| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Departments of Medicine (T.P.V., T.S.D., E.E.E., T.M.F., R.D.B., K.S.E., D.A.D.) and Psychiatry (M.T., S.C.W., R.J.S., J.P.H.), University of Cincinnati, Cincinnati, Ohio 45267
Address all correspondence and requests for reprints to: David D’Alessio, M.D., University of Cincinnati, Department of Internal Medicine, Division of Endocrinology and Metabolism, 2170 East Galbraith Road., Building 43, Room 315, Cincinnati, Ohio 45267. E-mail: dalessd{at}ucmail.uc.edu.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
There is currently one known GLP-1 receptor (GLP-1r), and it is presumed to mediate all the actions of GLP-1. This receptor was initially cloned from a library of pancreatic islet cells (10) but is also expressed in the stomach, lung, brain, and other tissues (1). The generally accepted conception of GLP-1 action is that the peptide is released from intestinal L-cells into the splanchnic vasculature and passes through the liver to the central venous and then arterial circulation from where it binds to GLP-1r on ß-cells and other targets, mediating insulin secretion and other effects. This model is consistent with the effects of systemic GLP-1r antagonists and GLP-1 antisera to cause glucose intolerance in animals and humans (11, 12, 13, 14). However, several results from studies of GLP-1 physiology in humans and animal models raise questions as to a strictly endocrine action of GLP-1. First, plasma levels of GLP-1 are relatively low compared with those of the other established incretin, glucose-dependent insulinotropic polypeptide (GIP), and the magnitude of the postprandial rise is considerably less (15). Second, GLP-1 is rapidly metabolized in the circulation by the ubiquitous enzyme dipeptidyl peptidase IV (16, 17). The intact peptide, GLP-1 (7–36)amide is degraded quickly to GLP-1 (9–36)amide with a half-life in the plasma of approximately 60–90 sec (18, 19). GLP-1 (9–36)amide, which lacks the two N-terminal amino acids histidine and alanine does not stimulate insulin secretion (20, 21). Dipeptidyl peptidase IV is located on the endothelium of capillaries, and it has been suggested that about 50% of intact GLP-1 may be N-terminally cleaved within the vessels of the small intestine immediately after release (22). An additional 40% of intact GLP-1 is thought to be degraded during a single passage through the liver (23). The low postprandial plasma levels of GLP-1 coupled with its rapid degradation raise the question as to whether the amount of intact GLP-1 that actually reaches peripheral target tissues can account for all of its properties to lower blood glucose.
Several recent studies suggest an alternative model of postprandial GLP-1 action through a neural circuit originating in the hepatic portal area. Nakabayashi et al. (24) demonstrated a neural reflex in an in situ rat model whereby hepatic vagal afferents and vagal efferent activity to the pancreas were stimulated by intraportal injection of GLP-1 but not the inactive precursor GLP-1 (1–36)amide. Consistent with this finding, infusion of GLP-1 and glucose intraportally caused an increase in glucose-stimulated insulin secretion that was attenuated by neural blockade (25). Other evidence supporting neural mediation of GLP-1 action comes from Ahren (26) who showed that destruction of sensory nerves by neonatal administration of capsaicin inhibited GLP-1 activity in adulthood. In addition, several studies in dogs support a portal action of GLP-1 to promote glucose metabolism (27, 28). Taken together, these studies are consistent with the mediation of GLP-1 effects by a hepatic-portal neural mechanism.
There is currently little anatomic evidence for a GLP-1-sensing neural pathway in the region of the portal vein. Nor is there yet any data demonstrating a contribution of intraportal signaling of endogenously released GLP-1 to the maintenance of postprandial glycemic control. We sought to address these issues by determining the presence of the GLP-1r in the visceral sensory neural system supplying the hepatoportal region and assessing the role of these receptors during enteral glucose absorption by blocking the receptor binding of endogenously released GLP-1 specifically in the portal vein.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RT-PCR
Tissues were harvested from naive rats immediately after lethal pentobarbital injection and stored in RNA Later (Ambion, Austin, TX). Total RNA was extracted using TRI reagent (Molecular Research Center, Cincinnati, OH). For nodose ganglia (n = 10 pools), portal vein (n = 5 pools), and femoral nerve ganglia (n = 2 pools) three tissue samples were pooled for one RNA extraction. Pancreatic islets were isolated from four rats and then pooled for one RNA extraction, whereas for liver (n = 4), lung (n = 2), and stomach (n = 2), single tissues from separate animals were extracted. RNA was extracted from three separate culture plates of confluent INS-1 cells (29). cDNA was synthesized from 500 ng total RNA by RT using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA). An aliquot of 1 µl of a total of 20 µl cDNA was used in PCR using primer pairs for the GLP-1r (forward, 5' ACGCACTTTCTTTCTCTGCC 3'; reverse, 5' CAAACAGGTTCAGGTGGATG 3') or glyceraldehyde-3-phosphate dehydrogenase (GAPDH; forward, 5' CCAAGGTCATCCATGACAAC 3'; reverse, 5' TCCACAGTCTTCTGAGTGGC 3'). PCR amplifications were performed in triplicate using the QuantiTect SYBR Green real-time PCR kit as directed by the manufacturer (QIAGEN, Valencia, CA) in a SmartCycler instrument (Cepheid, Sunnyvale, CA) for 40 cycles. The PCR products were confirmed by direct sequencing and demonstrated to be homogeneous by melting-curve analysis and electrophoresis on agarose gels.
Western blots
Frozen tissues and cultured cells were lysed in SDS lysis buffer containing protease inhibitors. The protein concentrations of extracts were measured using a bicinchoninic acid assay kit (Pierce, Rockford, IL), and 25–75 µg was added to 12% polyacrylamide gels. Gels were transferred to nitrocellulose membranes, blocked with a solution of Tween 20 and low-fat milk, and incubated with primary antibodies directed against the GLP-1r. The blots were probed using two distinct anti-GLP-1r sera: a mouse antihuman GLP-1r antiserum (here termed AS-DD) obtained from Dr. Daniel Drucker, University of Toronto (30), and antiserum ab13181 (rabbit antihuman GLP-1R antibody raised to an N-terminal epitope of the GLP-1r; Abcam, Inc., Cambridge, MA). AS-DD and ab13181 were used at 1:4000 and 1:500 dilutions, respectively. Labeled protein was detected using horseradish peroxidase-linked goat antirabbit or antimouse IgG (Santa Cruz Biotechnology, Santa Cruz, CA; 1:2000) as appropriate with an ECL detection kit (GE Healthcare-Biosciences, Piscataway, NJ).
Tissue preparation for immunohistochemistry
Rats were euthanized by pentobarbital injection and perfused intracardially with 300 ml normal saline followed by 300 ml 4% paraformaldehyde. Tissues were postfixed in 4% paraformaldehyde for 4 h and then placed in 30% sucrose in PBS at 4 C for at least 24 h. The portal vein was removed en bloc with the liver hilus and the mesentery attached and placed together in tissue boats, leaving the surrounding anatomy of the hepatoportal region intact. Freezing medium was added, and the tissue blocs were frozen and subsequently cut at 12 µm on a cryostat and then stored directly on slides at –20 C.
Single- and dual-label immunohistochemistry
Antiserum ab13181 (1:100, rabbit antihuman GLP-1r antibody; Abcam) interacting with the GLP-1r, AS-DD (1:100, mouse antihuman GLP-1r), and antisynaptophysin (1:300 rabbit antisynaptophysin antibody; Zymed, San Francisco, CA) were used to immunostain sections of the hepatoportal bed, pancreas, or nodose ganglion (31). The signal was amplified using biotinylated tyramide (1:250; Vector Laboratories, Burlingame, CA) (31). The secondary antibody for the GLP-1r was goat antirabbit conjugated to Cy3 (1:200; Vector). Alexa 488-labeled antirabbit antibody (Molecular Probes, Eugene, OR) was the secondary antibody for the antisynaptophysin. To determine specificity of primary antibodies, control reactions were performed in the absence of one or both primary antibodies. For double labeling, sections were incubated first with ab13181 (1:100, biotinylated tyramide amplified) and subsequently with antisynaptophsin (1:60). Confocal imaging was performed on an LSM 510 microscope system (Zeiss, Thornwood, NY) in multichannel mode. All confocal images processed for analysis were collected using a x63 or x100 water immersion lens with a numerical aperture of 1.5, z-step 0.5 µm, and image size 1024 x 1024 pixels. Cy3 was excited using the yellow line (568 nm) of the krypton/argon laser, whereas the green line (488 nm) was used to collect images of Alexa 488-labeled synaptophysin.
In vivo studies
Food was removed at 1600 h the day before the experiments, but the rats were given continued access to water. The following morning, anesthesia was induced with isoflurane, and rats received an ip injection of pentobarbital (60 mg/kg) to maintain anesthesia as well as buprenex analgesia (300 µg/kg) sc. A midline laparotomy was performed, and silastic catheters were inserted anterogradely into the hepatic portal vein and vena cava. The portal line was initiated in the superior mesenteric vein, positioned with the tip approximately 1.0–1.5 cm from the porta hepatis and used for infusions; the vena cava line was used for collection of blood samples. Separate experiments were performed with the infusion catheter in the right jugular vein instead of the portal vein. All animals received a gastric tube for administration of a glucose load. The animals were placed on an electrical heating pad set at 38 C throughout the surgery and the experiments to maintain their body temperature. To block the activity of endogenous GLP-1, the GLP-1 antagonist [desHis1,Glu9] exendin-4 (dH-Ex) (32, 33) was used. dH-Ex was purchased from American Peptides (Sunnyvale, CA; this peptide is designated as [desHis1,Glu8] exendin-4 in their catalog). Experiments were set up with pairs of dH-Ex and vehicle-treated animals studied in parallel. After line placement and a short stabilization period, animals were studied according to the following protocols.
Baseline samples were taken at –5 and 0 min, and a low-dose infusion (5 ng/min) of the GLP-1r antagonist dH-Ex in 0.5% BSA was started into the portal vein at a rate of 2 µl/min for 30 min (n = 12). Paired control studies used an infusion of 0.5% BSA for 30 min (n = 10). Starting at 0 min, a glucose bolus (1.0 g/kg) of a 20% dextrose solution was administered into the stomach over 3 min. Blood was collected at 10, 20, and 30 min in chilled heparinized tubes and immediately placed on ice. Blood samples were centrifuged at 4000 rpm for 20 min at 4 C. Plasma samples were collected and stored at –20 C for measurements of glucose and insulin.
In a second set of experiments, the same regimen described above was applied with the exception that the dH-Ex (5 ng/min) and control infusions were administered via the jugular vein (n = 10 per group). This experiment was included to control for systemic effects of the portally administered dose of dH-Ex.
In the third set of experiments, the animals received a bolus of 10 µg dH-Ex followed by a high-dose infusion of 1 µg/min or the control 0.5% BSA solution infused into the jugular vein over 30 min (n = 10 per group).
A fourth set of experiments was conducted to determine the release of GLP-1 during the intragastric glucose loading. Blood samples were taken from the portal vein and inferior vena cava of rats (n = 6) at –5 and 0 min before and 10, 20, and 30 min after the glucose infusion. Samples were collected in 50 mM EDTA plus 500 kIU/ml aprotinin, placed on ice, and centrifuged within 1 h for collection of plasma.
Analytical methods
Glucose levels were measured on the same day using a glucose oxidase method. Plasma samples were assayed for insulin using a RIA as previously described (34). Plasma was extracted in ethanol (21) and 300-µl aliquots assayed for total GLP-1 immunoreactivity using a commercially available assay kit following the manufacturer’s instructions (Linco Research, St. Louis, MO). The intra- and interassay coefficients of variation for this assay in our lab are 15 and 17%, and the minimal detectable concentration is 3 pM.
Statistical analysis
Results are given as mean ± SEM. The area under the curve for glucose and insulin was calculated for 30 min employing the trapezoidal rule. Comparison of area-under-the-curve values from animals given dH-Ex and vehicle were made using t tests. Pre- and postglucose values of plasma GLP-1 were made using two-way ANOVA.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
illustrates the RT-PCR products generated from RNA extracted from nodose ganglia, pancreatic islets, spinal cord, liver, and lung. GLP-1r mRNA was detectable in nodose ganglia, pancreatic islets, and lung but not in the liver or the spinal cord. Starting with 0.5 µg total RNA in the reverse transcriptase reaction, the threshold cycle (CT) for the SYBR Green detection in the real-time PCR was reached after 28.6 ± 0.7 cycles for nodose ganglia, 25.7 ± 0.2 cycles for pancreatic islets, and 25.1 ± 0.5 for lung. A control PCR run with nodose ganglion RNA but without previous RT yielded no product. Consistent with the literature, GLP-1r mRNA was also detectable in stomach and kidney tissue with CT values of 28.2 ± 0.4 and 30.6 ± 0.2, respectively, and was also present in extracts of confluent INS-1 cells at 19.6 ± 0.1. The amount of GLP-1r mRNA expressed in the portal vein and in the femoral nerve ganglion (CT 37.5 ± 0.5 and 36.4 ± 0.2, respectively) was approximately 1000-fold lower than in the nodose ganglion, suggesting that these cells from these tissues do not have appreciable expression of the GLP-1r gene.
|
). In addition, a second more faintly stained band at approximately 63 kDa was detected in the pancreas, portal vein, and INS-1 cells. Previous reports have found that the GLP-1r migrates in acrylamide gels in a comparable size range with some heterogeneity due to glycosylation (30, 37). The two antisera stained sections of pancreas comparably, with specific labeling of islets (Fig. 1C); on these control sections, there was no visible staining when the primary antiserum was excluded. The concordant results with two different GLP-1r antisera, on immunoblots and immunostaining, support their specificity. In addition, AS-DD labeled discrete neural cell bodies in sections of the nodose ganglion (Fig. 1D).
Because GLP-1r mRNA was detectable in neurons of the nodose ganglion, immunohistochemistry was used to determine whether afferent fibers of the vagus nerve innervating the portal vein express the GLP-1r. Figure 2A shows a section of portal vein at the liver hilus stained with hematoxylin and eosin. Labeling of a section adjacent to the one shown in Fig. 2A with an antiserum raised against synaptophysin, a membrane glycoprotein of synaptic vesicles (31, 38), demonstrated that the wall of the portal vein contains a dense network of neural fibers and nerve terminals (Fig. 2B). On higher magnification, these nerve fibers can be seen penetrating the portal vein and traversing the wall nearly to the lumen (Fig. 2C).
|
. Sections were labeled with the two antibodies and viewed by confocal microscopy. Antisynaptophysin stained neural structures in the wall of the portal vein with the Alexa 488-labeled secondary antibody showing green fluorescence (Fig. 3, B, E, H, and K). The anti-GLP-1r antibodies labeled similar structures although at a much lower density, with red fluorescence from the Cy-3 labeled secondary antibody (Fig. 3, A, D, G, and J). The merged images demonstrate colocalization of antisynaptophysin and anti-GLP-1r staining in common structures (Fig. 3, C, F, I, and L). Whereas the antisynaptophysin serum labeled both nerve fibers and terminals, the GLP-1r staining tended to be most apparent in the latter, a feature highlighted by the arrows in the photomicrographs. The overall pattern of staining is consistent with expression of the GLP-1r in discrete structures of nerves in the wall of the portal vein, such as terminals. The overall number of neural structures labeled by antisynaptophysin far exceeded those that were positive for the GLP-1r, suggesting that GLP-1 could act as a neurotransmitter in only a subset of portal nerves. Similar patterns of neural staining were seen in sections examined from three rats.
|
). Peripheral plasma GLP-1 levels were significantly lower than portal values at all time points (P = 0.002) and increased from 4.2 ± 0.7 to 10 ± 2.9 pM over the course of the intragastric glucose loading.
|
. Starting from similar baseline levels of plasma glucose, intraportal infusion of the GLP-1r antagonist dH-Ex at a dose of 5 ng/min caused a relative hyperglycemia after administration of enteral glucose compared with vehicle infusion (P < 0.001). Starting from a fasting glucose of 7.2 ± 0.4 mM, blood glucose rose to a peak of 12.8 ± 0.7 mM at 30 min during intraportal blockade of the GLP-r, whereas vehicle-treated rats had basal glucose levels of 6.9 ± 0.3 mM that peaked at 10.5 ± 0.5 mM (Fig. 5A). The integrated glucose response was 53% greater during intraportal dH-Ex than vehicle treatment (74.9 ± 11 vs. 46.8 ± 7.1 mM·min, P = 0.035; Fig. 5B). In contrast, plasma insulin levels were comparable in animals treated with dH-Ex and vehicle (Fig. 5, C and D). When expressed as a function of the plasma glucose, there was a trend for the insulin-glucose ratio to be lower in the animals receiving intraportal dH-Ex compared with controls (2.5 ± 0.4 vs. 3.9 ± 0.6 pM/mM; P = 0.073).
|
). Plasma glucose concentrations rose in response to the intragastric glucose load and were similar in rats given intrajugular dH-Ex or vehicle (Fig. 6A); the integrated glucose responses in the two groups did not differ (59.2 ± 10.5 and 58.6 ± 12.5 mM·min for vehicle and dH-Ex; Fig. 6B). Likewise, plasma insulin over the course of the study and integrated for each animal did not differ between the groups given GLP-1r antagonist or control infusions into the systemic circulation (Fig. 6, C and D).
|
), with a relative difference in integrated glucose levels of nearly 40% (74.9 ± 11.1 vs. 46.9 ± 7.2 mM·min for high-dose dH-Ex and vehicle, P = 0.038; Fig. 7B). Plasma insulin levels increased after the glucose load but did not differ between the dH-Ex and vehicle treatment.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
We studied anesthetized rats to minimize difficulties with catheter function and because several other groups have used a similar model for related studies. Kolligs et al. (11) reported one of the first in vivo experiments examining specific GLP-1r blockade during enteral glucose administration. In that study, peripheral administration of a high dose of the GLP-1r antagonist exendin (9–39) resulted in relative hyperglycemia in anesthetized rats given intraduodenal glucose. Similar models have been used to study nutrient-stimulated GLP-1 secretion (39, 40). The changes we noted in portal and peripheral plasma total GLP-1 immunoreactivity are consistent with those reported by Rocca and Brubaker (39), who noted increases of plasma GLP-1 from 10–33 pg/ml (3–10 pM) after intraduodenal corn oil administration in anesthetized rats, and with the 4 pM increase in intact GLP-1 that has been reported by Anini et al. (40) after corn oil in anesthetized rats. We have previously reported fasting plasma GLP-1 concentrations of 8–10 pM in conscious rats (41), and the roughly 2-fold higher portal than peripheral GLP-1 levels have also been noted previously (42).
We used dH-Ex to antagonize GLP-1 binding to its receptor because this peptide has been demonstrated to have a higher affinity for the GLP-1r than the more commonly used antagonist exendin (9–39) (43), an observation that has been borne out in our previous studies (32, 33). Although it has been reported that GLP-1r antagonists may also affect GIP signaling (44), we have found that dH-Ex does not affect insulin secretion from rats given GIP during an IV glucose tolerance test (Vahl, T. P., and D. A. D’Alessio, unpublished).
The findings presented herein provide direct anatomic support for the hypothesis that visceral sensory nerves mediate GLP-1 signals. The relative abundance of GLP-1r mRNA in nodose ganglia indicates that it is synthesized by afferent neurons innervating the abdominal viscera. This finding is in agreement with a recent report by Nakagawa and colleagues (45). The minimal production of GLP-1r message in other peripheral neural tissues indicates that synthesis of this receptor occurs only in specific sites throughout the nervous system. The presence of the GLP-1r in the portal vein was demonstrated by Western blot and immunohistochemistry. However, RT-PCR of RNA extracts from portal vein and liver strongly suggest that the GLP-1r gene is not expressed in these tissues. These results suggest that portal GLP-1r originate at a distant site, and based on our data, this is likely to be from vagal afferent nerves (46).
The results of our in vivo studies demonstrate that blocking the GLP-1r in the portal bed during enteral glucose absorption, the period when endogenous GLP-1 is released, causes glucose intolerance. The absence of comparable hyperglycemia observed with a low dose of dH-Ex infused in the jugular vein indicates that this dose of GLP-1r antagonist in the systemic circulation was not sufficient to affect the regulation of glucose homeostasis. We did not measure plasma dH-Ex and so cannot comment on the relative concentrations of antagonist in the systemic and portal circulation during these studies. However, the significant differences in glucose tolerance with the portal and jugular infusions of dH-Ex indicates that hepatoportal GLP-1r are specifically involved and that the results are not the result of systemic spillover of the antagonist. The degree of impairment of glucose tolerance was comparable with a low dose of the GLP-1r antagonist given into the portal vein and a high dose administered systemically. Our interpretation of these results is that a significant portion of the effects of GLP-1 to promote glucose tolerance in the early phase of a meal is mediated through a portal neural pathway.
Based on the results of our glucose tolerance tests we cannot explain the specific mechanism(s) by which portal GLP-1 antagonism impaired postload glycemia. Insulin secretion was not different between the intraportal dH-Ex-4 and control infusions. This finding differs from the earliest studies of GLP-1r blockade in rats (11, 12) but is similar to what has been described previously in humans and baboons treated with systemic doses of exendin (9–39) during oral glucose tolerance tests (13, 47). One interpretation of these results is that because GLP-1r antagonism caused hyperglycemia, an insulin response similar to the control study represents a relative impairment. This interpretation is consistent with the trend toward lower insulin-glucose ratios we found in the intraportal dH-Ex group. We did not assess gastric emptying or glucagon secretion in these studies, but both are reduced by GLP-1 and so could cause hyperglycemia with blockade of GLP-1r signaling. It will be important to carefully assess the effect of portal GLP-1r signaling on the variety of processes that are affected by peripheral administration of GLP-1. One possibility raised by these results is that neural signaling could integrate the variety of functions regulated by postprandial GLP-1.
The physiological importance of sensory units in the portal bed has received increased attention recently. For example, the hepatic vagus is the likely means by which portal glucose concentrations are sensed and transmitted (48, 49). Interestingly, Burcelin and colleagues (50) demonstrated that intraportal GLP-1 signaling is necessary for optimal function of the portal glucose sensor. In these studies, fasted mice given intraportal infusions of glucose at a rate similar to that of endogenous glucose production had a significant decrease in peripheral glucose levels, but administration of a GLP-1r antagonist or use of GLP-1r null mice reversed this effect. Because intraportal GLP-1 did not enhance the effect of the portal glucose sensor (50), it is not clear how this system relates to the postprandial setting when the incretins are released into the portal circulation. However, it is plausible that the neural pathway we propose here as mediating postprandial GLP-1 actions is also sensitive to changes in portal glucose concentration.
In summary, we have demonstrated the presence of GLP-1r in the hepatic portal region. These receptors are expressed on neural fibers in the portal vein that are likely to be extensions of vagal afferent nerves. Local blockade of portal GLP-1r causes glucose intolerance. These findings are consistent with a neural pathway by which GLP-1r can initiate responses from the splanchnic bed, closer to the origin of GLP-1 secretion, that promote glucose tolerance.
|
Footnotes |
|---|
The authors declare no conflict of interest.
First Published Online June 21, 2007
Abbreviations: CT, Threshold cycle; dH-Ex, [desHis1,Glu9] exendin-4; GIP, glucose-dependent insulinotropic polypeptide; GLP-1, glucagon-like peptide-1; GLP-1r, GLP-1 receptor.
Received February 10, 2006.
Accepted for publication June 13, 2007.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
This article has been cited by other articles:
 |
|
 |
|
  E. L. Raab, P. M. Vuguin, D. A. Stoffers, and R. A. Simmons Neonatal exendin-4 treatment reduces oxidative stress and prevents hepatic insulin resistance in intrauterine growth-retarded rats Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2009; 297(6): R1785 - R1794. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Williams Minireview: Finding the Sweet Spot: Peripheral Versus Central Glucagon-Like Peptide 1 Action in Feeding and Glucose Homeostasis Endocrinology, July 1, 2009; 150(7): 2997 - 3001. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Ahren, A. Schweizer, S. Dejager, B. E. Dunning, P. M. Nilsson, M. Persson, and J. E. Foley Vildagliptin Enhances Islet Responsiveness to Both Hyper- and Hypoglycemia in Patients with Type 2 Diabetes J. Clin. Endocrinol. Metab., April 1, 2009; 94(4): 1236 - 1243. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. L. Williams, D. G. Baskin, and M. W. Schwartz Evidence that Intestinal Glucagon-Like Peptide-1 Plays a Physiological Role in Satiety Endocrinology, April 1, 2009; 150(4): 1680 - 1687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. B. Ruttimann, M. Arnold, J. J. Hillebrand, N. Geary, and W. Langhans Intrameal Hepatic Portal and Intraperitoneal Infusions of Glucagon-Like Peptide-1 Reduce Spontaneous Meal Size in the Rat via Different Mechanisms Endocrinology, March 1, 2009; 150(3): 1174 - 1181. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Zheng, V. Ionut, V. Mooradian, D. Stefanovski, and R. N. Bergman Exenatide Sensitizes Insulin-Mediated Whole-Body Glucose Disposal and Promotes Uptake of Exogenous Glucose by the Liver Diabetes, February 1, 2009; 58(2): 352 - 359. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. S. Edgerton, K. M.S. Johnson, D. W. Neal, M. Scott, C. H. Hobbs, X. Zhang, A. Duttaroy, and A. D. Cherrington Inhibition of Dipeptidyl Peptidase-4 by Vildagliptin During Glucagon-Like Peptide 1 Infusion Increases Liver Glucose Uptake in the Conscious Dog Diabetes, January 1, 2009; 58(1): 243 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Maida, J. A. Lovshin, L. L. Baggio, and D. J. Drucker The Glucagon-Like Peptide-1 Receptor Agonist Oxyntomodulin Enhances {beta}-Cell Function but Does Not Inhibit Gastric Emptying in Mice Endocrinology, November 1, 2008; 149(11): 5670 - 5678. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Zhou, R. J. Martin, R. T. Tulley, A. M. Raggio, K. L. McCutcheon, L. Shen, S. C. Danna, S. Tripathy, M. Hegsted, and M. J. Keenan Dietary resistant starch upregulates total GLP-1 and PYY in a sustained day-long manner through fermentation in rodents Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1160 - E1166. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Woods and D. A. D'Alessio Central Control of Body Weight and Appetite J. Clin. Endocrinol. Metab., November 1, 2008; 93(11_Supplement_1): s37 - s50. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. W. Chia and J. M. Egan Incretin-Based Therapies in Type 2 Diabetes Mellitus J. Clin. Endocrinol. Metab., October 1, 2008; 93(10): 3703 - 3716. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Ionut, D. Zheng, D. Stefanovski, and R. N. Bergman Exenatide can reduce glucose independent of islet hormones or gastric emptying Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E269 - E277. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Salehi, B. A. Aulinger, and D. A. D'Alessio Targeting {beta}-Cell Mass in Type 2 Diabetes: Promise and Limitations of New Drugs Based on Incretins Endocr. Rev., May 1, 2008; 29(3): 367 - 379. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
) or vehicle control (
) during the intragastric glucose tolerance test. B and D, Integrated plasma glucose (B) and insulin (D) responses for animals treated with intraportal dH-Ex and vehicle (black bars, vehicle; white bars, dH-Ex). *, P value = 0.035 vs. vehicle control.
