This Article Abstract Full Text (PDF) All Versions of this Article: 148/10/5042    most recent Author Manuscript (PDF) Purchase Article View Shopping Cart Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Copyright Permission Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sze, K. H. Articles by Wong, A. O. L. Search for Related Content PubMed PubMed Citation Articles by Sze, K. H. Articles by Wong, A. O. L.

Pituitary Adenylate Cyclase-Activating Polypeptide (PACAP) as a Growth Hormone (GH)-Releasing Factor in Grass Carp: II. Solution Structure of a Brain-Specific PACAP by Nuclear Magnetic Resonance Spectroscopy and Functional Studies on GH Release and Gene Expression

Departments of Zoology (H.Z., M.H., Y.J., A.O.L.W.) and Chemistry and Open Laboratory of Chemical Biology (K.H.S., Y.Y.), The University of Hong Kong, Hong Kong SAR, People’s Republic of China

Address all correspondence and requests for reprints to: Anderson O. L. Wong, Department of Zoology, The University of Hong Kong, Pokfulam Road, Hong Kong SAR, P.R. China. E-mail: olwong{at}hkucc.hku.hk.

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Pituitary adenylate cyclase-activating polypeptide (PACAP) has been proposed to be the ancestral GHRH. Recently, using grass carp as a model for modern-day bony fish, we demonstrated that PACAP nerve fibers are present in close proximity to carp somatotrophs, and mammalian PACAPs can induce GH secretion in carp pituitary cells. To further examine the role of PACAP as a GH-releasing factor in fish, the structural identity of grass carp PACAP was established by molecular cloning. The newly cloned PACAP was found to be a single-copy gene and expressed in the brain but not other tissues. The mature peptides of PACAP, namely PACAP₂₇ and PACAP₃₈, were synthesized. As revealed by nuclear magnetic resonance spectroscopies, carp PACAP₃₈ is composed of a flexible N terminal from His¹ to Ile⁵, an extended central helix from Phe⁶ to Val²⁶, and a short helical tail in the C terminal from Arg²⁹ to Arg³⁴. The C-terminal helix is located after a hinge region at Leu²⁷ to Gly²⁸ and is absent in the solution structures of PACAP₂₇. The two forms of PACAPs were effective in elevating GH release and GH transcript expression in grass carp pituitary cells. These stimulatory effects occurred with parallel rises in cAMP and Ca²⁺ entry via voltage-sensitive Ca²⁺ channels in carp somatotrophs. The present study represents the first report for solution structures of nonmammalian PACAPs and provides evidence that a brain-specific isoform of PACAP in fish can stimulate GH synthesis and release at the pituitary level, presumably by activating the appropriate postreceptor signaling mechanisms.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
PITUITARY ADENYLATE CYCLASE-activating polypeptide (PACAP), a member of the glucagon/secretin peptide family, was first isolated in ovine hypothalamus by its ability to stimulate adenylyl cyclase activity in rat pituitary cells (1). Two forms of PACAP, PACAP₃₈ (1) and PACAP₂₇ (2), have been identified. PACAP₃₈ is a 38-amino acid (a.a.) neuropeptide with its N-terminal sequence highly homologous to vasoactive intestinal polypeptide (VIP), whereas PACAP₂₇ is a truncated form of PACAP₃₈ containing only the first 27 a.a. residues. In mammals, PACAP₃₈ and PACAP₂₇ are derived from the same precursor by posttranslational proteolysis and alternative -amidation (3). The protein sequences of PACAP₃₈ are identical in mammals and highly conserved compared with that reported in other vertebrate species, including the fish, amphibians, and birds (4). PACAP immunoreactivity, with PACAP₃₈ as the predominant form, was first identified in the central nervous system (CNS) and later in peripheral tissues including the respiratory, genital-urinary, circulatory, and gastrointestinal systems (5). Consistent with its wide range of tissue distribution, PACAP is also involved in a variety of physiological functions. For examples, it can serve as a neurotransmitter (6) and neurotropic factor within the brain (7). At the peripheral level, PACAP is also known to regulate gut motility (8), airway dilation (9), vasoconstriction (10), immune responses (11), insulin secretion (12), steroid production (13), and adrenal functions (14).

Because PACAP is a pleiotropic neuropeptide with very diverse functions and clinical potentials, characterization of its three-dimensional (3-D) structure with the goal of designing nonpeptidergic mimics has been the focus of recent research (15). At present, two nuclear magnetic resonance (NMR) structures for PACAP₂₇ (16, 17) and one for PACAP₃₈ have been reported (17). In these studies, PACAP₃₈ is composed of three domains with the N terminal (His¹ to Asp⁸) forming a disordered structure followed by an extended central -helix (Ser⁹ to Val²⁶) with a break at Lys²⁰ to Lys²¹ and a short helical tail (Leu²⁹ to Arg³⁴) in the C terminal. These structural domains have been proposed to form three anchorage sites for receptor recognition, and any two of the three can lead to high-affinity binding for the receptors (18). The 3-D conformation of PACAP₂₇ largely mirrors that of PACAP₃₈ except that the C-terminal tail is missing. Nevertheless, discrepancy has been noted in the NMR structures reported for PACAP₂₇. Using 25% methanol as the solvent system, a type IIß turn was identified in PACAP₂₇ from Ser⁹ to Arg¹² (16), which is not supported by the results using 50% trifluoroethanol (17). When compared with a recent study on PACAP₂₁, a C-terminal truncated form of PACAP₂₇, further inconsistency in NMR structures can be found including: 1) a shortening of the N-terminal random structure from His¹ to Ile⁵, 2) the presence of a ß-coil from Asp⁴ to Phe⁷, and 3) the absence of the structural discontinuity at Lys²⁰ to Lys²¹ in the central -helix (19). Given that NMR analysis is restricted to the single form of PACAP reported in mammals and the 3-D conformations of PACAP from other vertebrate classes are not available, comparative studies to examine the solution structures of PACAPs are still lacking. To our knowledge, the surface plots of PACAP₂₇ and PACAP₃₈ have not been published, and the surface properties in relationship to the 3-D molecular structures of the two PACAPs are unclear and remain to be determined.

In mammals, PACAP immunoreactivity can be detected in the hypothalamus (20) and hypophysial portal blood (21). Under certain conditions, PACAP can also elevate basal release of GH, prolactin, and gonadotropin, suggesting that PACAP can act at the pituitary level to serve as a hypophysiotropic factor (22). Although the GH-releasing effect of PACAP is relatively weak in mammalian models, the role of PACAP as a novel GH-releasing factor has received increasing attention, mainly due to the fact that 1) PACAP and GHRH are evolved from the same ancestral gene and 2) unlike mammals, in which PACAP and GHRH are encoded in separate genes, the two are encoded in the same gene in nonmammalian vertebrates (4). In lower vertebrates, in particular the bony fish, PACAP can act as a potent secretagogue for GH release, e.g. in rainbow trout (23), goldfish (24), European eel (25), and common carp (26). Because GHRH in general has a low efficacy or even no effects on GH secretion in amphibian and fish models, it has been postulated that PACAP may serve as the ancestral GHRH before the evolution of mammalian GHRH (27). In our recent studies in Chinese grass carp, we have shown that PACAP nerve fibers are present in close proximity to carp somatotrophs, and ovine PACAP₃₈ can induce GH gene expression in carp pituitary cells via activation of the cAMP/protein kinase A- and Ca²⁺/calmodulin-dependent signaling pathways (28). These findings suggest that PACAP not only can trigger GH release in fish but also play a role in GH synthesis at the pituitary cell level. Given that mammalian PACAP was used in our previous study, it remains to be determined whether fish PACAP can also have similar effects on GH gene expression.

In this study, we sought to establish the structural identity of PACAP expressed in grass carp and examine its functional role in regulating GH release and GH gene expression at the pituitary level. Chinese grass carp was used as the animal model because it is a major commercial fish in Asian countries. Besides, the fish used in our experiments are prepubertal and represent the grow-out phase during the transition from juvenile to adult fish. The fish at this stage of development can provide us a unique opportunity to study the neuroendocrine mechanisms regulating body growth in maturing Cyprinids. Using 5'/3' rapid amplification of cDNA ends (RACE), a full-length cDNA of grass carp PACAP was obtained. The gene copy number and tissue expression pattern of this newly cloned PACAP were determined by Southern blot and RT-PCR, respectively. Based on the deduced a.a. sequences, carp PACAP₂₇ and PACAP₃₈ were synthesized. Their solution structures were characterized by circular dichroism (CD) and NMR spectroscopy, whereas their GH-releasing actions were tested in vitro in grass carp pituitary cells under column perifusion. In parallel experiments, the effects of PACAP on GH transcript expression were also investigated using a static incubation approach.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Animals
One-year-old Chinese grass carp (Ctenopharyngodon idellus) with body weight ranging from 1.5 to 2.0 kg was purchased from local markets. Because the grass carp at this stage was sexually immature and sexual dimorphism was not apparent, fish of mixed sexes were used for total RNA extraction and pituitary cell preparation. During the process, the fish were killed by anesthesia followed by spinosectomy according to the protocols approved by the Committee of Animal Use for Research and Teaching at the University of Hong Kong (Hong Kong).

Molecular cloning of grass carp PACAP
Total RNA was extracted from the brain of grass carp using TRIZOL (Life Technologies, Inc., Rockville, MD) and reverse transcribed using a SuperScript II first-strand cDNA synthesis kit (Invitrogen, San Diego, CA). Using primers designed based on the conserved regions of goldfish and zebrafish PACAPs, a 504-bp fragment of grass carp PACAP cDNA was pulled out by nested PCR using the brain reverse transcription (RT) sample as the template. Based on the nucleotide sequence obtained, gene-specific primers were designed and 5'/3' RACE was performed using a GeneRacer kit (Invitrogen). PCR products were gel purified and subcloned into the pGEM-T Easy vector (Promega, Madison, WI) for DNA sequencing using a BigDye cycle sequencing kit (Applied Biosystems, Forster City, CA). The full-length cDNA of grass carp PACAP was compiled from its 5' and 3' sequences and analyzed with MacDNASIS PRO (Hitachi, San Bruno, CA) and MacVector 6.5 programs (Oxford Molecular, Madison, WI). After that, phylogenetic trees for PACAP evolution were constructed by UPGMA, PHYLIP, and TreeView V.32 using the EMBnet/CNB Web site (www.es.embnet.org).

Peptide synthesis and CD spectroscopy
Grass carp PACAP₃₈ and PACAP₂₇ were synthesized at the HSC Biotechnology Service Center (University of Toronto, Toronto, Canada) using a Novasyn Crystal automated peptide synthesizer (Nova-Biochem Ltd., Nottingham, UK). Peptide synthesis was conducted on PAL-PEG-PS resin using the continuous-flow Fmoc-peptide chemistry. The purity of PACAP₃₈ and PACAP₂₇ was 93 and 96%, respectively, as revealed by reverse-phase HPLC, and the homogeneity of the purified peptides was further confirmed by atmospheric pressure ionization mass spectrometry. These two peptides were dissolved in trifluoroethanol (TFE)-H₂O mixtures (0.4 mg/ml) with increasing ratio of TFE from 0 to 60%. CD spectra were collected at room temperature using a Jasco J-720 spectropolarimeter (Jasco, Tokyo, Japan). The data were recorded with a scanning speed of 50 nm/min at wavelength from 190 to 250 nm (with steps of 0.2 nm). In these experiments, the reference spectrum of the respective solvent was also monitored to serve as the background and the data were then subtracted from the corresponding CD spectrum. After that, the CD data were used to estimate the levels of secondary structure elements by deconvolution analysis using the CD-Pro software (http://lamar.colostate.edu/sreeram/CDPro).

NMR spectroscopy and structure calculations
Samples of grass carp PACAP₃₈ (3.5 mg) and PACAP₂₇ (2.5 mg) were dissolved in 50% TFE (vol/vol) prepared by mixing 0.3 ml H₂O and 0.3 ml TFE-d₂. One- and two-dimensional (2-D) NMR experiments, including total correlation spectroscopy (TOCSY), double-quantum filtered-correlation spectroscopy (DQF-COSY), and nuclear Overhauser effect spectroscopy (NOESY), were conducted in a Bruker Avance-600 NMR spectrometer (Bruker Biospin, Rheinstetten, Germany) using a dedicated 5-mm TXI probe with XYZ gradient. The mixing time for TOCSY study was 70 msec and that for NOESY measurements were 150 and 250 msec for PACAP₂₇ and 50, 100, 150, and 250 msec for PACAP₃₈, respectively. In these experiments, sodium [3-trimethylsilyl 2,2,3,3, ²H] propionate was used as an internal reference. Data processing was conducted with MestReC software (Mestrelab, A Coruna, Spain), whereas the graphical assignment and integration of cross-peaks were performed using SPARKY 3.110 (http://www.cgl.ucsf.edu/home/sparky). The 2-D data matrix was multiplied by a square-sine-bell window function and zero-filled to a 4 K x 2 K complex matrix before Fourier transformation (with baseline correction in both dimensions). The spin systems for PACAP₂₇ and PACAP₃₈ were assigned based on DQF-COSY and TOCSY spectra, and the sequential connectivity between cross-peaks was established using NOESY spectra according to standard procedures. To minimize human bias, interproton distance restraints were derived from NOESY cross-peaks with mixing times of 150 and 250 msec using the automated nuclear Overhauser effect (NOE) assignment strategy. Briefly, the data for NOE intensities and chemical shifts were extracted with SPARKY 3.110 and analyzed with CYANA 2.0 (http://www.las.jp/prod/cyana) for NOE assignment, distance calibration, removal of covalently fixed distance restraints, and calculation of torsion angle dynamics for solution structure modeling. Seven cycles of iterative NOE assignment and structural calculation were conducted and more than 90% of the input NOE data were assigned successfully. After that, a manual check of all NOE assignments was carried out before the final structure calculations. The 3-D models and surface plots of PACAP molecules were then constructed using the MOLMOL graphics program (http://hugin.ethz.ch/wuthrich/software/molmol).

Tissue distribution of PACAP expression
Tissue distribution of PACAP expression was examined using RT-PCR. Briefly, total RNA was isolated from the brain, pituitary, gills, heart, kidney, liver, intestine, muscle, and spleen using TRIZOL (Life Technologies). To establish the expression pattern of PACAP in the brain, total RNA was also prepared from various brain areas, including the olfactory bulbs, telencephalon, optic tectum, hypothalamus, cerebellum, medulla oblongata, and spinal cord. These RNA samples were digested with RNase-free DNase I (Invitrogen) and reverse transcribed using SuperScript II (Life Technologies). The RT samples obtained were used as the template for PCR using primers (GAAACTCGTTAA GCGACCTGGC and TTTAAAGAACACAGGCGCGA) specific for grass carp PACAP mRNA. PCR products were resolved in 1% agarose gel and transblotted onto a positively charged nylon membrane. Southern blot was then conducted to check for the authenticity of PCR products using a digoxigenin (DIG)-labeled cDNA probe for grass carp PACAP. In these studies, RT-PCR of ß-actin mRNA was used as an internal control.

Southern blot of genomic DNA
Genomic DNA was isolated from the whole blood of grass carp as described previously (29). The DNA sample obtained was subjected to overnight digestion at 37 C with HindIII alone or in combination with BglI, ClaI, StyI, or EcoRV, respectively. On the following day, the digested products were size fractionated in a 0.7% gel and vacuum blotted onto a positively charged nylon membrane for hybridization with a DIG-labeled cDNA probe for carp PACAP. Hybridization signals were then monitored using a DIG chemiluminescent detection kit (Roche, Mannheim, Germany) according to the standard procedures in our laboratory (30).

Column perfusion of grass carp pituitary cells
Primary cultures of grass carp pituitary cells were prepared by trypsin/DNase digestion method and cultured on preswollen Cytodex 2 beads (Pharmacia Biotech, Uppsala, Sweden) as described previously (28). After 15 h incubation, Cytodex beads with pituitary cells attached were loaded into 0.5-ml microcolumns (3 x 10⁶ cells/column) and perifused with prewarmed carp MEM (26) with 0.1% BSA at a flow rate of 15 ml/h using an ACUSYST-S perifusion system (Endotronics Inc., Minneapolis, MN). A 10-min pulse of PACAP or GHRH-like peptide (LP) treatment was administered via a three-way stopcock. Perifusate samples were collected in 5-min fractions and their GH contents were measured using a RIA previously validated for carp GH (31).

Measurement of GH mRNA expression
Static incubation of grass carp pituitary cells were used to examine the effects of PACAP₃₈ and PACAP₂₇ on GH mRNA expression. In this case, pituitary cells were seeded at a density of approximately 2.5 x 10⁶ cells/well in 24-well clustered plates. After overnight incubation, the cells were challenged with increasing doses of test substances for 48 h. Total RNA was then extracted from individual wells and GH mRNA level was quantified using a slot blot assay as described previously (32). In these experiments, parallel slot blots for 18S RNA were also performed to serve as an internal control.

Measurement of cAMP production
Carp somatotrophs (86–91% pure) were enriched from mixed populations of pituitary cells by Percoll gradient centrifugation (28). After washing two times to remove Percoll, somatotrophs were resuspended in carp MEM with 5% fetal bovine serum and seeded in 35-mm dishes at a density of approximately 2 x 10⁶ cells/dish. After 15 h incubation, culture medium was replaced with 0.9 ml HEPES-buffered Hanks’ balanced salt solution with 0.1% BSA medium (34) containing 0.1 mM 3-isobutyl-1-methylxanthine (Sigma, St. Louis, MO). 3-Isobutyl-1-methylxanthine, an inhibitor for phosphodiesterase, was used routinely to prevent cAMP degradation in cell cultures. In these experiments, drug treatment was initiated by adding 0.1 ml 10x stock solutions of PACAP₂₇ and PACAP₃₈ at appropriate concentrations. After 15 min incubation, medium was harvested for the measurement of cAMP release and cellular cAMP was extracted with 1 ml ice-cold absolute ethanol. These cAMP samples were freeze dried and stored at –20 C until their cAMP contents were assayed using a Bio-Trak [¹²⁵I]cAMP RIA kit (Amersham, Piscataway, NJ). Total cAMP production was defined as the sum of cellular cAMP content and the amount of cAMP released into the culture medium.

Measurement of intracellular Ca²⁺ levels
Carp somatotrophs were preloaded with Indo-I/AM (10 µM; Molecular Probes, Eugene, OR) in Hanks’ buffer saline medium (26) with 0.1% BSA for 30 min at 28 C. After dye loading, the cells were resuspended at a density of approximately 1.5 x 10⁶ cells/ml in BSA-free Hanks’ buffer saline in a thermostated quartz cuvette, and fluorescence signals for intracellular free calcium concentration ([Ca²⁺]i) were measured by a F4500 fluorescence spectrophotometer (Hitachi, Indianapolis, IN). Wavelengths for excitation and emission were fixed at 329 nm (5 nm slit width) and 405 nm (10 nm slit width), respectively. In these experiments, [Ca²⁺]i concentrations were calibrated using the cell lysis method as described previously (35). For single-cell Ca²⁺ imaging, carp somatotrophs were cultured on poly-D-lysine-coated coverslips (1.5 cm diameter) at a density of approximately 5 x 10⁵ cells/ml and preloaded with fura-2/AM (5 µM; Molecular Probes) for 60 min at room temperature. After dye loading, ratiometric measurement of [Ca²⁺]i signals was conducted with a PTI Epifluorescence Ca²⁺ imaging system (Photon Technology International, Birmingham, NJ) with excitation at 340 and 380 nm and emission at 510 nm, respectively. Images were captured and analyzed using the ImageMaster software (Photon Technology International). Because variations in fluorescence intensity were noted between different batches of cell preparation, Ca²⁺ calibration was not performed and the Ca²⁺ data were simply expressed as a ratio of the fluorescence signals with excitation at 340 and 380 nm, respectively.

Data transformation and statistics
For perifusion studies, GH data from individual columns were expressed as a percentage of the average GH contents in the first six fractions collected at the beginning of the experiment before drug treatment (as percent basal). This transformation was conducted to allow for pooling of data from separate columns without distorting the profile of GH release during the course of perifusion. GH responses were quantified by calculating the net change of GH release after the drug treatment (i.e. a net change in the area under the curve). In the case of slot blot experiments, GH mRNA was measured in terms of arbitrary density unit and normalized against the amount of 18S RNA in the same sample. To allow for pooling of data from different cells, the raw data for single-cell Ca²⁺ imaging (in fluorescence ratio at 340 and 380 nm) were transformed into fold increase of the mean value of basal Ca²⁺ levels averaged over the first 20 sec before drug treatment (as fold basal). Data presented were analyzed using Student’s t test or ANOVA followed by Fisher’s least significance difference test. Differences were considered significant at P < 0.05.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Molecular cloning and sequence analysis of grass carp PACAP
Using nested PCR coupled to 5'-3' RACE, a full-length cDNA for PACAP was cloned from the RT sample prepared from the brain of 1-yr-old grass carp (Fig. 1A). The newly cloned cDNA is 984 bp in size with a 173-bp 5' untranslated region (UTR), 528-bp open reading frame, and 283-bp 3'UTR encoding a 175-a.a. preprohormone. A short stretch of (CT)n repeats can be identified in the 5'UTR, whereas two putative polyadenylation signals are noted in the 3'UTR. The PACAP preprohormone (prepro-PACAP) can be divided into four structural domains, including the 24-a.a. signal peptide, 54-a.a. cryptic peptide, 45-a.a. GHRH-LP, and 38-a.a. PACAP₃₈. The mature peptide of GHRH-LP is flanked by an upstream monobasic (Thr-Glu-Arg) and downstream dibasic enzyme-processing site (Lys-Arg). The coding sequence of PACAP₃₈ is located after the dibasic processing site of GHRH-LP, and two additional dibasic processing sites preceded by a glycine residue (Gly-Arg-Arg) can be found within and at the end of the mature peptide of PACAP₃₈. Cleavage at these sites is expected to generate the mature peptides of GHRH-LP, PACAP₂₇, and PACAP₃₈, respectively. During the process of 5'/3' RACE, a truncated form of PACAP cDNA with the sequence from position 413 to 517 deleted was also obtained (Fig. 1B). The missing sequence covers the majority (32 a.a.) of the coding sequence for GHRH-LP, which is equivalent to exon IV of PACAP genes reported in other species, including the salmon (23) and zebrafish (36).

View larger version (27K): [in this window] [in a new window]   FIG. 1. A, Nucleotide and deduced a.a. sequences of grass carp PACAP cDNA. The four structural domains of prepro-PACAP, namely the signal peptide (underlined by dotted line), cryptic peptide (underlined by solid line), GHRH-LP (black font on gray background), and PACAP38 (white font on dark gray background), were mapped by sequence alignment with PACAP cDNAs reported in other species. The (CT)n repeats in 5'UTR were marked by dotted underline in italic. The monobasic and dibasic enzyme processing sites were labeled with small triangles. The polyadenylation signals (AACAAA) in 3'UTR were underlined in italic, and the stop codon located at the end of the coding sequence was marked by an asterisk. B, Structural organization of the coding sequences in two forms of PACAP transcripts. The structural domains of prepro-PACAP encoded by full-length and truncated form of PACAP mRNA were boxed for identification. SP, Signal peptide; Cryptic Pep, cryptic peptide; PACAP, PACAP38. The deleted region (413–517) in the truncated form (indicated by double underline in the nucleotide sequence) encodes a 32-a.a. fragment in GHRH-LP and is equivalent to exon IV of PACAP genes reported in fish models.

View larger version (43K): [in this window] [in a new window]   FIG. 2. Sequence comparison of different structural domains of PACAP preprohormone. The signal peptide (A), cryptic peptide (B), GHRH-LP (C), and PACAP38 (D) of grass carp prepro-PACAP were aligned with the corresponding sequences reported in other vertebrates. Sequence alignment was conducted using Clustal W with MacVector version 6.5.3. Sequences with identical a.a. residues across the species were boxed, whereas the conserved mutations were marked by shading. The a.a. sequences of prepro-PACAPs from representative species of different vertebrate classes were downloaded from the GenBank (http://www.ncbi.nih.gov).

View larger version (16K): [in this window] [in a new window]   FIG. 3. Phylogenetic analysis and Southern blot of grass carp PACAP. A, Unrooted analysis based on the nucleotide sequences of PACAP cDNAs was performed using PHYLIP and TreeView v. 3.2.1 programs. The guide tree was constructed using the neighbor-joining method after 1000 bootstraps (bootstrap value: 978–1000). The scale bar on the right represents the genetic distance of 0.1 nucleotide substitutions per site. B, Southern blot to study the gene copy number of PACAP in the carp genome. Grass carp genomic DNA was digested with HindIII alone or in combination with StyI, EcorV, ClaI, or BlgI. After size fractionation, positive signals for PACAP gene were detected by hybridization using a DIG-labeled probe for grass carp PACAP.

View larger version (29K): [in this window] [in a new window]   FIG. 4. Expression pattern of PACAP transcripts by RT-PCR. A, Tissue distribution of PACAP mRNA expression. RT-PCR of PACAP was performed in RNA samples prepared from the brain, pituitary, gill, heart, kidney, liver, muscle, spleen, and intestine. B, Brain distribution of PACAP mRNA expression. RT-PCR was conducted in RNA samples isolated from brain areas including the olfactory bulbs, telencephalon, hypothalamus, cerebellum, optic tectum, medulla oblongata, and spinal cord. In these studies, PCR products were size fractionated in 1% agarose gel and visualized by ethidium bromide staining. The authenticity of PCR products was confirmed by Southern blot using a DIG-labeled probe for grass carp PACAP. RT-PCR of ß-actin mRNA was also conducted to serve as an internal control.

View larger version (13K): [in this window] [in a new window]   FIG. 5. Global analysis of secondary structure elements in grass carp PACAP27 and PACAP38 by CD spectroscopy. The CD spectra of grass carp PACAP27 (A) and PACAP38 (B) were measured in aqueous solution with increasing levels of TFE according to the conditions described in Materials and Methods. Using deconvolution analysis, the relative contents of secondary structure elements were also deduced for the two forms of PACAPs (C). MRE, Mean residue ellipticity.

CH

CH

CH (observed)

CH (random

CH

View larger version (17K): [in this window] [in a new window]   FIG. 6. Identification of a.a. spin systems in grass carp PACAP by TOCSY and NOESY experiments. A, Fingerprint region showing the CH-NH 1H NMR cross-peaks of the 2-D TOCSY spectrum of grass carp PACAP27 (mixing time: 70 msec). B, NH-NH region showing the NHi-NHi+1 1H NMR cross-peaks of the 2-D NOESY spectrum of PACAP27 (mixing time: 150 msec). The sequential dNN connectivities and assignments are suggestive of -helical character. In this study, the TOCSY and NOESY experiments were conducted in 1:1 (vol/vol) TFE-d2/H2O at pH 3.1 and 300 K.

View larger version (15K): [in this window] [in a new window]   FIG. 7. Delineation of the -helical structures in PACAP27 and PACAP38. NOE connectivities and H shift differences were deduced for grass carp PACAP27 (A) and PACAP38 (B), respectively. The regions of the peptides with -helical structures deduced by quantitative NOE, and chemical shift data were marked by helical coils along the primary sequences of PACAP27 and PACAP38.

View larger version (22K): [in this window] [in a new window]   FIG. 8. Stereoview superpositions of the final restrained structures of grass carp PACAP27 (A) and PACAP38 (B). Ribbon plots of the average structures for the two peptides were also constructed and shown in the right panels. For structural comparison between PACAP27 and PACAP38, the restrained structures of Gly28 to Leu38 (C) and His1 to Leu27 (D) in carp PACAP38 were aligned separately to reveal the -helixes from Arg29 to Arg34 and Phe6 to Val27, respectively. The ribbon plots of the two peptides were also superimposed to reveal the ß-coil (square bracket) located in the N terminal of PACAP38 (green), which is absent in PACAP27 (red).

View larger version (45K): [in this window] [in a new window]   FIG. 9. Surface plots for grass carp PACAP27 and PACAP38. Both the front (upper panels) and back views (lower panels) of the stereo models for PACAP27 (A) and PACAP38 (B) are presented, with red color for acidic residues (negatively charged), blue color for basic residues (positively charged), and white color for neutral residues (hydrophobic). For spatial reference of individual a.a. residues, heavy atom plots for PACAP27 and PACAP38 were also constructed (light blue models with numbers indicating the position of the corresponding a.a. residues). To illustrate the unique features of PACAP38, the plane with the C terminal (Gly28 to Leu38) and central -helixes (Phe6 to Val27) arranged into a ring-like structure was selected to be the front view and rotated by 90° to highlight the amphipathic nature of the N-terminal ß-coil (C). In these models, the basic residues are located largely on one side of the helical structures of the two PACAPs. In PACAP27, and the acidic residues Asp3 and Asp8 are located on the opposite surface of the extended N terminal (as indicated by arrows). The corresponding residues in PACAP38, however, are clustered together in the ß-coil structure to form a hydrophilic pocket with the production of a hydrophobic patch on the other side (square bracket).

View larger version (24K): [in this window] [in a new window]   FIG. 10. Effects of grass carp PACAP27, PACAP38, and GHRH-LP on GH release from perifused grass carp pituitary cells. Increasing doses (1-1000 nM) of grass carp PACAP38 (A), PACAP27 (B), and GHRH-LP (C) were administered as 10-min pulses (as indicated by the vertical bars). The kinetic profiles of GH release during the experiments are presented in the left panels, whereas the quantitated GH responses (calculated as a net change of area under the curve) are presented in the bar graphs on the right. GH data (mean ± SEM, n = 6) are pooled results from six experiments. Treatment groups with similar levels of GH responses are denoted by the same letter (ANOVA followed by Fisher’s least significance difference test, P > 0.05), whereas an asterisk represents a significant difference, compared with basal GH secretion (Student’s t test, P < 0.05).

View larger version (15K): [in this window] [in a new window]   FIG. 11. Effects of grass carp PACAP38 (A) and PACAP27 (B) on GH mRNA expression in grass carp pituitary cells. Static incubation of carp pituitary cells was conducted for 48 h with increasing concentrations (0.1–1000 nM) of grass carp PACAP27 and PACAP38. After that, GH mRNA levels were determined by the slot blot assay described in Materials and Methods. In these studies, parallel blotting of 18S RNA was used as an internal control. Data presented (mean ± SEM, n = 4) are pooled results from four separate experiments. Treatment groups with similar levels of GH mRNA expression are denoted by the same letter (P > 0.05).

View larger version (26K): [in this window] [in a new window]   FIG. 12. Effects of grass carp PACAPs on cAMP production and [Ca2+]i levels in carp somatotrophs. For cAMP measurement, carp somatotrophs were incubated for 15 min with increasing concentrations (0.01–1000 nM) of grass carp PACAP38 (A) and PACAP27 (B). cAMP production was defined as the sum of cellular cAMP content and cAMP released into the culture medium. Parallel treatment with forskolin (1 µM) was used as a positive control, and the groups with similar levels of cAMP responses are denoted by the same letter (P > 0.05). For [Ca2+]i measurement, somatotrophs were preloaded with the Ca2+-sensitive dye Indo-I and challenged with grass carp PACAP38 (1 µM, C) and PACAP27 (1 µM, D), respectively. To check for the possible involvement of voltage-sensitive Ca2+ channels, nifedipine (10 µM) was added after PACAP treatment. In these experiments, the solvent for PACAPs and nifedipine was used as a negative control.

View larger version (23K): [in this window] [in a new window]   FIG. 13. Dose dependence of PACAP-induced [Ca2+]i responses in carp somatotrophs. Single-cell Ca2+ imaging was performed in carp somatotrophs preloaded with the Ca2+-sensitive dyefura-2. The cells were exposed to increasing concentrations (0.1 nM to 1 µM) of grass carp PACAP38 (A) and PACAP27 (B) as indicated by the yellow shading. Representative Ca2+ images captured at the time points (red bars) before (a) and after (b) the introduction of a 1 µM dose of PACAP are also included (insets). In these cases, Ca2+ signals were first detected in the sublaminal area underneath the plasma membrane and spread to the interior of carp somatotrophs. Dose-response curves for these Ca2+ responses (C) were then constructed based on the maximal [Ca2+]i responses detected for individual cells on exposure to different doses of PACAP27 and PACAP38. Data are presented are the mean values of 70–100 cells pooled from five experiments, and the error bars (or SEM) have been omitted in the kinetic profiles of A and B to avoid clustering of data points. In the dose-response curves (C), treatment groups with similar levels of [Ca2+]i responses are denoted by the same letter (P > 0.05).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

Because the enzyme processing sites, including both monobasic and dibasic processing sites, are conserved in grass carp prepro-PACAP, cleavage at these sites is expected to produce the mature peptides of GHRH-LP, PACAP₂₇, and PACAP₃₈, respectively. This idea is in agreement with our recent findings that PACAP immunoreactivity was detected in nerve fibers from the hypothalamus innervating the proximal pars distalis of the carp pituitary (28). Sequence alignment also reveals that the a.a. sequences of PACAPs are highly conserved, whereas the a.a. sequences of GHRH/GHRH-LP are more variable among different vertebrates. In general, it is commonly accepted that PACAP is originated from the glucagon gene family. The peptide first appeared in echinoderms and evolved along the deuterosome line of evolution via urochordates to modern-day vertebrates (44). During the process, GHRH was produced as a result of exon duplication followed by gene duplication (27). Apparently, the PACAP genes in fish have completed the process of exon duplication with one of the exons (i.e. PACAP coding exon) being highly conserved due to a strong functional constraint during evolution. The duplicated exon (i.e. GHRH coding exon), in contrast, exhibits a noticeable level of structural diversity as a result of lower selection pressure (4). Similar to the reports in salmon (45), trout (40), catfish (46), and zebrafish (36), two forms of PACAP mRNA (full length vs. truncated) could be detected in the grass carp. The truncated form with most of the GHRH-LP sequence deleted was caused by alternative splicing of exon IV (23), which may serve as a regulatory mechanism acting at the posttranscriptional level to shift the protein expression to a higher ratio of PACAP compared with GHRH-LP (47).

At present, high-resolution 3-D characterization of PACAP is restricted to the single structure reported in mammals and no information is available regarding the solution structures of PACAP in nonmammalian species. To provide the basis for structural analysis at the atomic level using a comparative approach, carp PACAP₂₇ and PACAP₃₈ were synthesized and their 3-D conformations were examined for the first time using CD and NMR spectroscopies. Consistent with the structures of peptides from the glucagon/secretin family (48), the solution structures of grass carp PACAP₂₇ and PACAP₃₈ are dominated by -helixes. The number of a.a. residues involved in the -helical structures independently calculated from CD and chemical shift index data are highly compatible if not identical with those deduced from the 3-D structures based on quantitative NOE data (PACAP₂₇: 21, 21, and 21; PACAP₃₈: 24, 26, and 26, respectively). Based on the final ensembles of NMR structures, three domains can be delineated in PACAP₃₈, namely a flexible N terminal from His¹ to Ile⁵, an extended -helix forming a central core from Phe⁶ to Val²⁶, and a short helical tail from Arg²⁹ to Arg³⁴ in the C terminal. The C-terminal helix is located after a hinge at Leu²⁷ to Gly²⁸ and is absent in the solution structures of PACAP₂₇. The 3-D conformations of grass carp PACAPs are similar to that of mammalian PACAPs, except that the random structures in the N terminal (His¹ to Ile⁵) are much reduced compared with the mammalian counterpart (His¹ to Asp⁸) (19) and that the structural discontinuity at Lys²⁰ to Lys²¹ reported in the central cores of mammalian PACAP₂₇ and PACAP₃₈ (17) is not evident in the fish PACAPs. Furthermore, spatial overlap of the side chains of Arg¹² and Gln¹⁶ with Lys³⁸ in grass carp PACAP₃₈ leads to the formation of a ring-like structure by the central -helix and C-terminal helical tail. This ring-like structure is unique and has not been reported in the mammalian counterparts.

The structure-activity relationship in mammalian PACAP has been extensively studied. Apparently the three structural domains identified in PACAP₃₈ form three anchorage sites for the receptors and any two of the three can lead to high-affinity binding (18). The hydrophilic residues Lys²⁰ to Lys²¹ in the central helical core are involved in ligand-receptor interactions. Their replacement by Gly²⁰ and Gly²¹, alone or in combination, can markedly reduce the binding affinity of the resulting peptides (49). The N terminal of PACAP, besides its role in receptor binding, is also required for activating postreceptor signaling, e.g. stimulation of adenylate cyclase (50), and N-terminal truncation (e.g. PACAP_6–38) can lead to the formation of high affinity competitive antagonists (51). Because the structural modifications observed in grass carp PACAPs occur at those locations known to affect receptor binding and signal transduction, it is conceivable that molecular interactions between PACAP and its receptors in fish models may be different from that of mammals.

In mammals, inconsistency in NMR structures for PACAP₂₇ has been reported regarding the presence of a ß-turn from Ser⁹ to Arg¹² (15). Our NMR structures based on fish PACAP₂₇ are more comparable with the previous report by Wray et al. (17) and do not support the presence of a ß-turn in the positions from Ser⁹ to Arg¹². In this study, the surface plots of PACAP₂₇ and PACAP₃₈ have reported for the first time and revealed that the helical structures of fish PACAPs are amphipathic in nature with basic residues clustered largely onto one side. In class B G protein-coupled receptors, including the receptors for PACAP and VIP, it is generally accepted that the N-terminal domain of these receptors via a network of disulfide bridges forms a negatively charged binding groove, which can act as an affinity trap to bind with the basic residues in the C terminal of the ligand (52). Subsequent binding of the N terminal of the ligand with the J-domains of the seven membrane-spanning -helices [or transmembrane domains (TMD)] of the receptor can lead to receptor activation and signal transduction (53). For VPAC1 receptors, which can also bind PACAP with high affinity (54), the basic residues in the central core of VIP have been shown to interact with the acidic residues in the electronegative binding groove in the N terminal of the receptor (55).

These previous findings have prompted us to speculate that the basic surface of the helical structures in fish PACAPs may be crucial for receptor interaction. In a recent study with PACAP₂₁, a truncated PACAP with only the first 21-a.a. residues, it has been shown that a ß-coil can be formed by two overlapping ß-turns in the N terminal from Asp³ to Thr⁷ during the process of receptor binding (19). This ß-coil forms the basis of a two-step ligand transportation model for receptor activation. In this model, PACAP comes into close proximity of the plasma membrane to acquire its 3-D structures under a hydrophobic environment and diffuses laterally on the surface to find its receptors. Upon receptor binding, conformational change occurs in the N terminal and the resulting ß-coil creates a hydrophobic patch for specific interactions and subsequent activation of PACAP receptors. As revealed by the 3-D modeling based on the average structures of fish PACAPs, a similar ß-coil composed of two ß-turns, namely a type I ß-turn from Gly⁴ to Thr⁷ and a type II' ß-turn from Asp³ to Phe⁶, can also be formed in the flexible N terminal of grass carp PACAP₃₈. This ß-coil not only can form a hydrophobic patch as reported in PACAP₂₁ (19) but also constitute a negatively charged hydrophilic pocket on the other side by clustering of Asp³ and Asp⁸. To our knowledge, the negatively charged pocket has not been reported in the 3-D structure of mammalian PACAPs. In VPAC receptors, the basic residues close to or located in the extracellular regions of TMD₁ (Lys¹⁴³) and TMD₂ (Arg¹⁸⁸ and Lys¹⁹⁵) are essential for VIP binding (55). Similar basic residues can also be noted in the juxtamembrane region of TMD₁ (Lys²¹¹), TMD₂ (Lys²⁶³), TMD₃ (Lys²⁸⁴), and TMD₄ (Arg³⁴⁵) in type I PACAP receptors (or PAC-I receptors), and these residues appear to be well conserved from fish to mammals (24). Because the N terminal of mammalian PACAPs, especially the first three resides including His¹, Ser², and Asp³, are involved in receptor binding and activation of adenylate cyclase (49), we do not exclude the possibility that the N terminal of fish PACAP₃₈ may interact with the basic residues in PACAP receptor, through the negatively charged pocket in the ß-coil structure to trigger receptor activation and signal transduction.

Because mammalian PACAPs can act as a potent GH secretagogue in fish (41) and PACAP has been proposed to be the ancestral GHRH in lower vertebrates (27), the biological activities of grass carp PACAP₂₇ and PACAP₃₈ were also tested in vitro in pituitary cells prepared from 1-yr-old grass carp. Similar to our recent studies using ovine PACAP₃₈ (28), grass carp PACAP₂₇ and PACAP₃₈ were both effective in triggering GH release and GH mRNA expression by acting directly at the pituitary level. These stimulatory effects, however, were not mimicked by GHRH-LP, which is supposed to be the grass carp GHRH. In general, it is commonly accepted that GHRH is not a major GH-releasing factor in amphibian and fish models (27). In previous studies, a lack of GH-releasing effect for GHRH has been reported in fish species, including turbot (56) and European eel (25). Parallel to their actions on GH release and GH mRNA expression, grass carp PACAPs also induced cAMP production and Ca²⁺ influx through VSCC in carp pituitary cells. These results are consistent with the findings that the GH-releasing actions of PACAP in fish pituitary cells, e.g. in goldfish (41) and common carp (26), are mediated by type I PACAP receptors coupled to cAMP/protein kinase A- and Ca²⁺/calmodulin kinase II-dependent signaling cascades. Recently we have shown that ovine PACAP₃₈ could up-regulate the nuclear expression of GH primary transcripts in carp pituitary cells and this stimulatory effect occurred with parallel rises in cytosolic mature GH mRNA and cellular GH content (28). These findings indicate that PACAP may activate GH synthesis at the pituitary level by stimulating GH gene transcription. This idea is supported by the results of our transfection studies, in which grass carp PACAP₂₇ and PACAP₃₈ could elevate GH promoter activity in a time- and dose-dependent manner. Using 5' deletion analysis, the promoter sequence responsible for the stimulatory effects by PACAPs was mapped to the region downstream of position –115 in the grass carp GH promoter (Zhou, H., Y. Jiang, and A. O. L. Wong, unpublished data).

When compared with its truncated form, PACAP₂₇, grass carp PACAP₃₈ was consistently found to be more potent and with a higher efficacy in terms of GH secretion, GH gene expression, cAMP production, and [Ca²⁺]i responses. Based on the extensive studies in mammals using structural analogs of PACAP₂₇ and PACAP₃₈, it is commonly accepted that the C-terminal helical tail in PACAP₃₈ can facilitate receptor recognition but is not essential for high-affinity binding (50). Because the expression level of PACAP receptors in the carp pituitary is quite low and cannot be used for radioreceptor binding studies (our unpublished data), it remains to be determined whether PACAP₂₇ and PACAP₃₈ have different affinity for the type I (or PAC-I) PACAP receptors expressed in carp somatotrophs. However, the differential responses to PACAP₂₇ and PACAP₃₈ observed in grass carp pituitary cells are highly comparable with that of type IB PACAP receptors previously reported in mammals. In the rat, type IB PACAP receptors have been identified in the cerebral cortex (57) and anterior pituitary (33). Unlike type IA PACAP receptors with equal affinity for the two forms of PACAPs, type IB PACAP receptors can bind PACAP₃₈ with an affinity 10- to 100-fold greater than that for PACAP₂₇ (38). Although type I PACAP receptors have been cloned in fish models, e.g. goldfish (24) and zebrafish (39), structural evidence to support the presence of two subtypes of type I (or PAC-I) PACAP receptors is still lacking. Further investigations are clearly warranted to study the functional role of pituitary type IB PACAP receptors in GH regulation.

	Acknowledgments

 
This series of papers on the role of PACAP as a GH-releasing factor in fish is dedicated to Dr. R. E. Peter (University of Alberta, Edmonton, Canada), who passed away on March 8, 2007. His sense of humor and genuine