help button home button Endocrine Society Endocrinology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS

Endocrinology, doi:10.1210/en.2007-0576
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sze, K. H.
Right arrow Articles by Wong, A. O. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sze, K. H.
Right arrow Articles by Wong, A. O. L.
Endocrinology Vol. 148, No. 10 5042-5059
Copyright © 2007 by The Endocrine Society

Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) as a Growth Hormone (GH)-Releasing Factor in Grass Carp: II. Solution Structure of a Brain-Specific PACAP by Nuclear Magnetic Resonance Spectroscopy and Functional Studies on GH Release and Gene Expression

Kong Hung Sze, Hong Zhou, Yinhua Yang, Mulan He, Yonghua Jiang and Anderson O. L. Wong

Departments of Zoology (H.Z., M.H., Y.J., A.O.L.W.) and Chemistry and Open Laboratory of Chemical Biology (K.H.S., Y.Y.), The University of Hong Kong, Hong Kong SAR, People’s Republic of China

Address all correspondence and requests for reprints to: Anderson O. L. Wong, Department of Zoology, The University of Hong Kong, Pokfulam Road, Hong Kong SAR, P.R. China. E-mail: olwong{at}hkucc.hku.hk.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Pituitary adenylate cyclase-activating polypeptide (PACAP) has been proposed to be the ancestral GHRH. Recently, using grass carp as a model for modern-day bony fish, we demonstrated that PACAP nerve fibers are present in close proximity to carp somatotrophs, and mammalian PACAPs can induce GH secretion in carp pituitary cells. To further examine the role of PACAP as a GH-releasing factor in fish, the structural identity of grass carp PACAP was established by molecular cloning. The newly cloned PACAP was found to be a single-copy gene and expressed in the brain but not other tissues. The mature peptides of PACAP, namely PACAP27 and PACAP38, were synthesized. As revealed by nuclear magnetic resonance spectroscopies, carp PACAP38 is composed of a flexible N terminal from His1 to Ile5, an extended central helix from Phe6 to Val26, and a short helical tail in the C terminal from Arg29 to Arg34. The C-terminal helix is located after a hinge region at Leu27 to Gly28 and is absent in the solution structures of PACAP27. The two forms of PACAPs were effective in elevating GH release and GH transcript expression in grass carp pituitary cells. These stimulatory effects occurred with parallel rises in cAMP and Ca2+ entry via voltage-sensitive Ca2+ channels in carp somatotrophs. The present study represents the first report for solution structures of nonmammalian PACAPs and provides evidence that a brain-specific isoform of PACAP in fish can stimulate GH synthesis and release at the pituitary level, presumably by activating the appropriate postreceptor signaling mechanisms.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PITUITARY ADENYLATE CYCLASE-activating polypeptide (PACAP), a member of the glucagon/secretin peptide family, was first isolated in ovine hypothalamus by its ability to stimulate adenylyl cyclase activity in rat pituitary cells (1). Two forms of PACAP, PACAP38 (1) and PACAP27 (2), have been identified. PACAP38 is a 38-amino acid (a.a.) neuropeptide with its N-terminal sequence highly homologous to vasoactive intestinal polypeptide (VIP), whereas PACAP27 is a truncated form of PACAP38 containing only the first 27 a.a. residues. In mammals, PACAP38 and PACAP27 are derived from the same precursor by posttranslational proteolysis and alternative {alpha}-amidation (3). The protein sequences of PACAP38 are identical in mammals and highly conserved compared with that reported in other vertebrate species, including the fish, amphibians, and birds (4). PACAP immunoreactivity, with PACAP38 as the predominant form, was first identified in the central nervous system (CNS) and later in peripheral tissues including the respiratory, genital-urinary, circulatory, and gastrointestinal systems (5). Consistent with its wide range of tissue distribution, PACAP is also involved in a variety of physiological functions. For examples, it can serve as a neurotransmitter (6) and neurotropic factor within the brain (7). At the peripheral level, PACAP is also known to regulate gut motility (8), airway dilation (9), vasoconstriction (10), immune responses (11), insulin secretion (12), steroid production (13), and adrenal functions (14).

Because PACAP is a pleiotropic neuropeptide with very diverse functions and clinical potentials, characterization of its three-dimensional (3-D) structure with the goal of designing nonpeptidergic mimics has been the focus of recent research (15). At present, two nuclear magnetic resonance (NMR) structures for PACAP27 (16, 17) and one for PACAP38 have been reported (17). In these studies, PACAP38 is composed of three domains with the N terminal (His1 to Asp8) forming a disordered structure followed by an extended central {alpha}-helix (Ser9 to Val26) with a break at Lys20 to Lys21 and a short helical tail (Leu29 to Arg34) in the C terminal. These structural domains have been proposed to form three anchorage sites for receptor recognition, and any two of the three can lead to high-affinity binding for the receptors (18). The 3-D conformation of PACAP27 largely mirrors that of PACAP38 except that the C-terminal tail is missing. Nevertheless, discrepancy has been noted in the NMR structures reported for PACAP27. Using 25% methanol as the solvent system, a type IIß turn was identified in PACAP27 from Ser9 to Arg12 (16), which is not supported by the results using 50% trifluoroethanol (17). When compared with a recent study on PACAP21, a C-terminal truncated form of PACAP27, further inconsistency in NMR structures can be found including: 1) a shortening of the N-terminal random structure from His1 to Ile5, 2) the presence of a ß-coil from Asp4 to Phe7, and 3) the absence of the structural discontinuity at Lys20 to Lys21 in the central {alpha}-helix (19). Given that NMR analysis is restricted to the single form of PACAP reported in mammals and the 3-D conformations of PACAP from other vertebrate classes are not available, comparative studies to examine the solution structures of PACAPs are still lacking. To our knowledge, the surface plots of PACAP27 and PACAP38 have not been published, and the surface properties in relationship to the 3-D molecular structures of the two PACAPs are unclear and remain to be determined.

In mammals, PACAP immunoreactivity can be detected in the hypothalamus (20) and hypophysial portal blood (21). Under certain conditions, PACAP can also elevate basal release of GH, prolactin, and gonadotropin, suggesting that PACAP can act at the pituitary level to serve as a hypophysiotropic factor (22). Although the GH-releasing effect of PACAP is relatively weak in mammalian models, the role of PACAP as a novel GH-releasing factor has received increasing attention, mainly due to the fact that 1) PACAP and GHRH are evolved from the same ancestral gene and 2) unlike mammals, in which PACAP and GHRH are encoded in separate genes, the two are encoded in the same gene in nonmammalian vertebrates (4). In lower vertebrates, in particular the bony fish, PACAP can act as a potent secretagogue for GH release, e.g. in rainbow trout (23), goldfish (24), European eel (25), and common carp (26). Because GHRH in general has a low efficacy or even no effects on GH secretion in amphibian and fish models, it has been postulated that PACAP may serve as the ancestral GHRH before the evolution of mammalian GHRH (27). In our recent studies in Chinese grass carp, we have shown that PACAP nerve fibers are present in close proximity to carp somatotrophs, and ovine PACAP38 can induce GH gene expression in carp pituitary cells via activation of the cAMP/protein kinase A- and Ca2+/calmodulin-dependent signaling pathways (28). These findings suggest that PACAP not only can trigger GH release in fish but also play a role in GH synthesis at the pituitary cell level. Given that mammalian PACAP was used in our previous study, it remains to be determined whether fish PACAP can also have similar effects on GH gene expression.

In this study, we sought to establish the structural identity of PACAP expressed in grass carp and examine its functional role in regulating GH release and GH gene expression at the pituitary level. Chinese grass carp was used as the animal model because it is a major commercial fish in Asian countries. Besides, the fish used in our experiments are prepubertal and represent the grow-out phase during the transition from juvenile to adult fish. The fish at this stage of development can provide us a unique opportunity to study the neuroendocrine mechanisms regulating body growth in maturing Cyprinids. Using 5'/3' rapid amplification of cDNA ends (RACE), a full-length cDNA of grass carp PACAP was obtained. The gene copy number and tissue expression pattern of this newly cloned PACAP were determined by Southern blot and RT-PCR, respectively. Based on the deduced a.a. sequences, carp PACAP27 and PACAP38 were synthesized. Their solution structures were characterized by circular dichroism (CD) and NMR spectroscopy, whereas their GH-releasing actions were tested in vitro in grass carp pituitary cells under column perifusion. In parallel experiments, the effects of PACAP on GH transcript expression were also investigated using a static incubation approach.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Animals
One-year-old Chinese grass carp (Ctenopharyngodon idellus) with body weight ranging from 1.5 to 2.0 kg was purchased from local markets. Because the grass carp at this stage was sexually immature and sexual dimorphism was not apparent, fish of mixed sexes were used for total RNA extraction and pituitary cell preparation. During the process, the fish were killed by anesthesia followed by spinosectomy according to the protocols approved by the Committee of Animal Use for Research and Teaching at the University of Hong Kong (Hong Kong).

Molecular cloning of grass carp PACAP
Total RNA was extracted from the brain of grass carp using TRIZOL (Life Technologies, Inc., Rockville, MD) and reverse transcribed using a SuperScript II first-strand cDNA synthesis kit (Invitrogen, San Diego, CA). Using primers designed based on the conserved regions of goldfish and zebrafish PACAPs, a 504-bp fragment of grass carp PACAP cDNA was pulled out by nested PCR using the brain reverse transcription (RT) sample as the template. Based on the nucleotide sequence obtained, gene-specific primers were designed and 5'/3' RACE was performed using a GeneRacer kit (Invitrogen). PCR products were gel purified and subcloned into the pGEM-T Easy vector (Promega, Madison, WI) for DNA sequencing using a BigDye cycle sequencing kit (Applied Biosystems, Forster City, CA). The full-length cDNA of grass carp PACAP was compiled from its 5' and 3' sequences and analyzed with MacDNASIS PRO (Hitachi, San Bruno, CA) and MacVector 6.5 programs (Oxford Molecular, Madison, WI). After that, phylogenetic trees for PACAP evolution were constructed by UPGMA, PHYLIP, and TreeView V.32 using the EMBnet/CNB Web site (www.es.embnet.org).

Peptide synthesis and CD spectroscopy
Grass carp PACAP38 and PACAP27 were synthesized at the HSC Biotechnology Service Center (University of Toronto, Toronto, Canada) using a Novasyn Crystal automated peptide synthesizer (Nova-Biochem Ltd., Nottingham, UK). Peptide synthesis was conducted on PAL-PEG-PS resin using the continuous-flow Fmoc-peptide chemistry. The purity of PACAP38 and PACAP27 was 93 and 96%, respectively, as revealed by reverse-phase HPLC, and the homogeneity of the purified peptides was further confirmed by atmospheric pressure ionization mass spectrometry. These two peptides were dissolved in trifluoroethanol (TFE)-H2O mixtures (0.4 mg/ml) with increasing ratio of TFE from 0 to 60%. CD spectra were collected at room temperature using a Jasco J-720 spectropolarimeter (Jasco, Tokyo, Japan). The data were recorded with a scanning speed of 50 nm/min at wavelength from 190 to 250 nm (with steps of 0.2 nm). In these experiments, the reference spectrum of the respective solvent was also monitored to serve as the background and the data were then subtracted from the corresponding CD spectrum. After that, the CD data were used to estimate the levels of secondary structure elements by deconvolution analysis using the CD-Pro software (http://lamar.colostate.edu/~sreeram/CDPro).

NMR spectroscopy and structure calculations
Samples of grass carp PACAP38 (3.5 mg) and PACAP27 (2.5 mg) were dissolved in 50% TFE (vol/vol) prepared by mixing 0.3 ml H2O and 0.3 ml TFE-d2. One- and two-dimensional (2-D) NMR experiments, including total correlation spectroscopy (TOCSY), double-quantum filtered-correlation spectroscopy (DQF-COSY), and nuclear Overhauser effect spectroscopy (NOESY), were conducted in a Bruker Avance-600 NMR spectrometer (Bruker Biospin, Rheinstetten, Germany) using a dedicated 5-mm TXI probe with XYZ gradient. The mixing time for TOCSY study was 70 msec and that for NOESY measurements were 150 and 250 msec for PACAP27 and 50, 100, 150, and 250 msec for PACAP38, respectively. In these experiments, sodium [3-trimethylsilyl 2,2,3,3, 2H] propionate was used as an internal reference. Data processing was conducted with MestReC software (Mestrelab, A Coruna, Spain), whereas the graphical assignment and integration of cross-peaks were performed using SPARKY 3.110 (http://www.cgl.ucsf.edu/home/sparky). The 2-D data matrix was multiplied by a square-sine-bell window function and zero-filled to a 4 K x 2 K complex matrix before Fourier transformation (with baseline correction in both dimensions). The spin systems for PACAP27 and PACAP38 were assigned based on DQF-COSY and TOCSY spectra, and the sequential connectivity between cross-peaks was established using NOESY spectra according to standard procedures. To minimize human bias, interproton distance restraints were derived from NOESY cross-peaks with mixing times of 150 and 250 msec using the automated nuclear Overhauser effect (NOE) assignment strategy. Briefly, the data for NOE intensities and chemical shifts were extracted with SPARKY 3.110 and analyzed with CYANA 2.0 (http://www.las.jp/prod/cyana) for NOE assignment, distance calibration, removal of covalently fixed distance restraints, and calculation of torsion angle dynamics for solution structure modeling. Seven cycles of iterative NOE assignment and structural calculation were conducted and more than 90% of the input NOE data were assigned successfully. After that, a manual check of all NOE assignments was carried out before the final structure calculations. The 3-D models and surface plots of PACAP molecules were then constructed using the MOLMOL graphics program (http://hugin.ethz.ch/wuthrich/software/molmol).

Tissue distribution of PACAP expression
Tissue distribution of PACAP expression was examined using RT-PCR. Briefly, total RNA was isolated from the brain, pituitary, gills, heart, kidney, liver, intestine, muscle, and spleen using TRIZOL (Life Technologies). To establish the expression pattern of PACAP in the brain, total RNA was also prepared from various brain areas, including the olfactory bulbs, telencephalon, optic tectum, hypothalamus, cerebellum, medulla oblongata, and spinal cord. These RNA samples were digested with RNase-free DNase I (Invitrogen) and reverse transcribed using SuperScript II (Life Technologies). The RT samples obtained were used as the template for PCR using primers (GAAACTCGTTAA GCGACCTGGC and TTTAAAGAACACAGGCGCGA) specific for grass carp PACAP mRNA. PCR products were resolved in 1% agarose gel and transblotted onto a positively charged nylon membrane. Southern blot was then conducted to check for the authenticity of PCR products using a digoxigenin (DIG)-labeled cDNA probe for grass carp PACAP. In these studies, RT-PCR of ß-actin mRNA was used as an internal control.

Southern blot of genomic DNA
Genomic DNA was isolated from the whole blood of grass carp as described previously (29). The DNA sample obtained was subjected to overnight digestion at 37 C with HindIII alone or in combination with BglI, ClaI, StyI, or EcoRV, respectively. On the following day, the digested products were size fractionated in a 0.7% gel and vacuum blotted onto a positively charged nylon membrane for hybridization with a DIG-labeled cDNA probe for carp PACAP. Hybridization signals were then monitored using a DIG chemiluminescent detection kit (Roche, Mannheim, Germany) according to the standard procedures in our laboratory (30).

Column perfusion of grass carp pituitary cells
Primary cultures of grass carp pituitary cells were prepared by trypsin/DNase digestion method and cultured on preswollen Cytodex 2 beads (Pharmacia Biotech, Uppsala, Sweden) as described previously (28). After 15 h incubation, Cytodex beads with pituitary cells attached were loaded into 0.5-ml microcolumns (3 x 106 cells/column) and perifused with prewarmed carp MEM (26) with 0.1% BSA at a flow rate of 15 ml/h using an ACUSYST-S perifusion system (Endotronics Inc., Minneapolis, MN). A 10-min pulse of PACAP or GHRH-like peptide (LP) treatment was administered via a three-way stopcock. Perifusate samples were collected in 5-min fractions and their GH contents were measured using a RIA previously validated for carp GH (31).

Measurement of GH mRNA expression
Static incubation of grass carp pituitary cells were used to examine the effects of PACAP38 and PACAP27 on GH mRNA expression. In this case, pituitary cells were seeded at a density of approximately 2.5 x 106 cells/well in 24-well clustered plates. After overnight incubation, the cells were challenged with increasing doses of test substances for 48 h. Total RNA was then extracted from individual wells and GH mRNA level was quantified using a slot blot assay as described previously (32). In these experiments, parallel slot blots for 18S RNA were also performed to serve as an internal control.

Measurement of cAMP production
Carp somatotrophs (86–91% pure) were enriched from mixed populations of pituitary cells by Percoll gradient centrifugation (28). After washing two times to remove Percoll, somatotrophs were resuspended in carp MEM with 5% fetal bovine serum and seeded in 35-mm dishes at a density of approximately 2 x 106 cells/dish. After 15 h incubation, culture medium was replaced with 0.9 ml HEPES-buffered Hanks’ balanced salt solution with 0.1% BSA medium (34) containing 0.1 mM 3-isobutyl-1-methylxanthine (Sigma, St. Louis, MO). 3-Isobutyl-1-methylxanthine, an inhibitor for phosphodiesterase, was used routinely to prevent cAMP degradation in cell cultures. In these experiments, drug treatment was initiated by adding 0.1 ml 10x stock solutions of PACAP27 and PACAP38 at appropriate concentrations. After 15 min incubation, medium was harvested for the measurement of cAMP release and cellular cAMP was extracted with 1 ml ice-cold absolute ethanol. These cAMP samples were freeze dried and stored at –20 C until their cAMP contents were assayed using a Bio-Trak [125I]cAMP RIA kit (Amersham, Piscataway, NJ). Total cAMP production was defined as the sum of cellular cAMP content and the amount of cAMP released into the culture medium.

Measurement of intracellular Ca2+ levels
Carp somatotrophs were preloaded with Indo-I/AM (10 µM; Molecular Probes, Eugene, OR) in Hanks’ buffer saline medium (26) with 0.1% BSA for 30 min at 28 C. After dye loading, the cells were resuspended at a density of approximately 1.5 x 106 cells/ml in BSA-free Hanks’ buffer saline in a thermostated quartz cuvette, and fluorescence signals for intracellular free calcium concentration ([Ca2+]i) were measured by a F4500 fluorescence spectrophotometer (Hitachi, Indianapolis, IN). Wavelengths for excitation and emission were fixed at 329 nm (5 nm slit width) and 405 nm (10 nm slit width), respectively. In these experiments, [Ca2+]i concentrations were calibrated using the cell lysis method as described previously (35). For single-cell Ca2+ imaging, carp somatotrophs were cultured on poly-D-lysine-coated coverslips (1.5 cm diameter) at a density of approximately 5 x 105 cells/ml and preloaded with fura-2/AM (5 µM; Molecular Probes) for 60 min at room temperature. After dye loading, ratiometric measurement of [Ca2+]i signals was conducted with a PTI Epifluorescence Ca2+ imaging system (Photon Technology International, Birmingham, NJ) with excitation at 340 and 380 nm and emission at 510 nm, respectively. Images were captured and analyzed using the ImageMaster software (Photon Technology International). Because variations in fluorescence intensity were noted between different batches of cell preparation, Ca2+ calibration was not performed and the Ca2+ data were simply expressed as a ratio of the fluorescence signals with excitation at 340 and 380 nm, respectively.

Data transformation and statistics
For perifusion studies, GH data from individual columns were expressed as a percentage of the average GH contents in the first six fractions collected at the beginning of the experiment before drug treatment (as percent basal). This transformation was conducted to allow for pooling of data from separate columns without distorting the profile of GH release during the course of perifusion. GH responses were quantified by calculating the net change of GH release after the drug treatment (i.e. a net change in the area under the curve). In the case of slot blot experiments, GH mRNA was measured in terms of arbitrary density unit and normalized against the amount of 18S RNA in the same sample. To allow for pooling of data from different cells, the raw data for single-cell Ca2+ imaging (in fluorescence ratio at 340 and 380 nm) were transformed into fold increase of the mean value of basal Ca2+ levels averaged over the first 20 sec before drug treatment (as fold basal). Data presented were analyzed using Student’s t test or ANOVA followed by Fisher’s least significance difference test. Differences were considered significant at P < 0.05.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Molecular cloning and sequence analysis of grass carp PACAP
Using nested PCR coupled to 5'-3' RACE, a full-length cDNA for PACAP was cloned from the RT sample prepared from the brain of 1-yr-old grass carp (Fig. 1AGo). The newly cloned cDNA is 984 bp in size with a 173-bp 5' untranslated region (UTR), 528-bp open reading frame, and 283-bp 3'UTR encoding a 175-a.a. preprohormone. A short stretch of (CT)n repeats can be identified in the 5'UTR, whereas two putative polyadenylation signals are noted in the 3'UTR. The PACAP preprohormone (prepro-PACAP) can be divided into four structural domains, including the 24-a.a. signal peptide, 54-a.a. cryptic peptide, 45-a.a. GHRH-LP, and 38-a.a. PACAP38. The mature peptide of GHRH-LP is flanked by an upstream monobasic (Thr-Glu-Arg) and downstream dibasic enzyme-processing site (Lys-Arg). The coding sequence of PACAP38 is located after the dibasic processing site of GHRH-LP, and two additional dibasic processing sites preceded by a glycine residue (Gly-Arg-Arg) can be found within and at the end of the mature peptide of PACAP38. Cleavage at these sites is expected to generate the mature peptides of GHRH-LP, PACAP27, and PACAP38, respectively. During the process of 5'/3' RACE, a truncated form of PACAP cDNA with the sequence from position 413 to 517 deleted was also obtained (Fig. 1BGo). The missing sequence covers the majority (32 a.a.) of the coding sequence for GHRH-LP, which is equivalent to exon IV of PACAP genes reported in other species, including the salmon (23) and zebrafish (36).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
FIG. 1. A, Nucleotide and deduced a.a. sequences of grass carp PACAP cDNA. The four structural domains of prepro-PACAP, namely the signal peptide (underlined by dotted line), cryptic peptide (underlined by solid line), GHRH-LP (black font on gray background), and PACAP38 (white font on dark gray background), were mapped by sequence alignment with PACAP cDNAs reported in other species. The (CT)n repeats in 5'UTR were marked by dotted underline in italic. The monobasic and dibasic enzyme processing sites were labeled with small triangles. The polyadenylation signals (AACAAA) in 3'UTR were underlined in italic, and the stop codon located at the end of the coding sequence was marked by an asterisk. B, Structural organization of the coding sequences in two forms of PACAP transcripts. The structural domains of prepro-PACAP encoded by full-length and truncated form of PACAP mRNA were boxed for identification. SP, Signal peptide; Cryptic Pep, cryptic peptide; PACAP, PACAP38. The deleted region (413–517) in the truncated form (indicated by double underline in the nucleotide sequence) encodes a 32-a.a. fragment in GHRH-LP and is equivalent to exon IV of PACAP genes reported in fish models.

 
Sequence alignment of the structural domains of grass carp prepro-PACAP (Fig. 2Go) has revealed that they are highly homologous if not identical with that of goldfish (sequence homology: 96–100%). When compared with the corresponding domains in representative species of tetrapods, the cryptic peptide is more variable (24–46%), whereas a moderate level of sequence homology can be noted in the signal peptide (29–75%) and GHRH-LP (36–67%). Unlike GHRH-LP, the protein sequence of PACAP38 is highly conserved (87–92%) and most of the a.a. substitutions observed in the C-terminal are conserved mutations (e.g. with Arg for Lys and Ile for Val). Because PACAP and VIP are evolved from the same ancestral gene (36) and both of them can trigger similar physiological functions via common receptors (5), phylogenetic analysis of grass carp PACAP was performed to study its evolutionary relationship with PACAPs and VIPs reported in other vertebrates. Based on rooted analysis using the UPGMA algorithm, the a.a. sequence of grass carp PACAP was found to be closely related to that of other fish species, moderately related to PACAPs in tetrapods, but distally related to VIPs in other vertebrates (data not shown). Using unrooted analysis based on PHYLIP and TreeView programs, the nucleotide sequence of grass carp PACAP could be grouped within the clade of fish PACAP, especially in the branch of cyprinids including the goldfish and zebrafish (Fig. 3AGo). In this study, the gene copy number of PACAP was also examined in the grass carp by Southern blot. As revealed by the hybridization signals using a DIG-labeled cDNA probe for carp PACAP, a single band was consistently observed in grass carp genomic DNA after digestion with HindIII alone or in combination with BglI, ClaI, EcoRV, or StyI, respectively (Fig. 3BGo). These results indicate that the newly cloned PACAP is a single copy gene in the grass carp genome.


Figure 2
View larger version (43K):
[in this window]
[in a new window]

 
FIG. 2. Sequence comparison of different structural domains of PACAP preprohormone. The signal peptide (A), cryptic peptide (B), GHRH-LP (C), and PACAP38 (D) of grass carp prepro-PACAP were aligned with the corresponding sequences reported in other vertebrates. Sequence alignment was conducted using Clustal W with MacVector version 6.5.3. Sequences with identical a.a. residues across the species were boxed, whereas the conserved mutations were marked by shading. The a.a. sequences of prepro-PACAPs from representative species of different vertebrate classes were downloaded from the GenBank (http://www.ncbi.nih.gov).

 

Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
FIG. 3. Phylogenetic analysis and Southern blot of grass carp PACAP. A, Unrooted analysis based on the nucleotide sequences of PACAP cDNAs was performed using PHYLIP and TreeView v. 3.2.1 programs. The guide tree was constructed using the neighbor-joining method after 1000 bootstraps (bootstrap value: 978–1000). The scale bar on the right represents the genetic distance of 0.1 nucleotide substitutions per site. B, Southern blot to study the gene copy number of PACAP in the carp genome. Grass carp genomic DNA was digested with HindIII alone or in combination with StyI, EcorV, ClaI, or BlgI. After size fractionation, positive signals for PACAP gene were detected by hybridization using a DIG-labeled probe for grass carp PACAP.

 
Tissue distribution of PACAP expression
To examine the pattern of tissue expression of PACAP in the grass carp, semiquantitative PCR was performed using RT samples prepared from selected tissues, including the brain, pituitary, gill, heart, kidney, liver, muscle, spleen, and intestine. As a part of the validation, PCR amplification profiles were examined with respect to the cycle number using the RT sample prepared from the hypothalamus as a template. The hypothalamus was chosen because it is known to be the tissue with the highest level of PACAP expression in mammals (5). Using primers specific for carp PACAP, two PCR products of 308 and 504 bp in size were consistently obtained. After DNA sequencing, the 504-bp product was confirmed to be the nucleotide sequence from position 307 to 810 of grass carp PACAP cDNA, whereas the 308-bp product was found to be the truncated form of the same region lacking the 105-bp coding sequence for GHRH-LP (position 413–517). Detectable rises in 308- and 504-bp PCR products were noted at cycle number 20 and reached their peaks at cycle number 28. Therefore, the cycle number for semiquantitative PCR was fixed at 24 cycles because it is in the midrange of the log-linear phase of PCR amplification (data not shown). Using RT samples prepared from various tissues, PCR signals for the two forms of PACAP mRNA could be detected only in the brain but not other tissues, including the gills, heart, liver, kidney, gut, muscle, pituitary, and spleen (Fig. 4AGo). Given that the 282-bp PCR product for ß-actin mRNA was observed in all the tissues examined, the lack of PCR products for PACAP caused by RNA degradation was unlikely. To further examine the pattern of PACAP expression within the CNS, RT-PCR was also conducted in different brain areas of the grass carp (Fig. 4BGo). In this case, the two forms of PACAP mRNA were shown to express at high levels in the telencephalon; to a lesser extent in the hypothalamus, cerebellum, and medulla oblongata; and to a low level in olfactory bulbs and optic tectum. PACAP transcripts, however, could not be detected in the pituitary and spinal cord.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

 
FIG. 4. Expression pattern of PACAP transcripts by RT-PCR. A, Tissue distribution of PACAP mRNA expression. RT-PCR of PACAP was performed in RNA samples prepared from the brain, pituitary, gill, heart, kidney, liver, muscle, spleen, and intestine. B, Brain distribution of PACAP mRNA expression. RT-PCR was conducted in RNA samples isolated from brain areas including the olfactory bulbs, telencephalon, hypothalamus, cerebellum, optic tectum, medulla oblongata, and spinal cord. In these studies, PCR products were size fractionated in 1% agarose gel and visualized by ethidium bromide staining. The authenticity of PCR products was confirmed by Southern blot using a DIG-labeled probe for grass carp PACAP. RT-PCR of ß-actin mRNA was also conducted to serve as an internal control.

 
Solution structures of grass carp PACAP
As a first step to study the solution structures of PACAP in fish model, grass carp PACAP38 and PACAP27 were synthesized, and the global secondary structures were evaluated using far-UV CD spectroscopy. By increasing TFE levels from 0 to 60% in aqueous solutions of PACAP27 (Fig. 5AGo) and PACAP38 (Fig. 5BGo), the shape of the CD spectra exhibited increasingly characteristics of {alpha}-helical structure as indicated by two negative ellipticity minima at 208 and 222 nm, respectively. Deconvolution analysis revealed that {alpha}-helical contents in grass carp PACAPs more or less reached a steady state at 50% TFE-H20. Under this condition, the structure content of {alpha}-helix in PACAP27 and PACAP38 was approximately 86% and 68%, respectively (Fig. 5CGo), equivalent to an average of 24-a.a. residues involved in the formation of {alpha}-helical structures. Although the deconvolution analysis indicated that some ß-sheet conformations were apparent in aqueous solution with 0% TFE, the ß-sheet contents in grass carp PACAPs were reduced to very low or negligible levels with increasing percentage of TFE. These results suggest that ß-sheet is not a stable structure of these peptides in a hydrophobic environment, which probably reflects the dynamic nature of the system.


Figure 5
View larger version (13K):
[in this window]
[in a new window]

 
FIG. 5. Global analysis of secondary structure elements in grass carp PACAP27 and PACAP38 by CD spectroscopy. The CD spectra of grass carp PACAP27 (A) and PACAP38 (B) were measured in aqueous solution with increasing levels of TFE according to the conditions described in Materials and Methods. Using deconvolution analysis, the relative contents of secondary structure elements were also deduced for the two forms of PACAPs (C). MRE, Mean residue ellipticity.

 
Based on the results of CD analysis, 1H NMR spectroscopies were routinely performed at a solvent condition of 50% TFE-d2/H2O. Complete a.a. spin systems for PACAPs were identified by 2-D DQF-COSY and TOCSY (for through-bond correlations) starting from the well-resolved amide protons in the region from 7.5 to 8.8 ppm. The spin systems in TOCSY spectrum were further confirmed by inspection of the cross-peaks to high field corresponding to side chain connectivities (Fig. 6AGo). Sequence-specific assignments of the a.a. spin systems were determined by NOESY experiments (for through-space correlations). The fingerprint region of the 2-D NOESY spectrum for PACAP27 showing the dNN connectivities is presented in Fig. 6BGo and the NOE assignment and chemical shift data for PACAP27 and PACAP38 are summarized in Table 1GoGo, A and B, respectively. The chemical shift data of the first 27 a.a. in PACAP38 are highly comparable with that of PACAP27, implying that PACAP27 and PACAP38 have nearly identical conformations in the same region. The exception is that there is an upfield shift by approximately 0.26 ppm in the C{alpha}H proton of Val26, which may be caused by a tighter helix formation at this position in PACAP38. With the available data, secondary structure elements in carp PACAPs can be delineated by NOE connectivities and 1H{alpha} chemical shift index. In this case, the deviations of chemical shift index ({delta}C{alpha}H) were deduced using the equation {Delta}{delta}C{alpha}H = {delta}C{alpha}H (observed) {delta}C{alpha}H (random coil) as described previously (37). As revealed by the chemical shift index plots (Fig. 7Go, A and B), the negative values of {Delta}{delta}C{alpha}H data for PACAP27 from Phe-6 to Val-26 indicate that an extended {alpha}-helix can be found in this region. This idea is in agreement with the patterns of NOE connectivities, especially for the medium-range NOEs of H{alpha} of residue (i) and HN and Hß of residues (i + 3). Similar results were obtained for the corresponding region in PACAP38 except that an additional helix was noted from Arg29 to Arg34. Given that the cross peak signals for N{alpha}Hi-N{alpha}Hi+1 connectivities were weak or even absent in the N terminal from His1 to Ile5, there is no evidence to support the presence of secondary structure elements in this region for the two peptides.


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
FIG. 6. Identification of a.a. spin systems in grass carp PACAP by TOCSY and NOESY experiments. A, Fingerprint region showing the C{alpha}H-N{alpha}H 1H NMR cross-peaks of the 2-D TOCSY spectrum of grass carp PACAP27 (mixing time: 70 msec). B, NH-NH region showing the N{alpha}Hi-N{alpha}Hi+1 1H NMR cross-peaks of the 2-D NOESY spectrum of PACAP27 (mixing time: 150 msec). The sequential dNN connectivities and assignments are suggestive of {alpha}-helical character. In this study, the TOCSY and NOESY experiments were conducted in 1:1 (vol/vol) TFE-d2/H2O at pH 3.1 and 300 K.

 

View this table:
[in this window]
[in a new window]

 
TABLE 1A. 1H assignment and chemical shift data for PACAP27 in aqueous 50% TFE (pH 3.1) at 300 K

 

View this table:
[in this window]
[in a new window]

 
TABLE 1B. 1H assignment and chemical shift data for PACAP38 in aqueous 50% TFE (pH 4.0) at 300 K

 

Figure 7
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 7. Delineation of the {alpha}-helical structures in PACAP27 and PACAP38. NOE connectivities and H{alpha} shift differences were deduced for grass carp PACAP27 (A) and PACAP38 (B), respectively. The regions of the peptides with {alpha}-helical structures deduced by quantitative NOE, and chemical shift data were marked by helical coils along the primary sequences of PACAP27 and PACAP38.

 
Based on the measured NOE cross-peak intensities, proton-proton distance constraints at the atomic level were deduced and used to establish the 3-D structures of grass carp PACAPs using restrained molecular dynamics calculations. The solution structures of PACAP27 and PACAP38 are presented in Fig. 8Go, whereas the results of structure calculation are listed in Table 2Go. Using CYANA 2.0 program, 1280 and 1654 NOESY cross-peaks were analyzed for PACAP27 and PACAP38 to generate a total of 325 and 451 nonredundant upper-limit distance constraints, respectively. Of 100 distance geometry structures calculated for individual peptides, the best 20 structures with the lowest target function, distance constraint violation less than 0.2 Å, and angle constraint violation less than 5° were subjected to final molecular dynamics refinement. The backbone traces of the resulting 20 energy-minimized NMR structures for each peptide were generated and superimposed over their respective helical regions. The backbone root mean square deviation of the ensemble of structures based on the well-defined regions for PACAP27 (Phe6 to Val26) and PACAP38 (Asp8 to Arg34) was found to be 0.52 and 0.51 Å, respectively. The quality of the 20 energy-minimized structures was further evaluated by Ramachandran analysis. In this case, the backbone dihedral angles for PACAP27 and PACAP38 are well within spatial limits, including the most favored regions (81.5 and 76.8%, respectively) and additional allowed regions (18.3 and 23.1%, respectively), and none of them is in the disallowed regions. The final ensembles of NMR structures have confirmed that the N terminal of PACAP27 from His1 to Ile5 is composed of random structures, which is followed by an extended {alpha}-helical region from Phe6 to Val26 with a short C-terminal tail at Leu27 (Fig. 8AGo). However, there is no evidence of a structural discontinuity at Lys20 to Lys21 in the N terminal {alpha}-helix as reported in mammalian PACAP (17). The conformation of the first 26 a.a. residues of PACAP38 is highly comparable with that of PACAP27 (Fig. 8Go, B and D), except that an additional helix from Arg29 to Arg34 can be found after the hinge region from Leu27 to Gly28 (Fig. 8CGo). Furthermore, the flexible structures from His1 to Ile5 of PACAP38 tend to be more clustered in the final ensemble of NMR models and superposition of the average structures of the two PACAPs also reveals that a ß-coil can be formed in the N terminal of PACAP38 (Fig. 8EGo).


Figure 8
View larger version (22K):
[in this window]
[in a new window]

 
FIG. 8. Stereoview superpositions of the final restrained structures of grass carp PACAP27 (A) and PACAP38 (B). Ribbon plots of the average structures for the two peptides were also constructed and shown in the right panels. For structural comparison between PACAP27 and PACAP38, the restrained structures of Gly28 to Leu38 (C) and His1 to Leu27 (D) in carp PACAP38 were aligned separately to reveal the {alpha}-helixes from Arg29 to Arg34 and Phe6 to Val27, respectively. The ribbon plots of the two peptides were also superimposed to reveal the ß-coil (square bracket) located in the N terminal of PACAP38 (green), which is absent in PACAP27 (red).

 

View this table:
[in this window]
[in a new window]

 
TABLE 2. Structure calculation statistics

 
To further examine the structural properties of the solvent-exposed residues of the two PACAPs, surface plots were constructed based on the average structures of PACAP27 and PACAP38. For PACAP27, the N-terminal region is more extended with negatively charged Asp3 and Asp8 located in the opposite side of the PACAP molecule (Fig. 9AGo). The extended {alpha}-helix, however, exhibits an amphipathic character with the basic residues clustered mainly on one side of the helix (front view) whereas the hydrophobic residues forming a loose core on the other side (back view). In the case of PACAP38, the overall charge distribution of the central helix from Phe6 to Val26 is comparable with that of PACAP27 (Fig. 9BGo). The C-terminal {alpha}-helix from Arg29 to Arg34 is highly basic and aligns in the same plane with respect to the central helical core. The close proximity/spatial overlap of the side chains of Arg12 and Gln16 with Lys38 leads to the formation of a ring-like structure with basic residues located on one side (front view) and a loose core of hydrophobicity on the other (back view). To our knowledge, this ring-like structure has not been previously reported in mammalian PACAPs. In contrast to the extended structure of the N terminal in PACAP27, a ß-coil is noted in the corresponding region of PACAP38. This ß-coil structure is comparable with that reported in the same region of mammalian PACAP21 upon receptor binding (19), which is formed by two consecutive ß-turns, including a type I ß-turn from Gly4 to Thr7 and a type II' ß-turn from Asp3 to Phe6. As a result, a negatively charged hydrophilic pocket is formed by clustering of Asp3 and Asp8, whereas a hydrophobic patch composed of Ile5 and Phe6, together with Try10 of the central helix is also generated on the opposite side of the PACAP38 molecule (Fig. 9CGo). These amphipathic structures, however, are not observed in the surface plot of PACAP27.


Figure 9
View larger version (45K):
[in this window]
[in a new window]

 
FIG. 9. Surface plots for grass carp PACAP27 and PACAP38. Both the front (upper panels) and back views (lower panels) of the stereo models for PACAP27 (A) and PACAP38 (B) are presented, with red color for acidic residues (negatively charged), blue color for basic residues (positively charged), and white color for neutral residues (hydrophobic). For spatial reference of individual a.a. residues, heavy atom plots for PACAP27 and PACAP38 were also constructed (light blue models with numbers indicating the position of the corresponding a.a. residues). To illustrate the unique features of PACAP38, the plane with the C terminal (Gly28 to Leu38) and central {alpha}-helixes (Phe6 to Val27) arranged into a ring-like structure was selected to be the front view and rotated by 90° to highlight the amphipathic nature of the N-terminal ß-coil (C). In these models, the basic residues are located largely on one side of the helical structures of the two PACAPs. In PACAP27, and the acidic residues Asp3 and Asp8 are located on the opposite surface of the extended N terminal (as indicated by arrows). The corresponding residues in PACAP38, however, are clustered together in the ß-coil structure to form a hydrophilic pocket with the production of a hydrophobic patch on the other side (square bracket).

 
PACAP stimulation of GH release and GH mRNA expression
To test whether the newly cloned PACAP cDNA indeed encodes functional proteins, the direct actions of grass carp PACAP38 and PACAP27 on GH secretion were examined in vitro in primary cultures of grass carp pituitary cells. Using a perifusion approach, increasing levels of grass carp PACAP38 (Fig. 10AGo) and PACAP27 (Fig. 10BGo) were both effective in inducing GH release from carp pituitary cells in a dose-dependent manner. These GH-releasing effects were rapid, and in general, the peak responses occurred within 10–20 min after the initiation of drug treatment. For most of the cases, GH secretion returned to basal levels within 30–40 min after PACAP stimulation. In these experiments, the minimal effective dose tested for PACAP27 (10 nM) to initiate a significant rise in basal GH secretion was found to be 10-fold higher than that of PACAP38 (1 nM). Furthermore, the magnitude of GH responses triggered by the same dose of PACAP was consistently higher in the case of PACAP38. In the same study, parallel treatment with increasing doses of grass carp GHRH-LP did not modify basal levels of GH secretion in grass carp pituitary cells (Fig. 10CGo).


Figure 10
View larger version (24K):
[in this window]
[in a new window]

 
FIG. 10. Effects of grass carp PACAP27, PACAP38, and GHRH-LP on GH release from perifused grass carp pituitary cells. Increasing doses (1-1000 nM) of grass carp PACAP38 (A), PACAP27 (B), and GHRH-LP (C) were administered as 10-min pulses (as indicated by the vertical bars). The kinetic profiles of GH release during the experiments are presented in the left panels, whereas the quantitated GH responses (calculated as a net change of area under the curve) are presented in the bar graphs on the right. GH data (mean ± SEM, n = 6) are pooled results from six experiments. Treatment groups with similar levels of GH responses are denoted by the same letter (ANOVA followed by Fisher’s least significance difference test, P > 0.05), whereas an asterisk represents a significant difference, compared with basal GH secretion (Student’s t test, P < 0.05).

 
In this study, the effects of grass carp PACAPs on GH gene expression were also examined at the pituitary cell level using a static incubation approach. A 48-h incubation with increasing doses of grass carp PACAP38 (Fig. 11AGo) and PACAP27 (Fig. 11BGo) were both effective in elevating GH mRNA levels in carp pituitary cells. Again, the minimal effective dose of PACAP38 (0.1 nM) to induce GH mRNA expression was found to be lower than that of PACAP27 (1 nM), and the GH mRNA responses induced by various doses of PACAP38 were always larger than that of PACAP27. In these experiments, forskolin was used as a positive control and activation of cAMP production by forskolin (5 µM) served as a potent stimulant for GH mRNA expression (100.0 ± 9.2% for the control vs. 286.8 ± 33.4% for forskolin-treated group, P < 0.05). Similar treatment with GHRH-LP (1 µM), however, had no effects on basal expression of GH transcripts (100.0 ± 12.2% for the control vs. 117.1 ± 14.6% for GHRH-LP-treated group, P > 0.05).


Figure 11
View larger version (15K):
[in this window]
[in a new window]

 
FIG. 11. Effects of grass carp PACAP38 (A) and PACAP27 (B) on GH mRNA expression in grass carp pituitary cells. Static incubation of carp pituitary cells was conducted for 48 h with increasing concentrations (0.1–1000 nM) of grass carp PACAP27 and PACAP38. After that, GH mRNA levels were determined by the slot blot assay described in Materials and Methods. In these studies, parallel blotting of 18S RNA was used as an internal control. Data presented (mean ± SEM, n = 4) are pooled results from four separate experiments. Treatment groups with similar levels of GH mRNA expression are denoted by the same letter (P > 0.05).

 
PACAP stimulation of cAMP production and [Ca2+]i levels
Using mammalian PACAP38, we have previously shown that PACAP can trigger GH release and GH gene expression in grass carp pituitary cells via activation of cAMP- and Ca2+-dependent cascades (28). To confirm that grass carp PACAPs can also functionally couple to the respective signaling pathways, measurements of cAMP production and [Ca2+]i were performed in enriched somatotrophs prepared from mixed populations of grass carp pituitary cells. In this case, grass carp PACAP38 and PACAP27 were both effective in elevating cAMP production (Fig. 12Go, A and B) and [Ca2+]i levels (Fig. 12Go, C and D). The Ca2+ responses induced by PACAPs could be blocked by the L-type voltage-sensitive Ca2+ channel (VSCC) inhibitor nifedipine, suggesting that the rise in [Ca2+]i was the result of extracellular Ca2+ entry through the VSCC. This idea is consistent with the results of our parallel experiments, in which the Ca2+ responses triggered by grass carp PACAPs (1 µM) could be abolished by removing extracellular Ca2+ using 4 mM EGTA (data not shown). In the dose-response studies for cAMP production, the stimulatory effects of PACAP were mimicked by the adenylate cyclase activator forskolin. When compared with PACAP27, PACAP38 could induce cAMP production at a lower dose (minimal effective dose: 0.1 nM for PACAP38 vs. 1 nM for PACAP27) with greater responses (maximal cAMP response: 4.9 ± 0.3 pmol/106 cells for PACAP38 vs. 3.3 ± 0.2 pmol/106 cells for PACAP27, P < 0.05).


Figure 12
View larger version (26K):
[in this window]
[in a new window]

 
FIG. 12. Effects of grass carp PACAPs on cAMP production and [Ca2+]i levels in carp somatotrophs. For cAMP measurement, carp somatotrophs were incubated for 15 min with increasing concentrations (0.01–1000 nM) of grass carp PACAP38 (A) and PACAP27 (B). cAMP production was defined as the sum of cellular cAMP content and cAMP released into the culture medium. Parallel treatment with forskolin (1 µM) was used as a positive control, and the groups with similar levels of cAMP responses are denoted by the same letter (P > 0.05). For [Ca2+]i measurement, somatotrophs were preloaded with the Ca2+-sensitive dye Indo-I and challenged with grass carp PACAP38 (1 µM, C) and PACAP27 (1 µM, D), respectively. To check for the possible involvement of voltage-sensitive Ca2+ channels, nifedipine (10 µM) was added after PACAP treatment. In these experiments, the solvent for PACAPs and nifedipine was used as a negative control.

 
Because [Ca2+]i measurement in cell suspension using fluorescence spectrophotometry is not ideal for quantitative analysis, single-cell Ca2+ imaging was also performed in carp somatotrophs using epiflourescence microscropy. In this case, somatotrophs cultured on coverslips were exposed to increasing doses of grass carp PACAP38 (Fig. 13AGo) and PACAP27 (Fig. 13BGo). Stimulation with two forms of PACAPs were both effective in triggering a concentration-dependent increase in [Ca2+]i. At high doses of PACAP stimulation (e.g. at 1 µM concentration), intense signals of Ca2+ rise were first detected in the sublaminal region underneath the plasma membrane and spread to the interior of individual somatotrophs (small insets). Similar to the cAMP responses, PACAP38 was capable of inducing Ca2+ rise at a lower dose (1 nM) when compared with that of PACAP27 (100 nM). In general, the Ca2+ responses to PACAP38 were found to be higher than that triggered by the same dose of PACAP27 (Fig. 13CGo).


Figure 13
View larger version (23K):
[in this window]
[in a new window]

 
FIG. 13. Dose dependence of PACAP-induced [Ca2+]i responses in carp somatotrophs. Single-cell Ca2+ imaging was performed in carp somatotrophs preloaded with the Ca2+-sensitive dyefura-2. The cells were exposed to increasing concentrations (0.1 nM to 1 µM) of grass carp PACAP38 (A) and PACAP27 (B) as indicated by the yellow shading. Representative Ca2+ images captured at the time points (red bars) before (a) and after (b) the introduction of a 1 µM dose of PACAP are also included (insets). In these cases, Ca2+ signals were first detected in the sublaminal area underneath the plasma membrane and spread to the interior of carp somatotrophs. Dose-response curves for these Ca2+ responses (C) were then constructed based on the maximal [Ca2+]i responses detected for individual cells on exposure to different doses of PACAP27 and PACAP38. Data are presented are the mean values of 70–100 cells pooled from five experiments, and the error bars (or SEM) have been omitted in the kinetic profiles of A and B to avoid clustering of data points. In the dose-response curves (C), treatment groups with similar levels of [Ca2+]i responses are denoted by the same letter (P > 0.05).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In this study, a full-length cDNA of grass carp PACAP has been cloned and confirmed to be a single copy gene in the genome of Chinese grass carp. Unlike the reports in mammals, in which a wide range of tissue distribution has been demonstrated (see introduction), the newly cloned grass carp PACAP was found to express exclusively in the brain, especially in brain areas including the telencephalon, hypothalamus, cerebellum, and medulla oblongata. The brain-specific expression of PACAP, to our knowledge, has not been reported previously. This unique pattern of expression observed in prepubertal grass carp may suggest that PACAP is expressed predominately in the CNS of juvenile fish before sexual maturation, presumably by acting as a neurotransmitter, neurotrophic factor, and/or hypophysiotropic factor. Because two separate genes for PACAP have been reported in rainbow trout (40) and multiple forms of PACAP has been cloned in goldfish (41) and zebrafish (36, 42), we do not exclude the possibility that other isoforms of PACAP may also express in peripheral tissues of the grass carp. Consistent with the structural organization of PACAP cDNAs reported in fish, including the salmon (23), catfish (43), zebrafish (36), and rainbow trout (40), the coding sequence of grass carp PACAP can be divided into four domains, including a 24-a.a. signal peptide with a Leu/Ile-rich hydrophobic core; a 54-a.a. cryptic peptide of unknown function; a 45-a.a. GHRH-LP as a structural homologue of fish GHRH; and a 38-a.a. mature peptide of PACAP38. Phylogenetic analysis has revealed that this newly cloned cDNA can be clustered in the clade of PACAP and is distally related to VIP, a structurally related peptide of the same family. The a.a. sequence of grass carp prepro-PACAP is almost identical with that of goldfish and is highly homologous to the sequences reported in other fish species (66–98%). The sequence homology, however, drops to lower levels when compared with prepro-PACAPs in tetrapods (37–45%).

Because the enzyme processing sites, including both monobasic and dibasic processing sites, are conserved in grass carp prepro-PACAP, cleavage at these sites is expected to produce the mature peptides of GHRH-LP, PACAP27, and PACAP38, respectively. This idea is in agreement with our recent findings that PACAP immunoreactivity was detected in nerve fibers from the hypothalamus innervating the proximal pars distalis of the carp pituitary (28). Sequence alignment also reveals that the a.a. sequences of PACAPs are highly conserved, whereas the a.a. sequences of GHRH/GHRH-LP are more variable among different vertebrates. In general, it is commonly accepted that PACAP is originated from the glucagon gene family. The peptide first appeared in echinoderms and evolved along the deuterosome line of evolution via urochordates to modern-day vertebrates (44). During the process, GHRH was produced as a result of exon duplication followed by gene duplication (27). Apparently, the PACAP genes in fish have completed the process of exon duplication with one of the exons (i.e. PACAP coding exon) being highly conserved due to a strong functional constraint during evolution. The duplicated exon (i.e. GHRH coding exon), in contrast, exhibits a noticeable level of structural diversity as a result of lower selection pressure (4). Similar to the reports in salmon (45), trout (40), catfish (46), and zebrafish (36), two forms of PACAP mRNA (full length vs. truncated) could be detected in the grass carp. The truncated form with most of the GHRH-LP sequence deleted was caused by alternative splicing of exon IV (23), which may serve as a regulatory mechanism acting at the posttranscriptional level to shift the protein expression to a higher ratio of PACAP compared with GHRH-LP (47).

At present, high-resolution 3-D characterization of PACAP is restricted to the single structure reported in mammals and no information is available regarding the solution structures of PACAP in nonmammalian species. To provide the basis for structural analysis at the atomic level using a comparative approach, carp PACAP27 and PACAP38 were synthesized and their 3-D conformations were examined for the first time using CD and NMR spectroscopies. Consistent with the structures of peptides from the glucagon/secretin family (48), the solution structures of grass carp PACAP27 and PACAP38 are dominated by {alpha}-helixes. The number of a.a. residues involved in the {alpha}-helical structures independently calculated from CD and chemical shift index data are highly compatible if not identical with those deduced from the 3-D structures based on quantitative NOE data (PACAP27: 21, 21, and 21; PACAP38: 24, 26, and 26, respectively). Based on the final ensembles of NMR structures, three domains can be delineated in PACAP38, namely a flexible N terminal from His1 to Ile5, an extended {alpha}-helix forming a central core from Phe6 to Val26, and a short helical tail from Arg29 to Arg34 in the C terminal. The C-terminal helix is located after a hinge at Leu27 to Gly28 and is absent in the solution structures of PACAP27. The 3-D conformations of grass carp PACAPs are similar to that of mammalian PACAPs, except that the random structures in the N terminal (His1 to Ile5) are much reduced compared with the mammalian counterpart (His1 to Asp8) (19) and that the structural discontinuity at Lys20 to Lys21 reported in the central cores of mammalian PACAP27 and PACAP38 (17) is not evident in the fish PACAPs. Furthermore, spatial overlap of the side chains of Arg12 and Gln16 with Lys38 in grass carp PACAP38 leads to the formation of a ring-like structure by the central {alpha}-helix and C-terminal helical tail. This ring-like structure is unique and has not been reported in the mammalian counterparts.

The structure-activity relationship in mammalian PACAP has been extensively studied. Apparently the three structural domains identified in PACAP38 form three anchorage sites for the receptors and any two of the three can lead to high-affinity binding (18). The hydrophilic residues Lys20 to Lys21 in the central helical core are involved in ligand-receptor interactions. Their replacement by Gly20 and Gly21, alone or in combination, can markedly reduce the binding affinity of the resulting peptides (49). The N terminal of PACAP, besides its role in receptor binding, is also required for activating postreceptor signaling, e.g. stimulation of adenylate cyclase (50), and N-terminal truncation (e.g. PACAP6–38) can lead to the formation of high affinity competitive antagonists (51). Because the structural modifications observed in grass carp PACAPs occur at those locations known to affect receptor binding and signal transduction, it is conceivable that molecular interactions between PACAP and its receptors in fish models may be different from that of mammals.

In mammals, inconsistency in NMR structures for PACAP27 has been reported regarding the presence of a ß-turn from Ser9 to Arg12 (15). Our NMR structures based on fish PACAP27 are more comparable with the previous report by Wray et al. (17) and do not support the presence of a ß-turn in the positions from Ser9 to Arg12. In this study, the surface plots of PACAP27 and PACAP38 have reported for the first time and revealed that the helical structures of fish PACAPs are amphipathic in nature with basic residues clustered largely onto one side. In class B G protein-coupled receptors, including the receptors for PACAP and VIP, it is generally accepted that the N-terminal domain of these receptors via a network of disulfide bridges forms a negatively charged binding groove, which can act as an affinity trap to bind with the basic residues in the C terminal of the ligand (52). Subsequent binding of the N terminal of the ligand with the J-domains of the seven membrane-spanning {alpha}-helices [or transmembrane domains (TMD)] of the receptor can lead to receptor activation and signal transduction (53). For VPAC1 receptors, which can also bind PACAP with high affinity (54), the basic residues in the central core of VIP have been shown to interact with the acidic residues in the electronegative binding groove in the N terminal of the receptor (55).

These previous findings have prompted us to speculate that the basic surface of the helical structures in fish PACAPs may be crucial for receptor interaction. In a recent study with PACAP21, a truncated PACAP with only the first 21-a.a. residues, it has been shown that a ß-coil can be formed by two overlapping ß-turns in the N terminal from Asp3 to Thr7 during the process of receptor binding (19). This ß-coil forms the basis of a two-step ligand transportation model for receptor activation. In this model, PACAP comes into close proximity of the plasma membrane to acquire its 3-D structures under a hydrophobic environment and diffuses laterally on the surface to find its receptors. Upon receptor binding, conformational change occurs in the N terminal and the resulting ß-coil creates a hydrophobic patch for specific interactions and subsequent activation of PACAP receptors. As revealed by the 3-D modeling based on the average structures of fish PACAPs, a similar ß-coil composed of two ß-turns, namely a type I ß-turn from Gly4 to Thr7 and a type II' ß-turn from Asp3 to Phe6, can also be formed in the flexible N terminal of grass carp PACAP38. This ß-coil not only can form a hydrophobic patch as reported in PACAP21 (19) but also constitute a negatively charged hydrophilic pocket on the other side by clustering of Asp3 and Asp8. To our knowledge, the negatively charged pocket has not been reported in the 3-D structure of mammalian PACAPs. In VPAC receptors, the basic residues close to or located in the extracellular regions of TMD1 (Lys143) and TMD2 (Arg188 and Lys195) are essential for VIP binding (55). Similar basic residues can also be noted in the juxtamembrane region of TMD1 (Lys211), TMD2 (Lys263), TMD3 (Lys284), and TMD4 (Arg345) in type I PACAP receptors (or PAC-I receptors), and these residues appear to be well conserved from fish to mammals (24). Because the N terminal of mammalian PACAPs, especially the first three resides including His1, Ser2, and Asp3, are involved in receptor binding and activation of adenylate cyclase (49), we do not exclude the possibility that the N terminal of fish PACAP38 may interact with the basic residues in PACAP receptor, through the negatively charged pocket in the ß-coil structure to trigger receptor activation and signal transduction.

Because mammalian PACAPs can act as a potent GH secretagogue in fish (41) and PACAP has been proposed to be the ancestral GHRH in lower vertebrates (27), the biological activities of grass carp PACAP27 and PACAP38 were also tested in vitro in pituitary cells prepared from 1-yr-old grass carp. Similar to our recent studies using ovine PACAP38 (28), grass carp PACAP27 and PACAP38 were both effective in triggering GH release and GH mRNA expression by acting directly at the pituitary level. These stimulatory effects, however, were not mimicked by GHRH-LP, which is supposed to be the grass carp GHRH. In general, it is commonly accepted that GHRH is not a major GH-releasing factor in amphibian and fish models (27). In previous studies, a lack of GH-releasing effect for GHRH has been reported in fish species, including turbot (56) and European eel (25). Parallel to their actions on GH release and GH mRNA expression, grass carp PACAPs also induced cAMP production and Ca2+ influx through VSCC in carp pituitary cells. These results are consistent with the findings that the GH-releasing actions of PACAP in fish pituitary cells, e.g. in goldfish (41) and common carp (26), are mediated by type I PACAP receptors coupled to cAMP/protein kinase A- and Ca2+/calmodulin kinase II-dependent signaling cascades. Recently we have shown that ovine PACAP38 could up-regulate the nuclear expression of GH primary transcripts in carp pituitary cells and this stimulatory effect occurred with parallel rises in cytosolic mature GH mRNA and cellular GH content (28). These findings indicate that PACAP may activate GH synthesis at the pituitary level by stimulating GH gene transcription. This idea is supported by the results of our transfection studies, in which grass carp PACAP27 and PACAP38 could elevate GH promoter activity in a time- and dose-dependent manner. Using 5' deletion analysis, the promoter sequence responsible for the stimulatory effects by PACAPs was mapped to the region downstream of position –115 in the grass carp GH promoter (Zhou, H., Y. Jiang, and A. O. L. Wong, unpublished data).

When compared with its truncated form, PACAP27, grass carp PACAP38 was consistently found to be more potent and with a higher efficacy in terms of GH secretion, GH gene expression, cAMP production, and [Ca2+]i responses. Based on the extensive studies in mammals using structural analogs of PACAP27 and PACAP38, it is commonly accepted that the C-terminal helical tail in PACAP38 can facilitate receptor recognition but is not essential for high-affinity binding (50). Because the expression level of PACAP receptors in the carp pituitary is quite low and cannot be used for radioreceptor binding studies (our unpublished data), it remains to be determined whether PACAP27 and PACAP38 have different affinity for the type I (or PAC-I) PACAP receptors expressed in carp somatotrophs. However, the differential responses to PACAP27 and PACAP38 observed in grass carp pituitary cells are highly comparable with that of type IB PACAP receptors previously reported in mammals. In the rat, type IB PACAP receptors have been identified in the cerebral cortex (57) and anterior pituitary (33). Unlike type IA PACAP receptors with equal affinity for the two forms of PACAPs, type IB PACAP receptors can bind PACAP38 with an affinity 10- to 100-fold greater than that for PACAP27 (38). Although type I PACAP receptors have been cloned in fish models, e.g. goldfish (24) and zebrafish (39), structural evidence to support the presence of two subtypes of type I (or PAC-I) PACAP receptors is still lacking. Further investigations are clearly warranted to study the functional role of pituitary type IB PACAP receptors in GH regulation.


    Acknowledgments
 
This series of papers on the role of PACAP as a GH-releasing factor in fish is dedicated to Dr. R. E. Peter (University of Alberta, Edmonton, Canada), who passed away on March 8, 2007. His sense of humor and genuine interest in the training of young scientists will be sadly missed.


    Footnotes
 
This work was supported by research grants from the Research Grant Council (Hong Kong), University Research Committee (University of Hong Kong), National 973 Program (China) (to A.O.L.W. and K.H.S.), and the Departments of Zoology (to H.Z. and Y.J.) and Chemistry (to Y.Y.) in the form of postgraduate studentships.

Disclosure: The authors have nothing to disclose.

First Published Online July 5, 2007

Abbreviations: a.a., Amino acid; [Ca2+]i, intracellular free calcium concentration; CD, circular dichroism; CNS, central nervous system; 2-D, two-dimensional; 3-D, three-dimensional; DIG, digoxigenin; DQF-COSY, double-quantum filtered-correlation spectroscopy; GHRH-LP, GHRH-like peptide; NMR, nuclear magnetic resonance; NOE, nuclear Overhauser effect; NOESY, nuclear Overhauser effect spectroscopy; PACAP, pituitary adenylate cyclase-activating polypeptide; RACE, rapid amplification of cDNA ends; RT, reverse transcription; TFE, trifluoroethanol; TMD, transmembrane domain; TOCSY, total correlation spectroscopy; UTR, untranslated region; VIP, vasoactive intestinal polypeptide; VSCC, voltage-sensitive Ca2+ channel.

Received May 1, 2007.

Accepted for publication June 22, 2007.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Miyata A, Arimura A, Dahl RR, Minamino N, Uehara A, Jiang L, Culler MD, Coy DH 1989 Isolation of a novel 38 residue-hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem Biophys Res Commun 164:567–574[CrossRef][Medline]
  2. Miyata A, Jiang L, Dahl RD, Kitada C, Kubo K, Fujino M, Minamino N, Arimura A 1990 Isolation of a neuropeptide corresponding to the N-terminal 27 residues of the pituitary adenylate cyclase activating polypeptide with 38 residues (PACAP38). Biochem Biophys Res Commun 170:643–648[CrossRef][Medline]
  3. Rawlings SR 1994 PACAP, PACAP receptors, and intracellular signalling. Mol Cell Endocrinol 101:C5–C9
  4. Sherwood NM, Krueckl SL, McRory JE 2000 The origin and function of the pituitary adenylate cyclase-activating polypeptide/glucagon superfamily. Endocr Rev 21:619–670[Abstract/Free Full Text]
  5. Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A, Vaudry H 2000 Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Rev 52:269–324[Abstract/Free Full Text]
  6. Masuo Y, Suzuki N, Matsumoto H, Tokito F, Matsumoto Y, Tsuda M, Fujino M 1993 Regional distribution of pituitary adenylate cyclase activating polypeptide in the rat central nervous system as determined by sandwich-enzyme immunoassay. Brain Res 602:57–63[CrossRef][Medline]
  7. Vaudry D, Gonzalez BJ, Basille M, Fournier A, Vaudry H 1999 Neurotrophic activity of pituitary adenylate cyclase-activating polypeptide on rat cerebellar cortex during development. Proc Natl Acad Sci USA 96:9415–9420[Abstract/Free Full Text]
  8. Lauff JM, Modlin IM, Tang LH 1999 Biological relevance of pituitary adenylate cyclase-activating polypeptide (PACAP) in the gastrointestinal tract. Regul Pept 84:1–12[CrossRef][Medline]
  9. Linden A, Cardell LO, Yoshihara S, Nadel JA 1999 Bronchodilation by pituitary adenylate cyclase-activating peptide and related peptides. Eur Respir J 14:443–451[Abstract]
  10. Carlsson PO, Ostenson CG, Efendic S, Langel U, Jansson L 1996 Pituitary adenylate cyclase activating polypeptide redistributes the blood within the pancreas of anesthetized rats. Regul Pept 63:123–128[Medline]
  11. Jiang X, Wang HY, Yu J, Ganea D 1998 VIP1 and VIP2 receptors but not PVR1 mediate the effect of VIP/PACAP on cytokine production in T lymphocytes. Ann NY Acad Sci 865:397–407[CrossRef][Medline]
  12. Filipsson K, Ahren B 1998 Protein kinase A inhibition and PACAP-induced insulin secretion in HIT-T15 cells. Ann NY Acad Sci 865:441–444[CrossRef][Medline]
  13. Zhong Y, Kasson BG 1994 Pituitary adenylate cyclase-activating polypeptide stimulates steroidogenesis and adenosine 3',5'-monophosphate accumulation in cultured rat granulosa cells. Endocrinology 135:207–213[Abstract]
  14. Conconi MT, Spinazzi R, Nussdorfer GG 2006 Endogenous ligands of PACAP/VIP receptors in the autocrine-paracrine regulation of the adrenal gland. Int Rev Cytol 249:1–51[Medline]
  15. Gonzalez-Muniz R, Martin-Martinez M, Granata C, de Oliveira E, Santiveri CM, Gonzalez C, Frechilla D, Herranz R, Garcia-Lopez MT, Del Rio J, Angeles Jimenez M, Andreu D 2001 Conformationally restricted PACAP27 analogues incorporating type II/II' IBTM ß-turn mimetics. Synthesis, NMR structure determination, and binding affinity. Bioorg Med Chem 9:3173–3183[CrossRef][Medline]
  16. Inooka H, Endo S, Kitada C, Mizuta E, Fujino M 1992 Pituitary adenylate cyclase activating polypeptide (PACAP) with 27 residues. Conformation determined by 1H NMR and CD spectroscopies and distance geometry in 25% methanol solution. Int J Pept Protein Res 40:456–464[Medline]
  17. Wray V, Kakoschke C, Nokihara K, Naruse S 1993 Solution structure of pituitary adenylate cyclase activating polypeptide by nuclear magnetic resonance spectroscopy. Biochemistry 32:5832–5841[CrossRef][Medline]
  18. Gourlet P, Vandermeers A, Vandermeers-Piret MC, Rathe J, De Neef P, Robberecht P 1995 Fragments of pituitary adenylate cyclase activating polypeptide discriminate between type I and II recombinant receptors. Eur J Pharmacol 287:7–11[CrossRef][Medline]
  19. Inooka H, Ohtaki T, Kitahara O, Ikegami T, Endo S, Kitada C, Ogi K, Onda H, Fujino M, Shirakawa M 2001 Conformation of a peptide ligand bound to its G-protein coupled receptor. Nat Struct Biol 8:161–165[CrossRef][Medline]
  20. Takahashi K, Totsune K, Murakami O, Satoh F, Sone M, Ohneda M, Sasano H, Mouri T 1994 Pituitary adenylate cyclase activating polypeptide (PACAP)-like immunoreactivity in human hypothalamus: co-localization with arginine vasopressin. Regul Pept 50:267–275[CrossRef][Medline]
  21. Dow RC, Bennie J, Fink G 1994 Pituitary adenylate cyclase-activating peptide-38 (PACAP)-38 is released into hypophysial portal blood in the normal male and female rat. J Endocrinol 142:R1–R4
  22. Rawlings SR, Hezareh M 1996 Pituitary adenylate cyclase-activating polypeptide (PACAP) and PACAP/vasoactive intestinal polypeptide receptors: actions on the anterior pituitary gland. Endocr Rev 17:4–29[Abstract/Free Full Text]
  23. Parker DB, Power ME, Swanson P, Rivier J, Sherwood NM 1997 Exon skipping in the gene encoding pituitary adenylate cyclase-activating polypeptide in salmon alters the expression of two hormones that stimulate growth hormone release. Endocrinology 138:414–423[Abstract/Free Full Text]
  24. Wong AOL, Leung MY, Shea WL, Tse LY, Chang JP, Chow BK 1998 Hypophysiotropic action of pituitary adenylate cyclase-activating polypeptide (PACAP) in the goldfish: immunohistochemical demonstration of PACAP in the pituitary, PACAP stimulation of growth hormone release from pituitary cells, and molecular cloning of pituitary type I PACAP receptor. Endocrinology 139:3465–3479[Abstract/Free Full Text]
  25. Montero M, Yon L, Rousseau K, Arimura A, Fournier A, Dufour S, Vaudry H 1998 Distribution, characterization, and growth hormone-releasing activity of pituitary adenylate cyclase-activating polypeptide in the European eel, Anguilla anguilla. Endocrinology 139:4300–4310[Abstract/Free Full Text]
  26. Xiao D, Chu MS, Lee KY, Lin HR, Wong AOL 2002 Regulation of growth hormone release in common carp pituitary cells by pituitary adenylate cyclase-activating polypeptide: signal transduction involves cAMP- and Ca2+-dependent mechanisms. Neuroendocrinology 76:325–338[CrossRef][Medline]
  27. Montero M, Yon L, Kikuyama S, Dufour S, Vaudry H 2000 Molecular evolution of the growth hormone-releasing hormone/pituitary adenylate cyclase-activating polypeptide gene family. Functional implication in the regulation of growth hormone secretion. J Mol Endocrinol 25:157–168[Abstract]
  28. Wong AOL, Li W, Leung CY, Huo L, Zhou H 2005 Pituitary adenylate cyclase-activating polypeptide (PACAP) as a growth hormone (GH)-releasing factor in grass carp. I. Functional coupling of cyclic adenosine 3',5'-monophosphate and Ca2+/calmodulin-dependent signaling pathways in PACAP-induced GH secretion and GH gene expression in grass carp pituitary cells. Endocrinology 146:5407–5424[Abstract/Free Full Text]
  29. Huo L, Lee EK, Leung PC, Wong AOL 2004 Goldfish calmodulin: molecular cloning, tissue distribution, and regulation of transcript expression in goldfish pituitary cells. Endocrinology 145:5056–5067[Abstract/Free Full Text]
  30. Zhou H, Wang X, Ko WK, Wong AOL 2004 Evidence for a novel intrapituitary autocrine/ paracrine feedback loop regulating growth hormone synthesis and secretion in grass carp pituitary cells by functional interactions between gonadotrophs and somatotrophs. Endocrinology 145:5548–5559[Abstract/Free Full Text]
  31. Wong AOL, Ng S, Lee EK, Leung RC, Ho WK 1998 Somatostatin inhibits (D-Arg6, Pro9-NEt) salmon gonadotropin-releasing hormone- and dopamine D1-stimulated growth hormone release from perifused pituitary cells of Chinese grass carp, Ctenopharyngodon idellus. Gen Comp Endocrinol 110:29–45[CrossRef][Medline]
  32. Zhou H, Jiang Y, Ko WK, Li W, Wong AOL 2005 Paracrine regulation of growth hormone gene expression by gonadotrophin release in grass carp pituitary cells: functional implications, molecular mechanisms and signal transduction. J Mol Endocrinol 34:415–432[Abstract/Free Full Text]
  33. Gottschall PE, Tatsuno I, Miyata A, Arimura A 1990 Characterization and distribution of binding sites for the hypothalamic peptide, pituitary adenylate cyclase-activating polypeptide. Endocrinology 127:272–277[Abstract/Free Full Text]
  34. Yunker WK, Lee EK, Wong AOL, Chang JP 2000 Norepinephrine regulation of growth hormone release from goldfish pituitary cells. II. Intracellular sites of action. J Neuroendocrinol 12:323–333[CrossRef][Medline]
  35. Zhou H, Ko WK, Ho WK, Stojilkovic SS, Wong AOL 2004 Novel aspects of growth hormone (GH) autoregulation: GH-induced GH gene expression in grass carp pituitary cells through autocrine/paracrine mechanisms. Endocrinology 145:4615–4628[Abstract/Free Full Text]
  36. Fradinger EA, Sherwood NM 2000 Characterization of the gene encoding both growth hormone-releasing hormone (GRF) and pituitary adenylate cyclase-activating polypeptide (PACAP) in the zebrafish. Mol Cell Endocrinol 165:211–219[CrossRef][Medline]
  37. Wishart DS, Sykes BD 1994 Chemical shifts as a tool for structure determination. Methods Enzymol 239:363–392[Medline]
  38. Arimura A, Shioda S 1995 Pituitary adenylate cyclase activating polypeptide (PACAP) and its receptors: neuroendocrine and endocrine interaction. Front Neuroendocrinol 16:53–88[CrossRef][Medline]
  39. Fradinger EA, Tello JA, Rivier JE, Sherwood NM 2005 Characterization of four receptor cDNAs: PAC1, VPAC1, a novel PAC1 and a partial GHRH in zebrafish. Mol Cell Endocrinol 231:49–63[CrossRef][Medline]
  40. Krueckl SL, Sherwood NM 2001 Developmental expression, alternative splicing and gene copy number for the pituitary adenylate cyclase-activating polypeptide (PACAP) and growth hormone-releasing hormone (GRF) gene in rainbow trout. Mol Cell Endocrinol 182:99–108[CrossRef][Medline]
  41. Wong AOL, Li WS, Lee EK, Leung MY, Tse LY, Chow BK, Lin HR, Chang JP 2000 Pituitary adenylate cyclase activating polypeptide as a novel hypophysiotropic factor in fish. Biochem Cell Biol 78:329–343[CrossRef][Medline]
  42. Wang Y, Wong AOL, Ge W 2003 Cloning, regulation of messenger ribonucleic acid expression, and function of a new isoform of pituitary adenylate cyclase-activating polypeptide in the zebrafish ovary. Endocrinology 144:4799–4810[Abstract/Free Full Text]
  43. McRory JE, Parker DB, Ngamvongchon S, Sherwood NM 1995 Sequence and expression of cDNA for pituitary adenylate cyclase activating polypeptide and growth hormone-releasing hormone-like peptide in catfish. Mol Cell Endocrinol 108:169–177[CrossRef][Medline]
  44. McRory J, Sherwood NM 1997 Two protochordate genes encode pituitary adenylate cyclase-activating polypeptide and related family members. Endocrinology 138:2380–2390[Abstract/Free Full Text]
  45. Parker DB, Coe IR, Dixon GH, Sherwood NM 1993 Two salmon neuropeptides encoded by one brain cDNA are structurally related to members of the glucagon superfamily. Eur J Biochem 215:439–448[Medline]
  46. Small BC, Nonneman D 2001 Sequence and expression of a cDNA encoding both pituitary adenylate cyclase activating polypeptide and growth hormone-releasing hormone-like peptide in channel catfish (Ictalurus punctatus). Gen Comp Endocrinol 122:354–363[CrossRef][Medline]
  47. Adams BA, Lescheid DW, Vickers ED, Crim LW, Sherwood NM 2002 Pituitary adenylate cyclase-activating polypeptide and growth hormone-releasing hormone-like peptide in sturgeon, whitefish, grayling, flounder and halibut: cDNA sequence, exon skipping and evolution. Regul Pept 109:27–37[CrossRef][Medline]
  48. Wray V, Nokihara K, Naruse S 1998 Solution structure comparison of the VIP/PACAP family of peptides by NMR spectroscopy. Ann NY Acad Sci 865:37–44[CrossRef][Medline]
  49. Robberecht P, Gourlet P, De Neef P, Woussen-Colle MC, Vandermeers-Piret MC, Vandermeers A, Christophe J 1992 Receptor occupancy and adenylate cyclase activation in AR 4–2J rat pancreatic acinar cell membranes by analogs of pituitary adenylate cyclase-activating peptides amino-terminally shortened or modified at position 1, 2, 3, 20, or 21. Mol Pharmacol 42:347–355[Abstract]
  50. Vandermeers A, Vandenborre S, Hou X, de Neef P, Robberecht P, Vandermeers-Piret MC, Christophe J 1992 Antagonistic properties are shifted back to agonistic properties by further N-terminal shortening of pituitary adenylate-cyclase-activating peptides in human neuroblastoma NB-OK-1 cell membranes. Eur J Biochem 208:815–819[Medline]
  51. Robberecht P, Gourlet P, De Neef P, Woussen-Colle MC, Vandermeers-Piret MC, Vandermeers A, Christophe J 1992 Structural requirements for the occupancy of pituitary adenylate-cyclase-activating-peptide (PACAP) receptors and adenylate cyclase activation in human neuroblastoma NB-OK-1 cell membranes. Discovery of PACAP(6–38) as a potent antagonist. Eur J Biochem 207:239–246[Medline]
  52. Gether U 2000 Uncovering molecular mechanisms involved in activation of G protein-coupled receptors. Endocr Rev 21:90–113[Abstract/Free Full Text]
  53. Hoare SR 2005 Mechanisms of peptide and nonpeptide ligand binding to class B G-protein-coupled receptors. Drug Discov Today 10:417–427[CrossRef][Medline]
  54. Harmar AJ, Arimura A, Gozes I, Journot L, Laburthe M, Pisegna JR, Rawlings SR, Robberecht P, Said SI, Sreedharan SP, Wank SA, Waschek JA 1998 International Union of Pharmacology. XVIII. Nomenclature of receptors for vasoactive intestinal peptide and pituitary adenylate cyclase-activating polypeptide. Pharmacol Rev 50:265–270[Abstract/Free Full Text]
  55. Laburthe M, Couvineau A 2002 Molecular pharmacology and structure of VPAC Receptors for VIP and PACAP. Regul Pept 108:165–173[CrossRef][Medline]
  56. Rousseau K, Le Belle N, Pichavant K, Marchelidon J, Chow BK, Boeuf G, Dufour S 2001 Pituitary growth hormone secretion in the turbot, a phylogenetically recent teleost, is regulated by a species-specific pattern of neuropeptides. Neuroendocrinology 74:375–385[CrossRef][Medline]
  57. Cauvin A, Robberecht P, De Neef P, Gourlet P, Vandermeers A, Vandermeers-Piret MC, Christophe J 1991 Properties and distribution of receptors for pituitary adenylate cyclase activating peptide (PACAP) in rat brain and spinal cord. Regul Pept 35:161–173[CrossRef][Medline]



This article has been cited by other articles:


Home page
Pharmacol. Rev.Home page
D. Vaudry, A. Falluel-Morel, S. Bourgault, M. Basille, D. Burel, O. Wurtz, A. Fournier, B. K. C. Chow, H. Hashimoto, L. Galas, et al.
Pituitary Adenylate Cyclase-Activating Polypeptide and Its Receptors: 20 Years after the Discovery
Pharmacol. Rev., September 1, 2009; 61(3): 283 - 357.
[Abstract] [Full Text] [PDF]


Home page
ReproductionHome page
W.-T. Huang, C.-J. Li, P.-J. Wu, Y.-S. Chang, T.-L. Lee, and C.-F. Weng
Expression and in vitro regulation of pituitary adenylate cyclase-activating polypeptide (pacap38) and its type I receptor (pac1-r) in the gonads of tilapia (Oreochromis mossambicus)
Reproduction, March 1, 2009; 137(3): 449 - 467.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Q. Jiang, W. K. W. Ko, E. A. Lerner, K. M. Chan, and A. O. L. Wong
Grass carp somatolactin: I. Evidence for PACAP induction of somatolactin-{alpha} and -{beta} gene expression via activation of pituitary PAC-I receptors
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E463 - E476.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Q. Jiang, M. He, X. Wang, and A. O. L. Wong
Grass carp somatolactin: II. Pharmacological study on postreceptor signaling mechanisms for PACAP-induced somatolactin-{alpha} and -{beta} gene expression
Am J Physiol Endocrinol Metab, August 1, 2008; 295(2): E477 - E490.
[Abstract] [Full Text] [PDF]


Home page
J EndocrinolHome page
J. M. Lugo, A. Rodriguez, Y. Helguera, R. Morales, O. Gonzalez, J. Acosta, V. Besada, A. Sanchez, and M. P. Estrada
Recombinant novel pituitary adenylate cyclase-activating polypeptide from African catfish (Clarias gariepinus) authenticates its biological function as a growth-promoting factor in low vertebrates
J. Endocrinol., June 1, 2008; 197(3): 583 - 597.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a related Letter to the Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Reprints, Permissions and Rights
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sze, K. H.
Right arrow Articles by Wong, A. O. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sze, K. H.
Right arrow Articles by Wong, A. O. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Endocrinology Endocrine Reviews J. Clin. End. & Metab.
Molecular Endocrinology Recent Prog. Horm. Res. All Endocrine Journals