| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
Department of Anatomy and Cell Biology (S.T., B.F., A.N.S.), Martin Luther University Faculty of Medicine, D-06097 Halle (Saale), Germany; Department Obstetrics and Gynaecology (K.K., J.G.T.), Research Centre for Reproductive Health, University of Adelaide, Adelaide 5005, South Australia, Australia; and Institut für Pflanzengenetik und Kulturpflanzenforschung (A.M.W.), 06466 Gatersleben, Germany
Address all correspondence and requests for reprints to: Dr. Anne Navarrete Santos, Department of Anatomy and Cell Biology, Martin Luther University Faculty of Medicine, Grosse Steinstrasse 52, D-06097 Halle (Saale), Germany. E-mail: a.navarrete-santos{at}medizin.uni-halle.de.
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-myosin heavy chain were affected, TCDD did not inhibit the differentiation of P19 cells to pulsating cardiomyocytes. TCDD significantly down-regulated the expression levels of the glucose transporter (GLUT) isoforms 1 and 3. After 24-h TCDD treatment, GLUT1 was no longer localized in the plasma membrane of P19 cells. The impaired GLUT expression correlated with a lower glucose uptake in 5-d-old embryoid bodies. The TCDD effects were mediated by AhR, as shown by preculture with the AhR antagonist -naphthoflavone. Our data demonstrate that an AhR-mediated disturbance in GLUT expression and insufficient glucose uptake may be major mechanisms in TCDD embryo toxicity. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
One of the possible mechanisms is the disturbance of glucose transport. A well-described effect of TCDD intoxication in vivo is a loss of body weight, hyperlipidemia, and other metabolic perturbations (5). TCDD is known to alter glucose transport in intestinal epithelium (6) and preadipocyte cell lines (7). It significantly reduces the level of glucose transporter (GLUT) 4 in vivo in adipose and muscle tissue (8). Because of the hydrophilic character of glucose, specific transport proteins are required for glucose to cross the cell membrane. They are present in all cell types and provide pores for the transmembrane glucose passage.
The number of mammalian GLUTs has expanded over the past several years, and two different families have been identified: sodium glucose cotransporters, and facilitative GLUTs. The latter belongs to a family of 13 structurally related, membrane-spanning glycoproteins (9). They exhibit different kinetic properties and tissue expression patterns depending on the cellular demand and regulation. Glucose enters the preimplantation embryo preferentially by GLUTs. In mouse blastocysts, at least six GLUT isoforms have been described (10, 11, 12). Mouse embryonic stem (ES) cells express GLUT1, 3, and 8. GLUT2 and GLUT4 are detectable only in differentiated ES-derived cells (13). In adult cardiac cells, GLUT1 is localized in the plasma membrane (PM), whereas GLUT4 translocates from cytoplasmic storage vesicles to the PM in response to an insulin stimulus.
TCDD affects heart development in zebra fish (2), chicken (14), and mouse (15). In piscine and avian embryos exposed to TCDD, changes in cardiac structure and function have been described. In the piscine embryo, TCDD reduces heart size and cardiomyocyte proliferation (2). Similarly, in the chick embryo, TCDD induces ventricular cavity dilation associated with thinner ventricle walls and reduced cardiomyocyte proliferation (14). The importance of the timing of TCDD exposure to cardiac teratogenic endpoints has not been studied in detail; however, chick embryos exposed to TCDD after organogenesis exhibit less severe cardiac structural or functional deficits compared with ones exposed shortly after fertilization (16). TCDD-treated fetal mice exhibit a dose-related decrease in heart-to-body weight ratio and a decreased cardiomyocyte proliferation (15).
To investigate the mechanism of TCDD embryo toxicity, we have used P19 mouse embryonic carcinoma cells (ECCs). P19 cells have differentiated into cardiac, skeletal, and smooth muscle cells (17). The cardiac cell differentiation recapitulates in vivo differentiation of embryonic myocardium, as shown by several authors (18, 19). The ability of P19 cells to reflect early differentiation processes was the basis to analyze the developmental toxicity of TCDD in this study. Here, we demonstrate for the first time that the AhR signaling cascade is fully active in pluripotent ECCs. A temporary TCDD exposure of undifferentiated P19 cells showed a long-lasting effect on gene expression and glucose transport. TCDD reduced cell viability and glucose uptake, whereas the mRNA expression of the skeletal muscle-specific transcription factor MyoD and the capacity to form contractile clusters were not affected. The TCDD-induced reduction of cellular glucose uptake is most likely caused by an impaired trafficking and a significant decrease in GLUT1 and 3 protein amounts. We show that in TCDD-treated P19 cells, the GLUT1 protein is no more localized in the PM. Disturbance of glucose uptake and GLUT expression in embryonic cells emerge as a potential mechanism of TCDD developmental toxicity.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Cardiac differentiation of P19 cells
P19 cells were differentiated into spontaneously beating cardiac clusters as previously described (19). Cells were cultured in differentiation medium supplemented with 1% dimethyl sulfoxide (DMSO) (Sigma-Aldrich Chemie GmbH, München, Germany) as inducer of cardiac differentiation. Drops of differentiation medium (20 µl) with 400 cells were placed onto the lids of Petri dishes filled with PBS and cultured for 2 d. Cell aggregates formed in the hanging drops were transferred into nonadhesive bacteriologic grade Petri dishes (6 cm) containing 5 ml culture medium to develop embryoid bodies (EBs) for a further 3 d. The 5-d-old EBs were placed onto gelatin (0.1%)-coated Petri dishes and grown for another 5–10 d (5 + 5 d, 5 + 10 d). The first spontaneously beating clusters appeared 1 d after plating. Analysis was performed for up to 10 d.
TCDD treatment
TCDD (Amchro, Hattersheim, Germany) was dissolved in DMSO at a final concentration of 1.55 mM. It was added to the cultures at concentrations of 0.1–100 nM. Control variants (solvent control) were cultured with the appropriate DMSO concentration without TCDD. For cardiac differentiation, undifferentiated P19 cells were cultured for 2 d (hanging drop period) in the presence of 1% DMSO and 10 nM TCDD. Furthermore, the experiment was repeated with a lower DMSO concentration of 6.45 x 10–6% and 10 nM TCDD to bring out more clearly the differentiation effects of TCDD.
The AhR antagonist -naphthoflavone (-NF) (Sigma-Aldrich) was added in a concentration range of 0.1–100 µM to the medium 4 h before TCDD treatment. -NF is a well-known AhR antagonist, which also inhibits cytochrome P450 activity.
RNA extraction and RT-PCR
The Superscript II RT-kit, dNTPs, and Taq polymerase were purchased from Invitrogen, and random primer, Rnase inhibitor, and Dnase I from Roche Diagnostics (Mannheim, Germany). Total RNA from P19 cells was extracted as described in Ref. 11 . For RNA extraction from EBs, 15 EBs were pooled. Total RNA (2 µg) was reverse transcribed in a final volume of 100 µl and amplified by PCR in a separate reaction as performed: 1 µl cDNA for GLUT1, 3, and 8; 5 µl for GLUT2; and 3 µl for GLUT4, AhR, ARNT, cytochrome P450 1A1 (CYP1A1) in a 50 µl volume containing 5 µM dNTP, 2.5 U Taq polymerase, using the primer combinations listed in Table 1
. Resulting PCR products were separated by electrophoresis on a 1.8% agarose gel and stained with ethidium bromide. Agarose gels were scanned by Bio-Capt MW software (LTF, Wasserburg, Germany), and three independent experiments were performed.
|
-myosin heavy chain (-MHC) transcription levels. Reactions were performed using SYBR green Master Mix (Applied Biosystems), as a double-stranded DNA-specific fluorescent dye, with the appropriate primer set (Table 1
). PCR was initiated with 2 min at 50 C, then 10 min at 95 C. The program continued with 40 cycles of 15 sec at 95 C and 60 sec at 60 C. Each assay, for each respective gene of interest, included duplicates of each cDNA sample and a no-template control. The parameter cycle threshold (CT) is defined as the cycle number at which fluorescence intensity exceeds a fixed threshold. Relative mRNA expression for the genes of interest was expressed relative to undifferentiated P19 cells (untreated control) using the 
CT method. The expression of 18S rRNA was used to normalize samples for the amount of cDNA used per reaction. Experiments were repeated three times. Control of real-time RT-PCR specificity was performed by gel electrophoresis and sequencing of PCR products. For each reaction, dissociation curve analysis was performed to confirm the amplification of single products.
Mitochondrial activity assessment
The viability of P19 cells was determined by MTT assay (EZ4U nonradioactive cell proliferation and cytotoxicity assay, Fa.; Biomedica, Wien, Austria) following the manufacturer’s protocol. This assay is based on the reduction of the nontoxic, yellow tetrazolium salt (450 nm) to an intensively colored, red formazan derivate (620 nm). Reduction requires functional mitochondria as an indicator of cell viability and cell proliferation. Cells (n = 4000) were plated onto gelatin-coated 96-well plates in 100 µl DMEM medium. TCDD at final concentration of 0.1, 1, 10, and 100 nM, and DMSO used as solvent control, respectively, were added. After 24 h, 10 µl substrate was added to each well and incubated for 1 h in 5% CO2 at 37 C. The absorbance was measured at 450 and 620 nm in an ELISA reader (SLT Labinstruments, Crailsheim, Germany). P19 cells cultured in standard DMEM without TCDD were estimated as 100%.
Construction of vectors and transfection
For the vector construction, restriction enzymes were purchased from Fermentas GmbH (St. Leon-Roth, Germany). The full-size coding regions of mouse GLUT1 was amplified from undifferentiated P19 cells using high fidelity Taq polymerase (Roche Diagnostics). Specific primers were derived from mouse GLUT1 and AhR mRNA gene sequences published in the European Molecular Biology Laboratory database. GLUT1 was amplified directly, whereas the AhR full-size coding sequence was amplified in three steps using the primer set combinations, AhR full-sizes primer 1, primer 2, and primer 3 (Table 1). All PCR products were separated on a 1% agarose gel and purified using Quia Quick Spin columns (QIAGEN, Hilden, Germany). GLUT1 was cloned directly into the eGFP-C3 Vector (BD Biosciences, Heidelberg, Germany) by directed restriction with EcoRI and XhoI. The AhR full-size sequence was cloned in a first step into the pGEMT vector (Promega Corp., Mannheim, Germany), and then reassembled by directed restriction and cloning in the eGFP-C3. Therefore, first the AhRP1 PCR product was cloned into eGFP-C3 plasmid linearized by XhoI and EcoRI. The second AhRP2 PCR fragment was added after restriction with EcoRI and SalI. Finally, the third fragment (AhRP3) was included after NotI and SacII restriction. All vector inserts were verified by sequencing (Seqlab, Göttingen, Germany) and basic local alignment search tool (BLAST) alignment. Recombinant vectors (50 µg) were cloned transient into ECCs by electroporation (Gene Pulser, 500 µF, 250 mV; Bio-Rad Laboratories, München, Germany) in Opti-MEM (Invitrogen). The evaluation was performed by confocal scanning microscopy (Leica, Wetzlar, Germany).
Western blot analyses
Protein preparations and Western blot analysis were performed as described in Ref. 13 . Protein (30 µg) from undifferentiated ECCs or pooled EBs was added to the blots.
For Western blotting, the primary antibodies monoclonal mouse anti-GLUT4 antibody (1:6000; DPC Biermann, Bad Nauenheim, Germany), rabbit anti-GLUT1 antibody (1:5000; Alpha Diagnostics International Inc., San Antonio, TX), rabbit anti-GLUT3 antibody (1:2000; Alpha Diagnostics), and mouse anti-ß-actin antibody (1:40,000; Sigma-Aldrich), respectively, were used by incubation overnight at 4 C. The secondary antibodies, goat antimouse-IgG (1:25,000), goat antirabbit-IgG (1:10,000) conjugated to horseradish peroxidase (Dianova, Hamburg, Germany) were applied for 1 h at room temperature.
The resulting blots were scanned using a CanoScan D660U flat screen scanner (Canon, Krefeld, Germany), and the images were quantified using the Bio-Capt MW software (LTF).
Subcellular fractionation
The fractionation was performed as described in Ref. 20 . P19 ECCs were cultured with 10 nM TCDD and DMSO as solvent control for 25 h. Cells from 10, 80-cm2 flasks were harvested and lysed by syringe pressure in solution I [250 mM sucrose, 5 mM NaN3, and 10 mM NaHCO3 (pH 7.8)]. Cellular lysis was verified by trypan blue staining of intact cells. Nuclei and remaining intact cells were pelleted by centrifugation at 4000 x g for 30 min at 4 C in a Biofuge 28S (Heraeus, Berlin, Germany). The supernatant was centrifuged at 32,000 x gmax for 1 h at 4 C. The pellet included the unpurified PM, the supernatant, and microsomal and cytosolic fractions. The PM pellet was dissolved in solution I and cleaned by ultracentrifugation (Beckman-Coulter GmbH Biomedical Research, Krefeld, Germany) on a sucrose gradient consisting of a 30 and 40% sucrose solution, followed by a centrifugation with 150,000 x gmax, 1 h and 4 C in a SW40 TI rotor. The PM laying on the 30% sucrose solution was diluted in solution II (10 nM NaHCO3), pelleted by centrifugation at 190,000 x gmax for 1 h at 4 C, and diluted in 0.1 N NaOH. The supernatant, including the microsomal and cytosolic fraction, was centrifuged at 190,000 x gav for 1 h at 4 C. The pellet containing the microsomes was dissolved in 0.1 N NaOH. Twenty micrograms of internal membrane proteins and 4.5 µg PM proteins were applied in Western blotting analyses for GLUT1, 3, and 4, as described before.
Immunofluorescence
For immunofluorescence analysis of TCDD-treated cells, GLUT1 (rabbit anti-GLUT1 antibody, 1:1500; Abcam, Cambridge, UK) and desmin (mouse anti-desmin antibody, 1:20, Abcam; and rabbit antidesmin antibody, 1:50, Chemicon, Hampshire, UK) were used as previously described (13).
XRE luciferase reporter gene assay
The XRE reporter gene was constructed by heat annealing of two oligonucleotides [XRE 3xfw: 5'-CTAGCC(CTTCTCACGCAACGCCTGGC)x3-3'; and XRE 3xrw: 5'-TCGAG (CCAGGCGTTGCGTGAGAAGG)x3-C3'; Roth, Karlsruhe, Germany] containing three XRE elements. The oligonucleotide was cloned into the pTAL-Luc-Vector (BD Biosciences, Franklin Lakes, NJ) by directed restriction. The vector was verified by sequencing. A combination of 50 µg XRE reporter and 1.25 µg pRL-SV40 Vector (Promega) were transfected by electroporation in P19 cells. There were 1 x 106 cells plated in six-well plates and allowed to recover for 8 h. TCDD treatment was performed for 24 h. The luminescence of firefly and Renilla luciferase was measured using the Dual-Luciferase Reporter assay system (Promega) in the Sirius Luminometer (Berthold Detection Systems, Pforzheim, Germany). The firefly luciferase was set in relation to the Renilla luciferase activity. The raw data were expressed as a percentage relative to P19 cells cultured in normal media. For this study the specificity of the XRE construct and AhR binding was proved by addition of -NF before TCDD stimulation in MCF7 cells (data not shown). After -NF there was no further induction of XRE promoter activity detectable by TCDD.
Glucose uptake studies
Glucose uptake was measured as described in Ref. 21 . In brief, 2 and 5-d EBs were washed twice in glucose-free DMEM and transferred into 100 µl pulse droplets, kept strictly at 37 C, for 3 min. The glucose-free pulse medium contained 0.3 mM 3-O-methyl-D-[1-3H] glucose (3H-OMG) (37 GBq/liter; Amersham Biosciences, Freiburg, Germany) and 25 mM 3-OMG (Sigma Chemical Co., St. Louis, MO). Uptake was stopped after 3 min by transferring the EBs through four washes of ice-cold glucose-free DMEM. The diameter of the EBs was recorded using a calibrated ocular micrometer. Radioactivity of individual EBs was determined in a Wallac LSC 1408 liquid scintillation analyzer (Wallac Oy, Turku, Finland). In three experimental replicates, 2-d EBs (n = 30) and 5-d EBs (n = 50) were studied. Uptake of 3-OMG was expressed in nmol/3 min x vol (cm3). The volume of the spherical EB (4/3
r3) was calculated as previously described (22) and used to standardize the differences in size between EBs.
For plated 5 + 5-d EBs, five 5-d EBs were plated on a six-well plate. One hour before the experiment, the cells were washed three times with a glucose-free DMEM and left for 1 h in 1 ml media. One milliliter of DMEM with 2 µCi of 3H-OMG in 50 mM 3-OMG was added and then incubated for 20 min. The reaction was stopped by washing three times with glucose-free DMEM, and the cells were lysed for 1 h in 500 µl 0.1 M NaOH at 60 C. Two hundred microliters were analyzed in the liquid scintillation analyzer. For standardization the protein amount of each well was calculated using a Bio-Rad assay. The uptake was expressed as picomoles per milligram.
Statistics
The results were compared with the Student’s t test. All data are expressed as mean ± SEM. The differences were considered statistically significant at P values less than 0.05, less than 0.01 to untreated controls, and at P values less than 0.05, less than 0.01 to solvent controls.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RT-PCR analyses of AhR, ARNT, and CYP1A1.
Undifferentiated mouse P19 cells, differentiated EBs (2 and 5 d old), and EB outgrowths were analyzed by RT-PCR. AhR, ARNT, and CYP1A1 mRNA levels were expressed in all studied stages (Fig. 1).
|
). In nontreated undifferentiated control P19 cells, the AhR-eGFP fluorescence was found in the cytoplasm (Fig. 2A, a–c), indicating that the AhR is present in P19 cells in an inactive state. Stimulation with 10 nM TCDD causes a change in the subcellular distribution of the AhR-eGFP fluorescence from cytoplasm into the nuclei within 40 min (Fig. 2A, g–i).
|
).
Stimulation of CYP1A1 gene expression by AhR.
The AhR target gene CYP1A1 showed a significant and concentration-dependent increase in mRNA level after stimulation with 0.1–100 nM TCDD (Fig. 3A). CYP1A1 was significantly up-regulated for 3 h after addition of 10 nM TCDD, with a maximum at 2 h. A second increase followed 24 h after treatment (Fig. 3B). The TCDD-stimulated increase in CYP1A1 gene expression was inhibited by -NF in a concentration-dependent manner, ranging from 0.1–100 µM (Fig. 3C), indicating that AhR inhibition abolished the CYP1A1 expression. TCDD exerted an immediate and a long-lasting effect on CYP1A1 expression during differentiation. In 2-d EBs, the CYP1A1 mRNA level was 2-fold increased vs. nontreated controls. A 5- to 6-fold increase was noted at stages 5 and 5 + 5 d, whereas at stage 5 + 10 d, no differences in CYP1A1 expression between TCDD-treated and solvent controls were detected anymore (Fig. 3D).
|
).
|
-MHC and MyoD transcript levels (Fig. 5, A and B); and 2) the formation of spontaneously beating cardiac clusters (Fig. 5C).
|
-MHC strongly increased during differentiation until d 5 + 5 d, followed by a reduction at 5 + 10 d (Fig. 5A). In TCDD-treated cells, the -MHC mRNA level differed from controls with a significant higher amount at 5 d and 5 + 5 d, and reduced amounts at 5 + 10 d. In contrast, the myogenic marker MyoD exponentially increased until d 5 + 10 d (Fig. 5B). The MyoD mRNA level was not influenced by TCDD.
The changes of -MHC transcription by TCDD implicated consequences for cardiac differentiation and functionality. Therefore, the number of EBs with beating cardiac clusters was estimated 1–5 d after EB plating (Fig. 5C). DMSO (1%) as an efficient inducer of cardiac differentiation was used as positive control. Clusters of pulsating cardiomyocytes were observed in more than 95% of EBs at d 8–9 differentiation. When the DMSO concentration was reduced to 6.25 x 10–6% (concentration of the solvent control for TCDD), only 80% or less of EBs showed beating foci at d 8–10 (Fig. 5C). No significant differences in the number of EBs with beating clusters were found between TCDD-treated and solvent control EBs. TCDD did not inhibit or induce the differentiation of P19 cell to pulsating cardiomyocytes (Fig. 5C).
TCDD affects glucose uptake and GLUT expression
The glucose uptake of 2, 5, and 5 + 5-d EB was measured by incorporation of 3H-OMG and related to EB size, with an average uptake of approximately 1200 nmol 3H-OMG/ cm3 x 3 min for nontreated EBs or protein amount, respectively. Early stage exposure to 10 nM TCDD significantly decreased the glucose uptake later in development, i.e. in 2, 5, and 5 + 5-d EBs (Fig. 6A).
|
). RNA levels of GLUTs, determined by real-time PCR at various stages of EB differentiation, showed only minor changes. TCDD exposure led to a slight increase of GLUT1, 3, and 4 at d 2, whereas the GLUT1 mRNA level was decreased by 30–60% at 5, 5 + 5, and 5 + 10 d (Table 2). For GLUT3 and 8, a significant decrease was observed only at stage 5 + 10 d. If EB differentiation was not effected by TCDD, GLUT1 and 3 protein levels increased notably. A strong reduction of GLUT1 and 3 protein by TCDD was found from 5-d EB onwards. GLUT4 remained unchanged (Fig. 6C).
|
). In untreated P19 cells and solvent controls, the GLUT1 construct was mainly localized in the PM and particularly in the cytoplasm, whereas at 25 h, the TCDD-treated cells showed a spotted cytoplasmic GLUT1 fluorescence signal, with no or significantly lower GLUT1 fluorescence in the PM. Analyses of GLUT1 and 3 amounts in the membrane fractions of treated and nontreated P19 cells showed that GLUT1 and 3 amounts decreased remarkably in the PM fraction. The fraction of the inner membrane (IM) consisting mainly of low-density microsomal compartments remained unchanged for GLUT1, 3, and 4 (Fig. 7C).
|
). In control cells, GLUT1 was localized in the whole cell and the PM. In TCDD-treated P19 cells, we found a strong perinuclear localization of GLUT1. The structural protein desmin was used as a marker of differentiated cells.
TCDD effect on subcellular localization of GLUT1 depends on AhR
For further analysis of TCDD-induced dysregulation of GLUT, P19 cells were treated with -NF before TCDD exposure. In this experimental setup, no differences in GLUT1 localization were found in exposed cells compared with controls (Fig. 7A).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
AhR signaling in P19 cells
In the present study, we have shown that the AhR and its dimerization partner ARNT are constitutively expressed in undifferentiated and differentiating ECCs. The translocation of the AhR into the nucleus was detected as soon as 40 min after TCDD treatment. This is contrary to findings in fibroblast and Hepa-1c1c7 cells (27, 28), in which the nuclear signal of AhR was found later, i.e. after 2 and 6 h, respectively. In P19 cells, the AhR translocation correlated well with the induction of CYP1A1 mRNA within 1 h after TCDD treatment. Remarkably, CYP1A1 mRNA induction peaked at 2 h and decreased to control levels within 4 h. This fast and time-limited induction contrasts to CYP1A1 expression in TCDD-exposed mouse blastocysts (24) and HepG2 cells (29), in which a maximum increase was observed at 12 h and later than 25 h, respectively. The CYP1A1 RNA level was induced by 1 nM TCDD, whereas inhibition of AhR blocked the increase of CYP1A1 level, as demonstrated by the decrease in TCDD-induced CYP1A1 level by -NF. -NF also blocked AhR translocation into the nucleus in P19 cells. The functionality of the AhR/ARNT transcription factor complex in P19 cells was further demonstrated by XRE promoter activation. In contrast to rat hepatocarcinoma cells (MH1C1), XRE induction was less strong, with a 2.2-fold induction in P19 cells compared with a 6.8-fold increase in MH1C1 (data not shown).
TCDD mediated toxicity in undifferentiated and cardiac differentiated P19 cells
Measured by the MTT assay, the viability of TCDD-exposed undifferentiated P19 cells was reduced by 10% compared with nontreated cells. This assay is based on functional mitochondria as an indicator for cell viability and cell proliferation. It is known that TCDD leads to a cell cycle arrest in the G1 phase in different cell types (30, 31). It is noteworthy that an induction of cell arrest may be a possible mechanism of TCDD toxicity in embryonic cells. However, in the present study using P19 ECCs, the differentiation efficiency was not affected by TCDD. The measured reduction of the mitochondrial activity can also be caused by lowered cytosolic glucose concentration (32).
Mouse ECCs have a high capacity to form cardiomyocytes in vitro. After induction with DMSO, P19 cells form EBs that contain a high percentage of cardiomyocytes (19). Spontaneously beating clusters can be seen from the developmental stage 5 + 1 d onwards. Within the range of TCDD concentrations used in this study, a significant influence on cardiac differentiation could not be shown. Several in vivo studies had reported on abnormalities in heart development after TCDD (15, 33, 34). TCDD treatment of chicken embryos led to pericardial edema (35), an increased heart wet/dry weight, and heart myosin content (34). Interestingly, mice lacking the AhR have developed cardiac hypertrophy and hypertension, suggesting that the AhR is required for cardiovascular homeostasis in the adult mouse (36). The cardiac-specific actin -MHC has been used as a marker for cardiomyocyte differentiation in murine ES cells (37). The differentiation of P19 cells into cardiac muscle cells in the presence of DMSO was accompanied by a significant increase in -MHC expression. TCDD exposure led to decreased -MHC-mRNA levels at d 5 + 5 and 5 + 10 of cardiomyogenic differentiation, whereas the skeletal muscle-specific MyoD transcription factor was not affected. Despite the changes in -MHC transcript levels, we found no effect on the number of beating cardiac clusters. Together, TCDD induced changes in the transcription of cardiac marker genes, whereas the skeletal myogenic-specific MyoD was not affected. However, changes in the mRNA amount by TCDD did not significantly affect the cardiomyocyte differentiation and formation of spontaneously beating cardiac clusters. TCDD acts neither as an inducer nor an inhibitor of cardiac differentiation.
Toxic effects of TCDD on glucose transport and GLUT expression
Glucose is the most important energy substrate for embryonic cells during development. Lack of glucose blocks the differentiation from the morula to the blastocyst stage during preimplantation embryo development (38). Glucose enters embryonic cells by facilitative transport mechanisms via membrane-spanning GLUT molecules (10). Pluripotent P19 cells expressed four GLUT isoforms. In contrast to adult cardiac and skeletal myocytes, which express only GLUT1 and 4, P19 cells also express GLUT isoforms 3 and 8, closely resembling the expression pattern of blastocysts with GLUT1, 3, 4, 8, and 9, and ES cells with GLUT1, 3, and 8 (13).
GLUT mRNA and protein levels as well as the glucose uptake decreased by TCDD in P19 cells. One reason for the metabolic changes seen in individuals exposed to TCDD was the reduction of GLUTs in various tissues (39, 40). In adipocytes, TCDD decreased GLUT1 and 4 mRNA and protein by 40–80% (39). The TCDD effect on GLUT expression in P19 cells differed from that observed in adult adipocytes. Whereas the GLUT4 mRNA and protein level was substantially decreased by TCDD treatment in adipocytes, it was not altered in P19 cells. Whereas GLUT1 and 4 are the functional transporters for glucose uptake in adipocytes, GLUT4 is not altered in pluripotent P19 cells. In contrast, GLUT1 and GLUT3 mRNA and protein level decreased during differentiation. These decreases were significant from 5 d of the differentiation onwards, i.e. 3 d after termination of TCDD treatment. Concomitantly, glucose uptake was reduced in 5-d EBs.
In addition, the GLUT localization is clearly dependent on AhR signaling. TCDD-induced changes did not occur after AhR inhibition by -NF. In nontreated P19 cells, the GLUT1 isoform was located in the PM, indicating that this isoform is responsible for the import of glucose into the cell. The effect of TCDD on GLUT1 localization became visible after 24 h, indicating that not only the transcriptional and primary translation processes were affected, but also protein processing and shuttling. Furthermore, we could show that a 48-h exposure at the beginning of the differentiation process disturbed the subcellular GLUT localization later in differentiation. After TCDD treatment, GLUT1 was localized around the nucleus.
The import of glucose, the rate-limiting step for most metabolic processes, is highly sensitively regulated. This study reveals that TCDD down-regulates GLUTs and disturbs the cellular assembling of glucose transport channels in dioxin-exposed ECCs. The impaired GLUT expression correlates with reduced glucose uptake and mitochondrial activity. The dysregulation of GLUTs by TCDD can be restored by an inhibition of the AhR. In conclusion, one possible mechanism of embryo toxicity of dioxins could be a specific disturbance of glucose transport and subsequent cellular glucose metabolism, followed by developmental retardation and contributing to early embryo loss.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
Disclosure Statement: The authors have nothing to disclose.
First Published Online September 13, 2007
Abbreviations: AhR, Arylhydrocarbon receptor; ARNT, arylhydrocarbon receptor nuclear translocator; CT, cycle threshold; CYP1A1, cytochrome P450 1A1; DMSO, dimethyl sulfoxide; EB, embryoid body; ECC, embryonic carcinoma cell; ES, embryonic stem; GLUT, glucose transporter; 3H-OMG, 3-O-methyl-D-[1-3H] glucose; IM, inner membrane; -MHC, -myosin heavy chain; -NF, -naphthoflavone; PM, plasma membrane; TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; XRE, xenobiotic response element.
Received February 27, 2007.
Accepted for publication September 6, 2007.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Endocrinology | Endocrine Reviews | J. Clin. End. & Metab. |
| Molecular Endocrinology | Recent Prog. Horm. Res. | All Endocrine Journals |
, P < 0.05 to the solvent control.
