Endocrinology, doi:10.1210/en.2007-0368
Endocrinology Vol. 148, No. 11 5377-5384
Copyright © 2007 by The Endocrine Society
Chorionic Gonadotropin Down-Regulates the Expression of the Decoy Inhibitory Interleukin 1 Receptor Type II in Human Endometrial Epithelial Cells
Catherine Herrmann-Lavoie,
C. V. Rao and
Ali Akoum
Unité dendocrinologie de la reproduction (C.H.-L., A.A.), Centre de Recherche, Hôpital Saint-François dAssise, Centre Hospitalier Universitaire de Québec, Faculté de Médecine, Université Laval, Québec, Canada G1L 3L5; and Department of Obstetrics (C.V.R.), Gynecology & Womens Health, University of Louisville Health Sciences Center, Louisville, Kentucky 40292
Address all correspondence and requests for reprints to: Dr. Ali Akoum, Laboratoire dEndocrinologie de la Reproduction, Centre de Recherche, Hôpital Saint-François dAssise, 10 rue de lEspinay, Local D0-711, Québec, Québec, Canada G1L 3L5. E-mail: ali.akoum{at}crsfa.ulaval.ca.
 |
Abstract
|
|---|
Secretion of embryonic IL-1β seems to be the first response of the blastocyst to receptive endometrium, inducing molecular changes that are essential for attachment of the blastocyst. Here, we report that human chorionic gonadotropin (hCG), a glycoprotein hormone that plays a critical role in the initiation and maintenance of pregnancy, markedly down-regulates the expression of the decoy inhibitory IL-1 receptor type II (IL-1R2) in human endometrial epithelial cells. Treatment with hCG resulted in a dose-dependent decrease in IL-1R2 soluble and membrane bound protein forms and mRNA steady-state levels, whereas no significant effect on the expression of the activating IL-1 receptor type I (IL-1R1) was seen. Cell infection with the wild-type human LH/chorionic gonadotropin receptor corroborated the aforementioned data, whereas cell infection with the constitutively activated LH chorionic gonadotropin receptor led to similar effects on IL-1R2 and IL-1R1 expression without hCG treatment. Cloning of human IL-1R2 gene promoter in the pGL3 luciferase reporter vector and transient transfection experiments further showed a significant dose-dependent diminution of IL-1R2 promoter activity in response to hCG. These data suggest that hCG, by down-regulating the expression of IL-1R2, a potent and specific inhibitor of IL-1, without affecting the expression of the functional activating IL-1R1, diminishes the ability of endometrial epithelial cells to counterbalance the local effects of IL-1, making these cells probably more responsive to the cytokine. In view of IL-1s role as an embryonic signal, these data reveal a new mechanism by which hCG sustains human pregnancy and promotes embryonic growth.
 |
Introduction
|
|---|
HUMAN CHORIONIC gonadotropin hormone (hCG), a heterodimeric glycoprotein hormone, is one of the major and earliest embryonic signals. hCG is mainly produced by the syncytiotrophoblasts in the chorionic villi. In normal pregnancy it is detectable in maternal serum as early as 1 d after the initiation of embryo implantation, and its concentration rapidly increases, reaching a peak at about the 6 wk, and then gradually decreases during the second trimester (1).
The main role of hCG is to stimulate the corpus luteum in the ovary to produce progesterone and maintain embryo implantation (2). However, newest evidence showed a wide spectrum of cell targets and biological properties by which hCG plays a crucial role in the implantation and growth of human embryo. Interestingly, the human LH/chorionic gonadotropin receptor (hLHCGR) was detected in nongonadal human reproductive tissues (3). The human endometrium, the natural host site where the embryo implants and develops, was shown to contain functional membrane bound (mb)-hLHCGRs, which were detected in glandular and luminal epithelial cells, as well as in stromal cells (4, 5). Further studies demonstrated that hCG promotes the decidualization of human endometrial stromal cells (6). It is now well documented that hCG directly modulates numerous endometrial functions, thereby promoting endometrial receptivity, as well as the implantation and growth of human embryo (3). For instance, hCG has been shown to possess intrinsic angiogenic properties (7), and promote the production of angiogenic and tissue remodeling factors such as vascular endothelial growth factor by the placenta (8) and decidual macrophages (7), and macrophage migration inhibitory factor by human endometrial cells (9).
Implantation of human embryo is dependent upon interaction between blastocyst and endometrium, and involves a complex process of tissue remodeling. Deep morphological, structural, and functional changes occurring within the uterus, particularly in the endometrium, are orchestrated by embryonic and maternal factors/signals that facilitate and enable embryonic attachment, invasion, and growth (10). One of these cytokines is IL-1, a major inflammatory cytokine found at the fetomaternal interface and considered as an embryonic signal (11, 12). IL-1 is secreted by trophoblastic and decidualized cells (13, 14, 15). IL-1 receptor (IL-1R) is found in endometrial epithelial cells (EECs) and trophoblasts (12, 16). The role of IL-1 in implantation has been well documented. The cytokine was shown to increase endometrial secretion of prostaglandin estradiol and leukemia inhibitory factor, the expression of integrin β3 subunit (17, 18, 19), and to stimulate matrix metalloproteinase-9 activity in trophoblasts (20). Blockade of IL-1 receptor type I (IL-1R1) by IL-1 receptor antagonist (IL-1RA), a natural antagonist of IL-1, inhibited the implantation in mouse (21), which further stresses the important role of IL-1 in implantation.
IL-1 has two known receptors, now designated as IL-1R1, IL-1 receptor type II (IL-1R2), and IL-1RA, which competes with IL-1 for binding to IL-1R1. Cell activation by IL-1 results from its binding to cell surface IL-1R1, which is capable of transducing the activation signal in concert with IL-1R accessory protein (22). IL-1R2, in contrast, has no signaling properties but has recently been described as a "decoy receptor." The extracellular domain of the receptor can be shed from the cell surface as a soluble molecule, which is capable of capturing IL-1, thus preventing its interaction with the functional receptor. These studies suggest that IL-1R2 plays an important physiological role in the regulation of IL-1 action in the inflammation sites (22, 23, 24, 25).
The present study showed that hCG acts directly on EECs to down-regulate the synthesis and release of IL-1R2, a decoy receptor that is known for counterbalancing IL-1-mediated cell activation, without affecting the functional activating IL-1R1. In view of IL-1s immunomodulatory, proangiogenic, and tissue remodeling properties and its role as embryonic signal, it is quite plausible that modulation of cell receptivity to IL-1 represents an important mechanism of hCG-induced endometrial changes during embryo implantation, growth, and development.
 |
Materials and Methods
|
|---|
Subjects and tissue handling
Tissue specimens were obtained from normal fertile women with a regular menstrual cycle who underwent laparoscopy for tubal ligation and had not received hormonal or antiinflammatory therapy for at least 3 months before surgery (mean age ± SD, 37.6 ± 6.5 yr; n = 23). Seven women were in the proliferative phase of the menstrual cycle and 16 in the secretory phase. The cycle phase was determined according to the histological criteria of Noyes et al. (26). A written informed consent was obtained from these women under a study protocol approved by the Ethical Committee on Human Research at Laval University, Quebec, Canada. Endometrial biopsies were obtained by aspiration with the use of a Pipelle (Unimar Inc., Prodimed, Neuilly-En-Tchelle, France). They were immediately placed at 4 C in sterile Hanks balanced salt solution containing 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin (Invitrogen Life Technologies, Burlington, Ontario, Canada) and transported to the laboratory.
Cell culture and treatment
EECs were obtained and characterized according to our previously described procedure (27). Extensive characterization of cell cultures prepared using this protocol previously confirmed more than 95% purity with cells retaining cytoskeletal markers of their endometrial epithelial origin. Cells were cultured in Dulbeccos modified essential medium-F12 medium supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin (Invitrogen). At confluence, the complete medium was discarded and replaced overnight with FBS-free medium, and cells were cultured for additional periods of time (0–24 h) with fresh FBS-free medium containing different concentrations of hCG (0–1 µg/ml) (recombinant expressed in mouse cell line, 10,000 IU/mg; Sigma Chemical Co., St. Louis, MO). hCG-induced IL-1R2 and IL-1R1 protein expression was evaluated by ELISA in the culture medium for the soluble receptors and Western blotting for the mb receptors, whereas mRNA was evaluated by real-time PCR.
Preparation of adenoviral particles containing hLHCGR gene, infection, and treatment of EECs
Adenoviral stocks containing native or constitutively activated mutant (hLHCGR-D578H) human hLHCGR were gifts from Dr. Anthony J. Zeleznik (University of Pittsburgh School of Medicine, Pittsburgh, PA) (28). They were propagated by infecting the HEK293 cells. Primary EECs in culture were infected either with adeno-native hLHCGR or adeno-hLHCGR-D578H viruses for 48 h. The infected cells were then incubated for 24 h with either no hCG or with varying concentrations of hCG (0–1 µg/ml).
Immunocytofluorescence
Cells were plated onto Lab-Tek 8-chamber slides (Nalge Nunc International, Naperville, IL), infected with adeno-native hLHCGR viruses for 48 h and fixed for 15 min at room temperature in 95% cold ethanol. Cultures were then rinsed three times in PBS/0.1% Tween 20, incubated for 90 min at room temperature with polyclonal anti-hLHCGR rabbit antibody (1:300 dilution in PBS/0.1% Tween 20) (primary antibody), rinsed three times with PBS/0.1% Tween 20, and incubated for 90 min at room temperature with a biotin-conjugated goat antirabbit IgG (heavy and light chains) (Jackson ImmunoResearch Laboratories Inc., West Grove, PA) (1:1000 dilution in PBS/0.2% BSA/0.1% Tween 20), then for 45 min at room temperature with Alexa 488-labeled streptavidin (1:100 dilution in PBS/0.2% BSA) (Molecular Probes Inc., Eugene, OR). Cells were finally counterstained with 4',6-diaminido-2-phenyl-indole (1:2000 dilution in PBS/0.1% Tween 20) and covered with mounting medium (Mowiol containing 10% para-phenylenediamine, an antifading agent; Sigma). Cells incubated without the primary antibody or with rabbit immunoglobulins (Sigma) at the same concentration as the primary antibody were included as negative controls. Slides were observed under a microscope equipped for fluorescence (Olympus BX51; Olympus Corp., Tokyo, Japan) and photographed. The intensity of hLHCGR immunostaining in infected and noninfected cells was determined in four different and randomly selected areas using Image-Pro Express 5.1 software (Media Cybernetics Inc., Bethesda, MD). The number of infected cells in which the intensity of immunostaining was equivalent to or above the control (immunostaining of noninfected cells) was also counted in four different and randomly selected areas.
IL-1R1 and IL-1R2 ELISA
IL-1R2 concentrations were measured using our previously reported procedure (29). IL-1R1 concentrations were measured according to a similar procedure but with the use of a mouse monoclonal antihuman IL-1R1 antibody for coating (500 ng/well in PBS/0.5% BSA) and a goat polyclonal antihuman IL-1R1 antibody (1 µg/ml in PBS/0.5% BSA; R&D Systems, Minneapolis, MN) for detection. IL-1R1 and IL-1R2 concentrations were calculated by interpolation from standard curves.
Quantitative real-time PCR
Total RNA was extracted from epithelial cells with TRIZOL reagent (Invitrogen) according to the manufacturers instructions. For synthesized cDNA, we used 100 ng total cellular RNA and 2.5 µM random hexamer (Roche Diagnostics, Laval, Québec, Canada) in 20 µl of a RT-PCR solution [1 x buffer (QIAGEN, Santa Clarita, CA), 6.5 mM MgCl2 (QIAGEN), 1 mM of each deoxynucleotide triphosphate (Applied Biosystems, Foster City, CA), 1 U RNase inhibitor (Roche Diagnostics), and 1 U reverse transcriptase (Roche Diagnostics)]. The reaction was incubated at 25 C for 15 min, 42 C for 30 min, and 99 C for 5 min, respectively.
Quantitative real-time PCRs were performed in an ABI 7000 Thermal Cycler (Applied Biosystems). Each standard PCR contains 2 µl RT product, 0.5 µl of each primer (final concentration, 0.1 µM), 12 µl sterilized water, 12.5 µl SYBR Green PCR Master Mix (Eurogentec, San Diego, CA) consisting of Taq DNA polymerase reaction buffer, deoxynucleotide triphosphate mix, SYBR Green I, MgCl2, and Taq DNA polymerase. After a 95 C denaturation for 10 min, the reactions were cycled 40 times with a 95 C denaturation for 15 sec and a 60 C annealing for 60 sec for IL-1R2, IL-1R1, or glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primers for IL-1R2 (forward, 5'-TGGCACCTACGTCTGCACTACT-3'; reverse, 5'-TTGCGGGTATGAGATGAACG-3', accession no. NM173343), IL-1R1 (forward, 5'-AGAGGAAAACAAACCCACAAGG-3'; reverse, 5'-CTGGCCGGTGACATTACAGAT-3', accession no. NM000877), and GAPDH (forward, 5'-CAGGGCTGCTTTTAACTCTGG-3'; reverse, 5'-TGGGTGGAATCATATTGGAACA-3', accession no. NM002046) were designed using Primer Express, version 2.0 (Applied Biosystems). The primers were designed to span intron-exon boundaries to avoid amplification of genomic DNA. Quantification of IL-1R2 and IL-1R1 mRNA was performed using a relative quantification method. For each experimental sample, IL-1R2 and IL-1R1 mRNA levels were normalized to GAPDH mRNA levels. After each run, melting curve analysis (55–95 C) was performed to verify the specificity of the PCR. All samples were tested in duplicate, each run including a no-RT control.
IL-1R1 and IL-1R2 Western blotting
Protein extraction, SDS-PAGE, and transfer onto nitrocellulose membranes were performed as we reported previously (30). Briefly, a goat polyclonal antihuman IL-1R1 (2 µg/ml in PBS containing 1% BSA and 0.1% Tween 20) or a goat polyclonal antihuman IL-1R2 antibody (R&D Systems) (2 µg/ml in PBS/1% BSA/0.1% Tween 20) was used for detection, followed by Fc-specific peroxidase-labeled rabbit antigoat antibody (Jackson ImmunoResearch Laboratories Inc.) (1:10000 dilution in PBS/1% BSA/0.1% Tween 20), and enhanced chemiluminescence system (BM chemiluminescence blotting substrate, POD) (Roche Diagnostics), respectively. Membranes were exposed to Biomax film (Eastman Kodak, Rochester, NY). Controls included recombinant human soluble (rhs) IL-1R1 and IL-1R2 (R&D Systems), used as positive controls, incubation with equivalent concentrations of normal goat IgGs, preabsorption of the primary anti-IL-1R1 and anti-IL-1R2 antibodies with 5 µg/ml (0.09 µM) of rhsIL-1R1 and 5 µg/ml (0.11 µM) of rhsIL-1R2, respectively. Membranes were reblotted with an anti-
-actin antibody (1:1000 dilution in PBS/1% BSA/0.1% Tween 20; Iowa University developmental studies hybridoma bank) to ensure equal protein loading.
IL-1R2 promoter construct
Human IL-1R2 gene promotor region was amplified by PCR from the BAC (bacterial artificial chromosome) clone RP11–353P23 obtained from BACPAC (BAC P1-derived artificial chromosome) Resources center at the Childrens Hospital Oakland Research Institute (Oakland, CA). For the amplification step, oligonucleotides BRIIF (forward: GCTGCTAGCCCAGGAGGAATCTCATTTGG) and BRIIR (reverse: GCTAAGCTTTAGGGGAAAGACAGCCAATCA; accession no. AC005035) were used. The amplified band [total size of 2329 bp, representing a region localized upstream of exon 1B, as identified by Sims et al. (31)] was then cloned in the luciferase reporter pGL3 basic-vector (Promega, Madison, WI), between the NheI and HindIII sites (underlined). The construct was then isolated using calcium-chloride competent BL21 Escherichia coli strain under selective conditions (ampicillin, 50 µg/ml in luria-bertani broth medium), and purified by plasmid maxi kit (QIAGEN, Mississauga, Ontario, Canada). The entire IL-1R2 promoter clone B7 DNA sequence was verified on an ABI prism 3100 sequencer (Applied Biosystems) using oligonucleotides BRIIF or BRIIR and showed no DNA mutation.
Transfections and luciferase assays
EECs were cultured in DMEM-F12 medium supplemented with 10% FBS and 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin (Invitrogen). At 80–90% of confluence, transfections were performed in triplicate in 24-well plates using Plus Reagent and Lipofectamine (Invitrogen), as described by the manufacturer. Cells were transiently transfected with 0.2 µg human IL-1R2 promoter construct in the pGL3 luciferase reporter vector (pGL3-IL-1R2) or with the control vector pGL3. Cells were then washed with PBS, and incubated overnight in the culture medium containing 10% FBS and 100 U/ml penicillin, 100 µg/ml streptomycin, and 0.25 µg/ml amphotericin before they were stimulated with hCG (0–1 µg/ml) for 24 h (predetermined stimulation time for hCG-mediated IL-1R2 regulation in EECs) (data not shown). Cell extracts were assayed for firefly and renilla luciferase activities using the dual luciferase reporter assay system (Promega), as instructed by the manufacturer.
Statistical analysis
Data followed a parametric distribution and were, therefore, expressed as mean ± SEM. An unpaired t test was used for comparing the means of two groups, and one-way ANOVA followed by the Dunnett test were used for multiple comparisons. Differences were considered statistically significant whenever a P value less than 0.05 occurred. All analyses were performed using GraphPad Software, Prism 3.0 (GraphPad Software, San Diego, CA).
 |
Results
|
|---|
Epithelial cells were first examined for soluble IL-1 receptor type II (sIL-1R2) and soluble IL-1 receptor type I (sIL-1R1) release in response to hCG. Thus, cell cultures were exposed to different concentrations of hCG (0–1 µg/ml) for 24 h, and sIL-1R2 and sIL-1R1 were measured by ELISA. Our data showed a spontaneous release of sIL-1R2 in the culture medium devoid of any stimulus (control) and that hCG decreased sIL-1R2 concentrations in a dose-dependent manner (Fig. 1
). A statistically significant decrease in sIL-1R2 levels at 0.01 (P < 0.05), 0.1 (P < 0.01), and 1 (P < 0.01) µg/ml hCG was noted. sIL-1R1 was undetectable by ELISA in the culture supernatants of EECs whether treated or not with hCG (data not shown).

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1. Effect of hCG on sIL-1R2 release by EECs. Cells grown to confluence were incubated for 24 h with 0–1 µg/ml hCG. sIL-1R2 release in the culture supernatant was evaluated by ELISA and expressed as percentage (%) of the control (the ratio of sIL-1R2 protein concentration in the presence of hCG to that found in the culture medium devoid of any stimulus). Data are means ± SEM from four cultures of secretory phase endometrial tissues. *, P < 0.05 and **, P < 0.01 compared with the control.
|
|
As sIL-1R2 and sIL-1R1 are released from the cell membrane receptors by proteolytic cleavage, we then assessed mb-IL-1 receptors in response to hCG. Western blot analyses showed a significant decrease in mb-IL-1R2 in cultures exposed to 0.01, 1, and 1 µg/ml hCG (P < 0.01) (Fig. 2
, A and D). However, no change in mb-IL-1R1 in the same cultures was noted (Fig. 2
, B and E). Furthermore, the ratio of mb-IL-1R2 to mb-IL-1R1 levels was significantly decreased in response to 0.01 (P < 0.01), 0.1 (P < 0.01), and 1 (P < 0.05) µg/ml hCG (Fig. 2C
).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2. Effect of hCG on mb-IL-1R2 and mb-IL-1R1 by EECs. Cells grown to confluence were incubated for 24 h with 0–1 µg/ml hCG. Cells were recovered, and total proteins were extracted and analyzed by SDS-PAGE and Western blotting. The relative intensity of mb-IL-1R2 (A) and mb-IL-1R1 (B) bands to that of corresponding β-actin bands was determined by densitometric analysis, and data were expressed as percentage (%) of the control (the ratio of mb-IL-1R protein level in the presence of hCG to that found in the presence of the culture medium devoid of any stimulus). C, The ratio of mb-IL-1R2 to mb-IL-1R1 levels was determined and expressed as percentage (%) of the control. Data are means ± SEM from three cultures of secretory phase endometrial tissues. *, P < 0.05 and **, P < 0.01 compared with the control. Representative Western blots for IL-1R2 and IL-1R1 (D and E, respectively) are shown. rhR, Recombinant human receptor.
|
|
We then infected epithelial cells with adeno-native hLHCGR or adeno-hLHCGR-D578H viruses (constitutively activated) to examine the implication of hLHCGR activation in hCG-mediated IL-1R2 and IL-1R1 regulation, and further evaluate endometrial cell response to hCG. Infected cells express higher levels of LHCGR compared with noninfected cells, as assessed by immunocytofluorescence. A representative photomicrograph of LHCG immunostaining is shown in Fig. 3A
. Quantitative analysis showed that the intensity of LHCG immunostaining was significantly higher in infected cells compared with noninfected control cells (P < 0.01) (Fig. 3B
). Cell counting further showed that infected cultures had a significantly higher percentage of cells in which the intensity of staining was above the control (P < 0.01) (Fig. 3C
). Treatment with hCG (0–1 µg/ml) for 24 h resulted in a dose-dependent decrease in sIL-1R2 (Fig. 4
); a statistically significant decrease in sIL-1R2 levels was found at 0.01 (P < 0.05), 0.1 (P < 0.01), and 1 (P < 0.01) µg/ml hCG. mb-IL-1R2 levels also significantly decreased at 0.1 (P < 0.05) and 1 (P < 0.01) µg/ml hCG (Fig. 5
, A and D). Furthermore, cell infection with the constitutively activated hLHCGR receptor led to a significant decrease in sIL-1R2 (P < 0.01) (Fig. 4
) and mb-IL-1R2 (P < 0.01) (Fig. 5
, A and D), thereby demonstrating the involvement of hLHCGR activation in IL-1R2 down-regulation. However, no sIL-1R1 was detected in the culture medium of hCG-treated and untreated cells, and no statistically significant change in mb-IL-1R1 was observed (Fig. 5
, B and E). Analysis of the ratio of mb-IL-1R2 to mb-IL-1R1 levels showed a significant decrease in cells treated with 0.01, 0.1, and 1 µg/ml hCG (P < 0.01), as well as in cells infected with the constitutively activated hLHCGR (P < 0.05) (Fig. 5C
).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3. Immunocytofluorescence analysis of hLHCGR in EECs. Cells cultured in chamber slides were infected with adeno-native hLHCGR virus for 48 h. hLHCGR was detected using successively a specific rabbit polyclonal anti-hLHCGR antibody, a biotin-conjugated goat antirabbit IgGs, and Alexa 488-labeled streptavidin. Cells were counterstained with 4',6-diaminido-2-phenyl-indole (blue). Note the increase in the intensity of staining (green) in infected (a) compared with noninfected (b) EECs (secretory phase). A, Staining was virtually absent in the presence of rabbit IgGs used instead of the primary rabbit anti-hLHCGR antibody in infected (c) and noninfected (d) cultures. B, The intensity of hLHCGR immunostaining in infected cells was determined and expressed as percentage (%) of the control (immunostaining intensity in noninfected cells). C, The percentage (%) of infected cells with immunostaining intensity equivalent to or above the control was determined. Data are means ± SEM from three endometrial cell cultures, one from proliferative phase endometrial tissue and two from secretory phase tissues. **, P < 0.01 compared with noninfected control cells (B) or with infected cells with immunostaining intensity equivalent to the control (C). Scale bar, 30 µm.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4. Effect of hCG on sIL-1R2 release by EECs after overexpression of hLHCGR. Cell cultures were infected for 48 h either with adeno-native hLHCGR virus or adeno-hLHCGR-D578H virus, which bears the mutated constitutively activated hLHCGR (Mt). The infected cells were then incubated for 24 h with either no hCG or with varying concentrations of hCG (0–1 µg/ml). sIL-1R2 release in the culture supernatant was evaluated by ELISA and expressed as percentage (%) of the control (the ratio of sIL-1R2 protein concentration in the presence of hCG to that found in the culture medium devoid of any stimulus). Data are means ± SEM from four endometrial cell cultures, three from proliferative phase endometrial tissues and one from secretory phase tissues. *, P < 0.05 and **, P < 0.01 compared with the control.
|
|

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5. Effect of hCG on mb-IL-1R2 and mb-IL-1R1 by EECs after overexpression of hLHCGR. Cell cultures were infected for 48 h either with adeno-native hLHCGR virus or adeno-hLHCGR-D578H virus, which bears the mutated constitutively activated hLHCGR (Mt). The infected cells were then incubated for 24 h with either no hCG or with varying concentrations of hCG (0–1 µg/ml). Cells were recovered, and total proteins were extracted and analyzed by SDS-PAGE and Western blotting. The relative intensity of mb-IL-1R2 (A) and mb-IL-1R1 (B) bands to that of corresponding β-actin bands was determined by densitometric analysis, and data were expressed as percentage (%) of the control (the ratio of mb-IL-1R protein level in the presence of hCG to that found in the presence of the culture medium devoid of any stimulus). C, The ratio of mb-IL-1R2 to mb-IL-1R1 levels was determined and expressed as percentage (%) of the control. Data are means ± SEM from three endometrial cell cultures, one from proliferative phase endometrial tissue and two from secretory phase tissues. *, P < 0.05 and **, P < 0.01 compared with the control. Representative Western blots for IL-1R2 and IL-1R1 (D and E, respectively) are shown. rhR, Recombinant human receptor.
|
|
Based on these data, we then investigated hCG effect on IL-1R2 mRNA expression. Quantitative real-time PCR analysis showed a significant dose-dependent decrease in IL-1R2 mRNA steady-state levels in response to hCG, reaching statistically significant differences at 0.1 (P < 0.01) and 1 (P < 0.01) µg/ml hCG (Fig. 6A
). hCG had no statistically significant effect on IL-1R1 mRNA levels, as shown in Fig. 6B
. However, the ratio of IL-1R2 to IL-1R1 mRNA levels was significantly decreased at 1 µg/ml hCG (P < 0.01) (Fig. 6C
). Overexpression of hLHCGR by infecting epithelial cells with adeno-native hLHCGR corroborated the aforementioned data. A significant down-regulation of IL-1R2 mRNA levels in cell exposed to 0.1 and 1 µg/ml hCG (P < 0.01) was observed, and infection with the constitutively activated adeno-hLHCGR-D578H virus resulted in a significant decrease in IL-1R2 mRNA compared with the control (P < 0.01). This is in keeping with the protein data and further supports a role for LGCGR activation (Fig. 7A
). No change in IL-1R1 mRNA levels in response to varying hCG concentrations in cells infected with adeno-native hLHCGR or constitutively activated adeno-hLHCGR-D578H viruses was noted (Fig. 7B
). However, a significant decrease was found in the ratio of IL-1R2 to IL-1R1 mRNA levels in cells exposed to 0.01 (P < 0.05), 0.1 (P < 0.05), and 1 (P < 0.01) µg/ml hCG, and in cells infected with the constitutively activated hLHCGR (P < 0.01).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 6. Effect of hCG on IL-1R2 and IL-1R1 mRNA levels by EECs. Cells grown to confluence were incubated for 24 h with 0–1 µg/ml hCG, and recovered to extract total cellular RNA and evaluate IL-1R2 (A) and IL-1R1 (B) mRNA expression by real-time PCR. mRNA levels were expressed as percentage (%) of the control (the ratio of IL-1R2 or IL-1R1 mRNA levels in the presence of hCG to that found in the presence of the culture medium alone). C, The ratio of IL-1R2 to IL-1R1 mRNA levels was determined and expressed as percentage (%) of the control. Data are means ± SEM from three cultures of secretory phase endometrial tissues. **, P < 0.01 compared with the control.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 7. Effect of hCG on IL-1R2 and IL-1R1 mRNA levels by EECs after overexpression of hLHCGR. Cell cultures were infected for 48 h either with adeno-native hLHCGR virus or adeno-hLHCGR-D578H virus, which bears the mutated constitutively activated hLHCGR (Mt). The infected cells were then incubated for 24 h with either no hCG or with varying concentrations of hCG (0–1 µg/ml). Cells were then recovered to extract total cellular RNA and evaluate IL-1R2 (A) and IL-1R1 (B) mRNA expression by real-time PCR. mRNA levels were expressed as percentage (%) of the control (the ratio of IL-1R2 or IL-1R1 mRNA levels in the presence of hCG to that found in the presence of the culture medium alone). C, The ratio of IL-1R2 to IL-1R1 mRNA levels was determined and expressed as percentage (%) of the control. Data are means ± SEM from four endometrial cell cultures, one from proliferative phase endometrial tissue and three from secretory phase tissues. *, P < 0.05 and **, P < 0.01 compared with the control.
|
|
To determine further whether hCG can interfere with IL-1R2 gene transcription, a human IL-1R2 gene promotor sequence (2331 bp) representing a region localized upstream of exon 1B, as identified by Sims et al. (31), was amplified and cloned in the luciferase reporter pGL3 basic vector. The transcriptional activity of the IL-1R2 promoter-luciferase construct in the presence and absence of hCG was evaluated after transfection with the IL-1R2 promoter construct or with the pGL3 luciferase reporter vector as a control. As shown in Fig. 8
, the activity of IL-1R2 promoter was significantly reduced in EEC cultures exposed to hCG. A dose-dependent diminution of IL-1R2 promoter activity was noted with statistically significant differences observed at 0.01, 0.1, and 1 µg/ml hCG (P < 0.01), whereas no change in cells transfected in parallel with the plasmid vector alone was noted.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 8. Effects of hCG on IL-1R2 promoter activity. The human IL-1R2 gene promoter (accession no. AC005035) region was amplified by PCR, then cloned in the luciferase reporter pGL3 basic vector as described in Materials and Methods. Human EECs were transiently transfected with pGL3-IL-1R2 or the control vector pGL3. The transfected cells were then incubated for 24 h with and without varying concentrations of hCG (0–1 µg/ml) before being harvested. Cell lysates were analyzed for firefly and renilla luciferase activities as described in Materials and Methods. Data are expressed as number (%) of the controls (IL-1R2 promoter activity in cells transfected with pGL3-IL-1R2 and incubated with the culture medium alone). The bars represent means ± SEM. Data are means ± SEM from three endometrial cell cultures, two from proliferative phase endometrial tissues and one from secretory phase tissue. **, Significant increase in IL-1R2 promoter activity in response to hCG compared with the culture medium (P < 0.01).
|
|
 |
Discussion
|
|---|
Molecular interactions at the embryo-maternal interface during the time of adhesion and subsequent invasion are crucial to the process of embryonic implantation. Available data indicate that the embryo participates intensively in this early embryo-maternal signaling. hCG represents one of the major and earliest embryonic signals, and seems to influence endometrial activity, not only through its endocrine effects via rescue of the corpus luteum, but also via direct paracrine effects on the endometrium (3, 10).
In the present study, we showed that hCG directly acts on EECs to down-regulate IL-1R2 expression, without affecting the expression of IL-1R1, thereby decreasing IL-1R2 to IL-1R1 expression level. IL-1R2 has been described as a potent, specific, and natural inhibitor of IL-1. This receptor could be released in a soluble form after proteolytic cleavage of the mb-receptors extracellular domain (32) and acts as a decoy receptor, thereby restricting the availability of IL-1 for the functional receptor IL-1R1 and, consequently, IL-1-mediated cell activation (23, 25, 33, 34). hCG treatment resulted in a dose-dependent decrease in the release of sIL-1R2 and the levels of its mb form. Our data further revealed a significant diminution of IL-1R2 mRNA steady-state levels and IL-1R2 promoter activity, suggesting a down-regulation of IL-1R2 gene transcription. Overexpression of the hLHCGR in EECs using an adenoviral expression vector bearing hLHCGR gene corroborated the direct regulatory effect of hCG described previously, targeting IL-1R2 rather than IL-1R1. However, the uninfected cells appeared to express LHCGR, and the use of the LHCGR overexpressing epithelial cells appeared to add little to the results obtained using uninfected secretory phase epithelial cells alone. Indeed, endometrial cell cultures from each cycle phase may be influenced by different steroid hormones, which in turn, could potentially have a significant impact on hCG responsiveness. It has been reported that there is little LHCGR expression in the endometrium during the proliferative phase of the primate menstrual cycle relative to the significant expression observed in the secretory phase (35). However, the human data showed an abundant receptor expression in the proliferative phase, which further increases in the secretory phase (4). Comparing proliferative to secretory phase endometrial cell responsiveness to hCG was beyond the scope of the present study, and the small number of cultures used to assess sIL-1Rs, mb-IL-1Rs, IL-1Rs mRNA, or IL-1R2 promoter activity does not allow appropriate statistical analyses of proliferative vs. secretory phase cell responsiveness.
The most significant aspect of using the adenovirus expression system was the down-regulatory effect that the constitutively active LHCGR had on IL-1R2 expression. Cell infection with the constitutively activated hLHCGR did result in a significant down-regulation of IL-1R2s soluble and mb protein, mRNA steady-state levels, and promoter activity without any noticeable change in IL-1R1 expression. This clearly indicates the requirement for hLHCGR activation, points to receptor-mediated hCG effects, and further supports our present findings of a direct modulation of EEC receptivity to IL-1 by hCG.
These findings may have an interesting physiological significance, considering the biological properties of hCG and IL-1, and their respective important roles in human pregnancy and uterine physiology. Actually, hCG should be viewed not only as a hormone, but also as a growth factor and a cytokine with multifaceted actions, some of which have physiological end points, whereas others have pathological consequences (3). In addition to its direct stimulatory effects on uterine endothelial cells and the induction of endothelial cell migration and capillary formation (36), hCG appeared to up-regulate vascular endothelial growth factor gene expression in macrophages (36) and other angiogenic factors in endometrial cells (9), and to induce endometrial differentiation and decidualization (10), which emphasize its role as an early embryonic signal, giving the conceptus the ability to influence endometrial receptivity and its own implantation.
The appropriate interaction between the preimplantation embryo and maternal endometrium is at least partly mediated by local paracrine factors (11, 12). The IL-1 system is intimately involved in implantation and preimplantation embryo development, and may play an important role in embryo-maternal interface. In early human implantation sites, trophoblastic cells and decidualized stromal cells produce IL-1 (13, 14, 15). Immunostaining for IL-1R1 has been reported in syncytiotrophoblast and endometrial epithelial glands in the maternal decidua (12). However, there is little information regarding the mechanisms underlying IL-1Rs regulation and involvement in embryonic implantation and growth. IL-1β gene expression in porcine concepti was temporally associated with an increase in endometrial IL-1R1 and IL-1R accessory protein gene expression in pregnant gilts (37). Preimplantation embryos expressing IL-1RA mRNA in a detectable amount appear more likely to be arrested in early developmental stages (12). In mice, IL-1RA given before implantation significantly reduces the number of implanted embryos (21). Furthermore, this appeared to be mediated by an effect on the endometrial epithelium, as a result of down-regulation of
4,
v, and β3 adhesion molecules. Accordingly, the hCG-induced down-regulation of IL-1R2, another potent and specific inhibitor of IL-1, in EECs may represent a mechanism by which hCGs alleviate the tight control that is likely exerted on IL-1 at the embryo-maternal interface, thereby favoring IL-1-mediated actions. Interestingly and in keeping with the findings of the present study, there is evidence in the primate for a synergism between IL-1 and hCG in enhancing uterine receptivity (38). Investigations are underway to assess IL-1Rs expression at different phases of the menstrual cycle in response to hCG, particularly because IL-1R2 expression in the human endometrium during the normal menstrual cycle was shown to decline at the time of the implantation window (30). In addition, it will be interesting to evaluate the expression of IL-1Rs during gestation and verify in vivo the regulatory effects of hCG.
There are several mechanisms by which IL-1, a cytokine capable of a wide spectrum of effects on numerous cell types (39), may affect the process of implantation. IL-1β has been postulated as one of the first signals mediating the cross communication between the implanting blastocyst and endometrium (12). For instance, secretion of embryonic IL-1β seems to be the first response of the blastocyst to the receptive endometrium. The release of IL-1β parallels the invasive potential of the cytotrophoblasts; the highest levels are produced by first trimester cells, and the lowest levels by second and third trimester cells, respectively (20). Successful implantation after in vitro fertilization has been correlated to high concentrations of both IL-1
and IL-1β in the culture medium of human embryos (14, 15). The selective release of the IL-1 from human embryo is observed only when embryos are cocultured with human EEC or EEC-conditioned medium (40). IL-1β stimulates cytotrophoblast matrix metalloproteinase-9 secretion, thereby inducing trophoblast invasion (20). IL-1β induces the expression of IGF binding protein-1 during decidualization in the primate (11). A recent study demonstrated that the β3-integrin-subunit, a marker of uterine receptivity (41), on the surface of human EECs could be up-regulated by coculture with a human preimplantation embryo. Furthermore, this effect was also achieved when IL-1
and/or IL-1β was added to the EEC culture and blocked by administration of IL-1β plus anti-IL-1-antibody (19). This suggests that the appropriate stimulation of the IL-1R1 by binding of IL-1
and/or IL-1β might be responsible for initiating appropriate endometrial epithelial integrin expression, and, therefore, might trigger the attachment and implantation. Interestingly, IL-1β has stimulated hCG release from the first trimester human trophoblast (42, 43). This, together with our data, points to a close cooperation between these two embryonic signals during early embryonic implantation and growth. The fact that hCG directly down-regulates the decoy inhibitory IL-1R2 in human EECs, without affecting the expression of the signaling IL-1R1, reveals a new mechanism by which hCG can directly modulate the local embryo-maternal environment and cell receptivity to other embryonic signals that, in turn, may sustain development and maintain pregnancy.
In conclusion, we have demonstrated that hCG directly down-regulates the synthesis and secretion of the decoy inhibitory IL-1R2, a potent specific inhibitor of IL-1. hCG was revealed to act at the IL-1R2 gene promoter but had no direct regulatory effect on the expression of the functional activating IL-1R1, which mediates cell activation by IL-1. These findings may have an interesting significance in view of the well-documented roles of these two embryonic signals in the early events of embryo implantation and growth. Furthermore, they provide a new insight into the mechanisms of hCG action, and reveal another feature of the endocrine/immune control of pregnancy and embryonic development.
 |
Acknowledgments
|
|---|
The authors thank Drs. François Belhumeur, Jean Blanchet, Marc Bureau, Simon Carrier, Elphège Cyr, Marlène Daris, Jean-Louis Dubé, Jean-Yves Fontaine, Céline Huot, Pierre Huot, Johanne Hurtubise Rodolphe Maheux, Jacques Mailloux, and Marc Villeneuve for patient evaluation and providing endometrial biopsies, and Christian Bellehumeur, Madeleine Desaulniers, Monique Longpré, Johanne Pelletier, and Sylvie Pleau for technical assistance.
 |
Footnotes
|
|---|
This work was supported by Grant MOP-14638 (to A.A.) from The Canadian Institutes for Health Research. A.A. is Chercheur National from the Fonds de la Recherche en Santé du Québec.
Disclosure Statement: The authors have nothing to declare.
First Published Online August 16, 2007
Abbreviations: EEC, Endometrial epithelial cell; FBS, fetal bovine serum; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hCG, human chorionic gonadotropin; hLHCGR, human LH/chorionic gonadotropin receptor; IL-1RA, IL-1 receptor antagonist; IL-1R1, IL-1 receptor type I; IL-1R2, IL-1 receptor type II; mb, membrane bound; rhs, recombinant human soluble; sIL-1R1, soluble IL-1 receptor type I; sIL-1R2, soluble IL-2 receptor type II.
Received March 19, 2007.
Accepted for publication August 8, 2007.
 |
References
|
|---|
- Jaffe RB, Lee PA, Midgley Jr AR 1969 Serum gonadotropins before, at the inception of, and following human pregnancy. J Clin Endocrinol Metab 29:1281–1283[Free Full Text]
- Jaffe RB 1983 Fetoplacental endocrine and metabolic physiology. Clin Perinatol 10:669–693[Medline]
- Rao CV 2006 Physiological and pathological relevance of human uterine LH/hCG receptors. J Soc Gynecol Investig 13:77–78[CrossRef][Medline]
- Reshef E, Lei ZM, Rao CV, Pridham DD, Chegini N, Luborsky JL 1990 The presence of gonadotropin receptors in nonpregnant human uterus, human placenta, fetal membranes, and decidua. J Clin Endocrinol Metab 70:421–430[Abstract/Free Full Text]
- Bernardini L, Moretti-Rojas I, Brush M, Rojas FJ, Balmaceda JP 1995 Status of hCG/LH receptor and G proteins in human endometrium during artificial cycles of hormone replacement therapy. J Soc Gynecol Investig 2:630–635[CrossRef][Medline]
- Tang B, Gurpide E 1993 Direct effect of gonadotropins on decidualization of human endometrial stroma cells. J Steroid Biochem Mol Biol 47:115–121[CrossRef][Medline]
- Zygmunt M, Herr F, Munstedt K, Lang U, Liang OD 2003 Angiogenesis and vasculogenesis in pregnancy. Eur J Obstet Gynecol Reprod Biol 110(Suppl 1):S10–S18
- Islami D, Bischof P, Chardonnens D 2003 Modulation of placental vascular endothelial growth factor by leptin and hCG. Mol Hum Reprod 9:395–398[Abstract/Free Full Text]
- Akoum A, Metz CN, Morin M 2005 Marked increase in macrophage migration inhibitory factor synthesis and secretion in human endometrial cells in response to human chorionic gonadotropin hormone. J Clin Endocrinol Metab 90:2904–2910[Abstract/Free Full Text]
- Filicori M, Fazleabas AT, Huhtaniemi I, Licht P, Rao CV, Tesarik J, Zygmunt M 2005 Novel concepts of human chorionic gonadotropin: reproductive system interactions and potential in the management of infertility. Fertil Steril 84:275–284[CrossRef][Medline]
- Fazleabas AT, Kim JJ, Strakova Z 2004 Implantation: embryonic signals and the modulation of the uterine environment—a review. Placenta 25(Suppl A):S26–S31
- Krussel JS, Bielfeld P, Polan ML, Simon C 2003 Regulation of embryonic implantation. Eur J Obstet Gynecol Reprod Biol 110(Suppl 1):S2–S9
- Kauma S, Matt D, Strom S, Eierman D, Turner T 1990 Interleukin-1β, human leukocyte antigen HLA-DR alpha, and transforming growth factor-beta expression in endometrium, placenta, and placental membranes. Am J Obstet Gynecol 163:1430–1437[Medline]
- Baranao RI, Piazza A, Rumi LS, Polak de Fried E 1997 Determination of IL-1 and IL-6 levels in human embryo culture-conditioned media. Am J Reprod Immunol 37:191–194[Medline]
- Sheth KV, Roca GL, al-Sedairy ST, Parhar RS, Hamilton CJ, al-Abdul Jabbar F 1991 Prediction of successful embryo implantation by measuring interleukin-1-alpha and immunosuppressive factor(s) in preimplantation embryo culture fluid. Fertil Steril 55:952–957[Medline]
- Bigonnesse F, Labelle Y, Akoum A 2001 Triphasic expression of interleukin-1 receptor type I in human endometrium throughout the menstrual cycle of fertile women and women with unexplained infertility. Fertil Steril 75:79–87[CrossRef][Medline]
- Tabibzadeh S, Kaffka KL, Satyaswaroop PG, Kilian PL 1990 Interleukin-1 (IL-1) regulation of human endometrial function: presence of IL-1 receptor correlates with IL-1-stimulated prostaglandin E2 production. J Clin Endocrinol Metab 70:1000–1006[Abstract/Free Full Text]
- Sawai K, Matsuzaki N, Okada T, Shimoya K, Koyama M, Azuma C, Saji F, Murata Y 1997 Human decidual cell biosynthesis of leukemia inhibitory factor: regulation by decidual cytokines and steroid hormones. Biol Reprod 56:1274–1280[Abstract]
- Simon C, Gimeno MJ, Mercader A, OConnor JE, Remohi J, Polan ML, Pellicer A 1997 Embryonic regulation of integrins β 3,
4, and
1 in human endometrial epithelial cells in vitro. J Clin Endocrinol Metab 82:2607–2616[Abstract/Free Full Text] - Librach CL, Feigenbaum SL, Bass KE, Cui TY, Verastas N, Sadovsky Y, Quigley JP, French DL, Fisher SJ 1994 Interleukin-1β regulates human cytotrophoblast metalloproteinase activity and invasion in vitro. J Biol Chem 269:17125–17131[Abstract/Free Full Text]
- Simon C, Valbuena D, Krussel J, Bernal A, Murphy CR, Shaw T, Pellicer A, Polan ML 1998 Interleukin-1 receptor antagonist prevents embryonic implantation by a direct effect on the endometrial epithelium. Fertil Steril 70:896–906[CrossRef][Medline]
- Boraschi D, Bossu P, Macchia G, Ruggiero P, Tagliabue A 1996 Structure-function relationship in the IL-1 family. Front Biosci 1:d270–d308
- Bossu P, Visconti U, Ruggiero P, Macchia G, Muda M, Bertini R, Bizzarri C, Colagrande A, Sabbatini V, Maurizi G, Del Grosso E, Tagliabue A, Boraschi D 1995 Transfected type II interleukin-1 receptor impairs responsiveness of human keratinocytes to interleukin-1. Am J Pathol 147:1852–1861[Abstract]
- Colotta F, Re F, Muzio M, Bertini R, Polentarutti N, Sironi M, Giri JG, Dower SK, Sims JE, Mantovani A 1993 Interleukin-1 type II receptor: a decoy target for IL-1 that is regulated by IL-4. Science 261:472–475[Abstract/Free Full Text]
- Symons JA, Young PR, Duff GW 1995 Soluble type II interleukin 1 (IL-1) receptor binds and blocks processing of IL-1β precursor and loses affinity for IL-1 receptor antagonist. Proc Natl Acad Sci USA 92:1714–1718[Abstract/Free Full Text]
- Noyes RW, Hertig AT, Rock J 1975 Dating the endometrial biopsy. Am J Obstet Gynecol 122:262–263[Medline]
- Akoum A, Lemay A, Brunet C, Hebert J 1995 Secretion of monocyte chemotactic protein-1 by cytokine-stimulated endometrial cells of women with endometriosis. Le groupe dinvestigation en gynecologie. Fertil Steril 63:322–328[Medline]
- Bebia Z, Somers JP, Liu G, Ihrig L, Shenker A, Zeleznik AJ 2001 Adenovirus-directed expression of functional luteinizing hormone (LH) receptors in undifferentiated rat granulosa cells: evidence for differential signaling through follicle-stimulating hormone and LH receptors. Endocrinology 142:2252–2259[Abstract/Free Full Text]
- Bellehumeur C, Collette T, Maheux R, Mailloux J, Villeneuve M, Akoum A 2005 Increased soluble interleukin-1 receptor type II proteolysis in the endometrium of women with endometriosis. Hum Reprod 20:1177–1184[Abstract/Free Full Text]
- Akoum A, Jolicoeur C, Kharfi A, Aube M 2001 Decreased expression of the decoy interleukin-1 receptor type II in human endometriosis. Am J Pathol 158:481–489[Abstract/Free Full Text]
- Sims JE, Painter SL, Gow IR 1995 Genomic organization of the type I and type II IL-1 receptors. Cytokine 7:483–490[CrossRef][Medline]
- Orlando S, Sironi M, Bianchi G, Drummond AH, Boraschi D, Yabes D, Mantovani A 1997 Role of metalloproteases in the release of the IL-1 type II decoy receptor. J Biol Chem 272:31764–31769[Abstract/Free Full Text]
- Colotta F, Dower SK, Sims JE, Mantovani A 1994 The type II decoy receptor: a novel regulatory pathway for interleukin 1. Immunol Today 15:562–566[CrossRef][Medline]
- Subramaniam S, Stansberg C, Cunningham C 2004 The interleukin 1 receptor family. Dev Comp Immunol 28:415–428[CrossRef][Medline]
- Cameo P, Szmidt M, Strakova Z, Mavrogianis P, Sharpe-Timms KL, Fazleabas AT 2006 Decidualization regulates the expression of the endometrial chorionic gonadotropin receptor in the primate. Biol Reprod 75:681–689[Abstract/Free Full Text]
- Zygmunt M, Herr F, Keller-Schoenwetter S, Kunzi-Rapp K, Munstedt K, Rao CV, Lang U, Preissner KT 2002 Characterization of human chorionic gonadotropin as a novel angiogenic factor. J Clin Endocrinol Metab 87:5290–5296[Abstract/Free Full Text]
- Ross JW, Malayer JR, Ritchey JW, Geisert RD 2003 Characterization of the interleukin-1beta system during porcine trophoblastic elongation and early placental attachment. Biol Reprod 69:1251–1259[Abstract/Free Full Text]
- Strakova Z, Mavrogianis P, Meng X, Hastings JM, Jackson KS, Cameo P, Brudney A, Knight O, Fazleabas AT 2005 In vivo infusion of interleukin-1β and chorionic gonadotropin induces endometrial changes that mimic early pregnancy events in the baboon. Endocrinology 146:4097–4104[Abstract/Free Full Text]
- Dinarello CA 2004 Therapeutic strategies to reduce IL-1 activity in treating local and systemic inflammation. Curr Opin Pharmacol 4:378–385[CrossRef][Medline]
- De los Santos MJ, Mercader A, Frances A, Portoles E, Remohi J, Pellicer A, Simon C 1996 Role of endometrial factors in regulating secretion of components of the immunoreactive human embryonic interleukin-1 system during embryonic development. Biol Reprod 54:563–574[Abstract]
- Lessey BA, Castelbaum AJ, Sawin SW, Buck CA, Schinnar R, Bilker W, Strom BL 1994 Aberrant integrin expression in the endometrium of women with endometriosis. J Clin Endocrinol Metab 79:643–649[Abstract]
- Steele GL, Currie WD, Leung EH, Yuen BH, Leung PC 1992 Rapid stimulation of human chorionic gonadotropin secretion by interleukin-1 β from perifused first trimester trophoblast. J Clin Endocrinol Metab 75:783–788[Abstract]
- Tsukihara S, Harada T, Deura I, Mitsunari M, Yoshida S, Iwabe T, Terakawa N 2004 Interleukin-1beta-induced expression of IL-6 and production of human chorionic gonadotropin in human trophoblast cells via nuclear factor-
B activation. Am J Reprod Immunol 52:218–223[Medline]
This article has been cited by other articles:

|
 |

|
 |
 
C. Bellehumeur, J. Blanchet, J.-Y. Fontaine, N. Bourcier, and A. Akoum
Interleukin 1 regulates its own receptors in human endometrial cells via distinct mechanisms
Hum. Reprod.,
May 28, 2009;
(2009)
dep192v1.
[Abstract]
[Full Text]
[PDF]
|
 |
|