological incretin. Diabetologia 46:222–230[Medline]
  45. Nakagawa A, Satake H, Nakabayashi H, Nishizawa M, Furuya K, Nakano S, Kigoshi T, Nakayama K, Uchida K 2004 Receptor gene expression of glucagon-like peptide-1, but not glucose-dependent insulinotropic polypeptide, in rat nodose ganglion cells. Auton Neurosci 110:36–43[CrossRef][Medline]
  46. Berthoud HR 2004 Anatomy and function of sensory hepatic nerves. Anat Rec A Discov Mol Cell Evol Biol 280:827–835[Medline]
  47. Edwards CM, Todd JF, Mahmoudi M, Wang Z, Wang RM, Ghatei MA, Bloom SR 1999 Glucagon-like peptide 1 has a physiological role in the control of postprandial glucose in humans: studies with the antagonist exendin 9–39. Diabetes 48:86–93[Abstract]
  48. Niijima A 1969 Afferent impulse discharges from glucoreceptors in the liver of the guinea pig. Ann NY Acad Sci 157:690–700[Medline]
  49. Pagliassotti MJ, Myers SR, Moore MC, Neal DW, Cherrington AD 1991 Magnitude of negative arterial-portal glucose gradient alters net hepatic glucose balance in conscious dogs. Diabetes 40:1659–1668[Abstract]
  50. Burcelin R, Da Costa A, Drucker D, Thorens B 2001 Glucose competence of the hepatoportal vein sensor requires the presence of an activated glucagon-like peptide-1 receptor. Diabetes 50:1720–1728[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. L. Raab, P. M. Vuguin, D. A. Stoffers, and R. A. Simmons
Neonatal exendin-4 treatment reduces oxidative stress and prevents hepatic insulin resistance in intrauterine growth-retarded rats
Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2009; 297(6): R1785 - R1794.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Williams
Minireview: Finding the Sweet Spot: Peripheral Versus Central Glucagon-Like Peptide 1 Action in Feeding and Glucose Homeostasis
Endocrinology, July 1, 2009; 150(7): 2997 - 3001.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Ahren, A. Schweizer, S. Dejager, B. E. Dunning, P. M. Nilsson, M. Persson, and J. E. Foley
Vildagliptin Enhances Islet Responsiveness to Both Hyper- and Hypoglycemia in Patients with Type 2 Diabetes
J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1236 - 1243.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
D. L. Williams, D. G. Baskin, and M. W. Schwartz
Evidence that Intestinal Glucagon-Like Peptide-1 Plays a Physiological Role in Satiety
Endocrinology, April 1, 2009; 150(4): 1680 - 1687.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
E. B. Ruttimann, M. Arnold, J. J. Hillebrand, N. Geary, and W. Langhans
Intrameal Hepatic Portal and Intraperitoneal Infusions of Glucagon-Like Peptide-1 Reduce Spontaneous Meal Size in the Rat via Different Mechanisms
Endocrinology, March 1, 2009; 150(3): 1174 - 1181.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. Zheng, V. Ionut, V. Mooradian, D. Stefanovski, and R. N. Bergman
Exenatide Sensitizes Insulin-Mediated Whole-Body Glucose Disposal and Promotes Uptake of Exogenous Glucose by the Liver
Diabetes, February 1, 2009; 58(2): 352 - 359.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
D. S. Edgerton, K. M.S. Johnson, D. W. Neal, M. Scott, C. H. Hobbs, X. Zhang, A. Duttaroy, and A. D. Cherrington
Inhibition of Dipeptidyl Peptidase-4 by Vildagliptin During Glucagon-Like Peptide 1 Infusion Increases Liver Glucose Uptake in the Conscious Dog
Diabetes, January 1, 2009; 58(1): 243 - 249.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
A. Maida, J. A. Lovshin, L. L. Baggio, and D. J. Drucker
The Glucagon-Like Peptide-1 Receptor Agonist Oxyntomodulin Enhances {beta}-Cell Function but Does Not Inhibit Gastric Emptying in Mice
Endocrinology, November 1, 2008; 149(11): 5670 - 5678.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
J. Zhou, R. J. Martin, R. T. Tulley, A. M. Raggio, K. L. McCutcheon, L. Shen, S. C. Danna, S. Tripathy, M. Hegsted, and M. J. Keenan
Dietary resistant starch upregulates total GLP-1 and PYY in a sustained day-long manner through fermentation in rodents
Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1160 - E1166.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
S. C. Woods and D. A. D'Alessio
Central Control of Body Weight and Appetite
J. Clin. Endocrinol. Metab., November 1, 2008; 93(11_Supplement_1): s37 - s50.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
C. W. Chia and J. M. Egan
Incretin-Based Therapies in Type 2 Diabetes Mellitus
J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3703 - 3716.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
V. Ionut, D. Zheng, D. Stefanovski, and R. N. Bergman
Exenatide can reduce glucose independent of islet hormones or gastric emptying
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E269 - E277.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
M. Salehi, B. A. Aulinger, and D. A. D'Alessio
Targeting {beta}-Cell Mass in Type 2 Diabetes: Promise and Limitations of New Drugs Based on Incretins
Endocr. Rev., May 1, 2008; 29(3): 367 - 379.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Copyright Permission
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vahl, T. P.
Right arrow Articles by D’Alessio, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vahl, T. P.
Right arrow Articles by D’Alessio, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals